ID: 1141108626 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:81253928-81253950 |
| Sequence | GTCTTGCTGTCACCAGGCTA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 196 | |||
| Summary | {0: 1, 1: 0, 2: 5, 3: 15, 4: 175} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1141108626_1141108628 | -4 | Left | 1141108626 | 16:81253928-81253950 | CCTTAGCCTGGTGACAGCAAGAC | 0: 1 1: 0 2: 5 3: 15 4: 175 |
||
| Right | 1141108628 | 16:81253947-81253969 | AGACCCTGTCTCACAAAGAAAGG | 0: 1 1: 21 2: 214 3: 706 4: 1341 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1141108626 | Original CRISPR | GTCTTGCTGTCACCAGGCTA AGG (reversed) | Intronic | ||