ID: 1141108628

View in Genome Browser
Species Human (GRCh38)
Location 16:81253947-81253969
Sequence AGACCCTGTCTCACAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2283
Summary {0: 1, 1: 21, 2: 214, 3: 706, 4: 1341}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141108624_1141108628 3 Left 1141108624 16:81253921-81253943 CCACTGCCCTTAGCCTGGTGACA 0: 1
1: 1
2: 14
3: 60
4: 341
Right 1141108628 16:81253947-81253969 AGACCCTGTCTCACAAAGAAAGG 0: 1
1: 21
2: 214
3: 706
4: 1341
1141108626_1141108628 -4 Left 1141108626 16:81253928-81253950 CCTTAGCCTGGTGACAGCAAGAC 0: 1
1: 0
2: 5
3: 15
4: 175
Right 1141108628 16:81253947-81253969 AGACCCTGTCTCACAAAGAAAGG 0: 1
1: 21
2: 214
3: 706
4: 1341
1141108627_1141108628 -10 Left 1141108627 16:81253934-81253956 CCTGGTGACAGCAAGACCCTGTC 0: 3
1: 13
2: 66
3: 174
4: 464
Right 1141108628 16:81253947-81253969 AGACCCTGTCTCACAAAGAAAGG 0: 1
1: 21
2: 214
3: 706
4: 1341
1141108625_1141108628 -3 Left 1141108625 16:81253927-81253949 CCCTTAGCCTGGTGACAGCAAGA 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1141108628 16:81253947-81253969 AGACCCTGTCTCACAAAGAAAGG 0: 1
1: 21
2: 214
3: 706
4: 1341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141108628 Original CRISPR AGACCCTGTCTCACAAAGAA AGG Intronic
Too many off-targets to display for this crispr