ID: 1141094316

View in Genome Browser
Species Human (GRCh38)
Location 16:81152169-81152191
Sequence GTGCCATGTGTACAGGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141094316_1141094321 0 Left 1141094316 16:81152169-81152191 CCATTAACCTGTACACATGGCAC No data
Right 1141094321 16:81152192-81152214 CAAGCTCAGGGCCAGCGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141094316 Original CRISPR GTGCCATGTGTACAGGTTAA TGG (reversed) Intergenic
No off target data available for this crispr