ID: 1141108625

View in Genome Browser
Species Human (GRCh38)
Location 16:81253927-81253949
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141108625_1141108628 -3 Left 1141108625 16:81253927-81253949 CCCTTAGCCTGGTGACAGCAAGA 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1141108628 16:81253947-81253969 AGACCCTGTCTCACAAAGAAAGG 0: 1
1: 21
2: 214
3: 706
4: 1341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141108625 Original CRISPR TCTTGCTGTCACCAGGCTAA GGG (reversed) Intronic