ID: 1141108624

View in Genome Browser
Species Human (GRCh38)
Location 16:81253921-81253943
Sequence TGTCACCAGGCTAAGGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 1, 2: 14, 3: 60, 4: 341}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141108624_1141108628 3 Left 1141108624 16:81253921-81253943 CCACTGCCCTTAGCCTGGTGACA 0: 1
1: 1
2: 14
3: 60
4: 341
Right 1141108628 16:81253947-81253969 AGACCCTGTCTCACAAAGAAAGG 0: 1
1: 21
2: 214
3: 706
4: 1341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141108624 Original CRISPR TGTCACCAGGCTAAGGGCAG TGG (reversed) Intronic