ID: 1141110140

View in Genome Browser
Species Human (GRCh38)
Location 16:81265456-81265478
Sequence GTGGGTAGATAGATGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1329
Summary {0: 1, 1: 3, 2: 33, 3: 231, 4: 1061}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141110140 Original CRISPR GTGGGTAGATAGATGGTGGA TGG (reversed) Intronic
900032089 1:379527-379549 GTAGGTAGATATATGATAGATGG - Intergenic
900052638 1:607713-607735 GTAGGTAGATATATGATAGATGG - Intergenic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900498152 1:2985943-2985965 GTGGATGGATGGATGATGGATGG - Intergenic
900498155 1:2985958-2985980 GTGAATGGATGGATGGTGGATGG - Intergenic
900498159 1:2985973-2985995 GATGGTAGATGGATGGTGAATGG - Intergenic
900498754 1:2989403-2989425 GTGGATGGATGGATGATGGATGG - Intergenic
900509449 1:3051637-3051659 GTGGGTAGATGGGTGATGGATGG - Intergenic
900509450 1:3051641-3051663 GTGGGTGGGTAGATGGGTGATGG - Intergenic
900573330 1:3370817-3370839 ATGGATGAATAGATGGTGGATGG - Intronic
900573469 1:3371461-3371483 ATGGATGGATAGATGGTGGATGG - Intronic
900573486 1:3371516-3371538 ATGGATGGATAGATGGTGGATGG - Intronic
900869345 1:5290828-5290850 ATGGGTGGATGGATGGTGGATGG + Intergenic
900869348 1:5290839-5290861 GATGGTGGATGGATGGTGGATGG + Intergenic
900884717 1:5406547-5406569 ATGGGTAGATAGATAATAGATGG + Intergenic
901001369 1:6150510-6150532 ATGGATGGATGGATGGTGGATGG + Intronic
901006594 1:6174672-6174694 GTGGAAGGATGGATGGTGGATGG + Intronic
901006615 1:6174786-6174808 GTGGATGGATGAATGGTGGATGG + Intronic
901006632 1:6174885-6174907 ATGGATGGATAGATGGTGGGTGG + Intronic
901006779 1:6175551-6175573 GTGGATGGGTGGATGGTGGATGG + Intronic
901134402 1:6983782-6983804 ATAGGTGGATAGATGGTTGATGG + Intronic
901134403 1:6983786-6983808 GTGGATAGATGGTTGATGGATGG + Intronic
901699820 1:11039315-11039337 GTGGATGGAAGGATGGTGGATGG + Intronic
901700108 1:11040771-11040793 GTGGGTGGATAAAGGATGGATGG + Intronic
901700220 1:11041325-11041347 GTAGGTAGAAGGATGATGGATGG + Intronic
901700270 1:11041584-11041606 GTGGGTGGATGGATGGTGGATGG + Intronic
901849634 1:12007309-12007331 GTGGGAAGAGAGATGGGGAAGGG - Intronic
902332754 1:15738546-15738568 GTGGGTAGAGAGCTGTTGCAGGG + Intronic
902621821 1:17655251-17655273 GTGGATAGATGGATGGATGATGG - Intronic
902658528 1:17885916-17885938 GTGGGTGGATAGATGGGGTGAGG + Intergenic
902722839 1:18315577-18315599 GTGGATGGGTAGAGGGTGGATGG + Intronic
902722855 1:18315650-18315672 ATGGGTAGATGGATGGAGAATGG + Intronic
903224410 1:21886711-21886733 ATGGGTGGATAGATGGATGAAGG + Intronic
903277390 1:22230901-22230923 GTGGGTGGATGGATGATGGGTGG - Intergenic
903277440 1:22231095-22231117 GTGGGTGGATGGATGATGGGTGG - Intergenic
903578401 1:24353371-24353393 GTGGGCAGGTGGATGGAGGATGG + Intronic
903578432 1:24353501-24353523 ATGGGTGGGTAGATGGTGGATGG + Intronic
904269093 1:29337499-29337521 ATGAGTACATAGATGGTGGCAGG - Intergenic
904464546 1:30700086-30700108 ATGGATGGATAGGTGGTGGAGGG - Intergenic
904487970 1:30840120-30840142 GTGGGTGGATGGATGATGGATGG + Intergenic
904933291 1:34107636-34107658 GTGGGTGGATGGATGAAGGATGG + Intronic
904993706 1:34614534-34614556 GTGGATGGATGGATGGTGGGTGG + Intergenic
905182158 1:36174170-36174192 GGTGGTAGATAGATGTTTGAAGG + Intronic
905272039 1:36793675-36793697 GTGGATGGATGGGTGGTGGATGG + Intergenic
905885505 1:41489686-41489708 ATGGATAGAAAGAAGGTGGATGG - Intergenic
905885551 1:41489884-41489906 ATGGATAGAAAGAAGGTGGATGG - Intergenic
906138775 1:43520648-43520670 GTGGGGAGCTGGATGGGGGAGGG + Intergenic
907313393 1:53552635-53552657 CTGGGAGGATGGATGGTGGAGGG - Intronic
