ID: 1141094485

View in Genome Browser
Species Human (GRCh38)
Location 16:81153404-81153426
Sequence ACCTGGGAACAGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141094485_1141094491 -10 Left 1141094485 16:81153404-81153426 CCTCCTTCCCTCTGTTCCCAGGT No data
Right 1141094491 16:81153417-81153439 GTTCCCAGGTGCTGGTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141094485 Original CRISPR ACCTGGGAACAGAGGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr