ID: 1141108627

View in Genome Browser
Species Human (GRCh38)
Location 16:81253934-81253956
Sequence GACAGGGTCTTGCTGTCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 720
Summary {0: 3, 1: 13, 2: 66, 3: 174, 4: 464}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141108627_1141108628 -10 Left 1141108627 16:81253934-81253956 CCTGGTGACAGCAAGACCCTGTC 0: 3
1: 13
2: 66
3: 174
4: 464
Right 1141108628 16:81253947-81253969 AGACCCTGTCTCACAAAGAAAGG 0: 1
1: 21
2: 214
3: 706
4: 1341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141108627 Original CRISPR GACAGGGTCTTGCTGTCACC AGG (reversed) Intronic