907446208 1:54509551-54509573 GTGGGTAGATTGCAGGTGGAGGG - Intergenic
907814340 1:57903503-57903525 TTGGGGAGAAAGAAGGTGGAAGG - Intronic
908116025 1:60941047-60941069 GGGGGTAGGAAGATGGGGGATGG + Intronic
908962809 1:69721123-69721145 GTGTGGGGATAGATGGTGAATGG - Intronic
909469299 1:76008822-76008844 GTGGGAAGAGAGAGGGAGGAAGG - Intergenic
912230620 1:107788340-107788362 GTGGGCAGAGTGAGGGTGGAAGG - Intronic
912727991 1:112076091-112076113 GTGGGTAGATGGATTGGTGAAGG + Intergenic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
914351247 1:146842484-146842506 GTGGGTGAATGGATGATGGATGG + Intergenic
914351294 1:146842716-146842738 GTGGGTGGGTGGATGATGGATGG + Intergenic
914351330 1:146842867-146842889 GTGGGTAGGGAGATGATGGATGG + Intergenic
914351337 1:146842890-146842912 GTGGATAGGTGGATGGTGGATGG + Intergenic
914351362 1:146842978-146843000 GTGGGTGGATGGATGATGGCAGG + Intergenic
914351393 1:146843115-146843137 ATGGATAGATAGATGATGGATGG + Intergenic
915818302 1:158993675-158993697 GAGGGTAGAGAGTTGGAGGAGGG - Intergenic
916214097 1:162381472-162381494 GTGGGTTGGAAGCTGGTGGAGGG - Intronic
916332240 1:163629861-163629883 TTAAGTAAATAGATGGTGGATGG - Intergenic
916875023 1:168959883-168959905 GTGGGGAGAGAGATGGGGTAGGG - Intergenic
916991781 1:170252209-170252231 ATGGGTGGATAGATAATGGATGG - Intergenic
917020182 1:170578365-170578387 GTGGGAAGAGAGTTGGTGAAGGG + Intergenic
917435139 1:175013371-175013393 GTGTCTAGATAGATGGTAGAGGG - Exonic
919490326 1:198198084-198198106 GTGGATTGATAGGTGGTGGGTGG + Intronic
919922272 1:202173655-202173677 ATGGATGGATGGATGGTGGATGG - Intergenic
921087582 1:211810333-211810355 GACGGAAGATAGAGGGTGGAAGG + Intronic
922027487 1:221764210-221764232 TTAAGTAAATAGATGGTGGATGG + Intergenic
922745787 1:228042865-228042887 ATGGATAGATGGGTGGTGGATGG + Intronic
922790891 1:228310379-228310401 GTGAATGGATGGATGGTGGATGG - Intronic
922792821 1:228319541-228319563 ATGGGTGGATGAATGGTGGATGG - Intronic
922792838 1:228319638-228319660 ATGGATAGATGAATGGTGGATGG - Intronic
922792933 1:228320339-228320361 ATGGATGGATAGATGGTGGATGG - Intronic
922905729 1:229172301-229172323 GTGGGTAGGGAGATGATTGAGGG + Intergenic
923410209 1:233700614-233700636 GTGGGTACATAGCAGGTGGTGGG - Intergenic
1062928762 10:1338727-1338749 GTGGATAGAGAGGTGGAGGAAGG + Intronic
1062940159 10:1414930-1414952 GTGGATGGATGGATGGTGGATGG + Intronic
1062940165 10:1414953-1414975 GTGGGTGGCTATATGGTGAATGG + Intronic
1062940208 10:1415134-1415156 ATGGGTGGATGTATGGTGGATGG + Intronic
1062940218 10:1415185-1415207 GTGGGTGAACAGATGGTGGATGG + Intronic
1062943720 10:1444374-1444396 GTAGATAGATGGATGGTGAATGG - Intronic
1062943725 10:1444411-1444433 GTGGGTGGATGGATAGAGGATGG - Intronic
1063088246 10:2838883-2838905 GTGAGTAGAAAGCTTGTGGATGG - Intergenic
1063450409 10:6146367-6146389 TGGGGTAGAGAGATGGGGGAGGG + Exonic
1063655192 10:7981258-7981280 GTGGGTGAATAGATGGAAGAGGG - Intronic
1063658788 10:8018657-8018679 GTGGATAGAAAGATGATGTATGG - Intergenic
1063816514 10:9780645-9780667 ATAGATAGATAGATGATGGATGG - Intergenic
1063957991 10:11283628-11283650 GTGGGTGGATGCATGGTTGATGG + Intronic
1063958242 10:11284773-11284795 GTGGATGGATGGATGGTGGATGG + Intronic
1064132361 10:12721505-12721527 ATGGATGGATGGATGGTGGATGG - Intronic
1065204064 10:23341733-23341755 CTGGGTAGAAAGATGGTGCCTGG - Intronic
1065850097 10:29780721-29780743 CTGGGTATTTAAATGGTGGATGG - Intergenic
1065860674 10:29870310-29870332 ATGGTTAGACAGATGGTGGTTGG - Intergenic
1065860679 10:29870336-29870358 ATGGATGGATGGATGGTGGATGG - Intergenic
