ID: 1141094321

View in Genome Browser
Species Human (GRCh38)
Location 16:81152192-81152214
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141094317_1141094321 -7 Left 1141094317 16:81152176-81152198 CCTGTACACATGGCACCAAGCTC No data
Right 1141094321 16:81152192-81152214 CAAGCTCAGGGCCAGCGTCCAGG No data
1141094316_1141094321 0 Left 1141094316 16:81152169-81152191 CCATTAACCTGTACACATGGCAC No data
Right 1141094321 16:81152192-81152214 CAAGCTCAGGGCCAGCGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141094321 Original CRISPR CAAGCTCAGGGCCAGCGTCC AGG Intergenic