ID: 1141097075

View in Genome Browser
Species Human (GRCh38)
Location 16:81170534-81170556
Sequence GGTCAGAGAAGACCCCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141097072_1141097075 6 Left 1141097072 16:81170505-81170527 CCATATGGGCAGGTACAGTAGGC No data
Right 1141097075 16:81170534-81170556 GGTCAGAGAAGACCCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141097075 Original CRISPR GGTCAGAGAAGACCCCCAGA AGG Intergenic
No off target data available for this crispr