ID: 1141108780

View in Genome Browser
Species Human (GRCh38)
Location 16:81255029-81255051
Sequence CAGCAGTTTGAGAGGCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8522
Summary {0: 1, 1: 3, 2: 235, 3: 3378, 4: 4905}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141108780_1141108785 6 Left 1141108780 16:81255029-81255051 CCTCTGGGCCTCTCAAACTGCTG 0: 1
1: 3
2: 235
3: 3378
4: 4905
Right 1141108785 16:81255058-81255080 CAGGCATGAGCCATTGCACCTGG 0: 315
1: 7781
2: 29726
3: 76156
4: 132986
1141108780_1141108786 13 Left 1141108780 16:81255029-81255051 CCTCTGGGCCTCTCAAACTGCTG 0: 1
1: 3
2: 235
3: 3378
4: 4905
Right 1141108786 16:81255065-81255087 GAGCCATTGCACCTGGCCCCAGG 0: 2
1: 32
2: 228
3: 883
4: 2343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141108780 Original CRISPR CAGCAGTTTGAGAGGCCCAG AGG (reversed) Intronic
Too many off-targets to display for this crispr