ID: 1141108627 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:81253934-81253956 |
| Sequence | GACAGGGTCTTGCTGTCACC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 720 | |||
| Summary | {0: 3, 1: 13, 2: 66, 3: 174, 4: 464} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1141108627_1141108628 | -10 | Left | 1141108627 | 16:81253934-81253956 | CCTGGTGACAGCAAGACCCTGTC | 0: 3 1: 13 2: 66 3: 174 4: 464 |
||
| Right | 1141108628 | 16:81253947-81253969 | AGACCCTGTCTCACAAAGAAAGG | 0: 1 1: 21 2: 214 3: 706 4: 1341 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1141108627 | Original CRISPR | GACAGGGTCTTGCTGTCACC AGG (reversed) | Intronic | ||