1065860732 10:29870592-29870614 GATGGTAGATGGGTGGTGGATGG - Intergenic
1066243344 10:33558922-33558944 GTGGGTTGATAGGTGGTTGATGG - Intergenic
1067709598 10:48637459-48637481 GTAGATGGATAGATGGTAGATGG + Intronic
1067709622 10:48637580-48637602 ATGGATGGATAAATGGTGGATGG + Intronic
1067808236 10:49407907-49407929 GTGGGTGGATGGAAGGAGGAAGG + Intergenic
1067878462 10:50024431-50024453 TTGGGTAGATGGAGGGGGGAAGG - Intergenic
1067893260 10:50153497-50153519 TTGGGTAGATGGAGGGGGGAAGG + Intergenic
1068063993 10:52105767-52105789 GAGGGTAGAGAGTTGGGGGAGGG - Intronic
1070792203 10:79196265-79196287 GTGGGTAGATGGATGGCAGGAGG - Intronic
1073467170 10:103700964-103700986 ATGGATGGATGGATGGTGGATGG - Intronic
1073467179 10:103701013-103701035 ATGGATGGATGGATGGTGGATGG - Intronic
1073467185 10:103701036-103701058 ATGGATGGATGGATGGTGGATGG - Intronic
1073467213 10:103701172-103701194 ATGGATGGATGGATGGTGGATGG - Intronic
1073467254 10:103701387-103701409 GTGGATGGATGGATGATGGATGG - Intronic
1073467257 10:103701402-103701424 GTGGATGGATGGATGGTGGATGG - Intronic
1073467261 10:103701417-103701439 GATGGTGGATGGATGGTGGATGG - Intronic
1073467264 10:103701428-103701450 ATGAATGGATAGATGGTGGATGG - Intronic
1073467279 10:103701511-103701533 GTGGATGGATGGATGATGGATGG - Intronic
1073467282 10:103701526-103701548 GTGGATGGATGGATGGTGGATGG - Intronic
1073467297 10:103701608-103701630 GTGGATGGATGGATGATGGATGG - Intronic
1073467303 10:103701634-103701656 ATGGATGGATAGATGATGGATGG - Intronic
1073467339 10:103701845-103701867 GATGGTAAATGGATGGTGGATGG - Intronic
1073467359 10:103701946-103701968 GATGGTAGATAGATGATGGATGG - Intronic
1073467364 10:103701979-103702001 ATGGATGGATGGATGGTGGATGG - Intronic
1073467376 10:103702031-103702053 ATGGATAGATGGATGATGGATGG - Intronic
1073467377 10:103702035-103702057 GTGGATGGATAGATGGATGATGG - Intronic
1073467399 10:103702161-103702183 ATGGATGGATGGATGGTGGATGG - Intronic
1073630289 10:105141397-105141419 GTGGGGACAGAGAGGGTGGAGGG + Intronic
1074186899 10:111105610-111105632 GTGGGAATACAGATGATGGAGGG - Intergenic
1074767894 10:116714036-116714058 GTGGGTGGATGGTGGGTGGATGG + Intronic
1074873164 10:117593786-117593808 GCTGGTATATAGAAGGTGGATGG + Intergenic
1075329940 10:121566661-121566683 GTGGGCAGGTGTATGGTGGAGGG - Intronic
1075803716 10:125170133-125170155 GTGGGGAGATAGGTGGTGGTGGG + Intergenic
1076136771 10:128050430-128050452 ATGGGTGGATGGATGATGGATGG + Intronic
1076453729 10:130575096-130575118 GTGGGTAGATACCAGCTGGAGGG - Intergenic
1076676726 10:132150941-132150963 GATGATAGATAGATGGAGGATGG - Intronic
1076844953 10:133065483-133065505 ATGGATGGATGGATGGTGGATGG + Intergenic
1076844956 10:133065494-133065516 GATGGTGGATGGATGGTGGATGG + Intergenic
1076844959 10:133065505-133065527 GATGGTGGATGGATGGTGGATGG + Intergenic
1076844985 10:133065582-133065604 GTGGATGGATGGATGGTGGATGG + Intergenic
1076844988 10:133065593-133065615 GATGGTGGATGGATGGTGGATGG + Intergenic
1076844999 10:133065635-133065657 GTGGATGGATTGATGATGGATGG + Intergenic
1076845004 10:133065654-133065676 ATGGATAGATGGAGGGTGGATGG + Intergenic
1076845018 10:133065705-133065727 ATGGGTGGATGGATGGTGAATGG + Intergenic
1076845049 10:133065802-133065824 AGGGATGGATAGATGGTGGATGG + Intergenic
1076845054 10:133065817-133065839 GTGGATGGATGGAGGGTGGACGG + Intergenic
1076845121 10:133066046-133066068 ATGGGTGGATAGATGGTGGATGG + Intergenic
1076845126 10:133066061-133066083 GTGGATGGATGGAGGGTGGATGG + Intergenic
1076845138 10:133066100-133066122 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076845186 10:133066247-133066269 GTGGATGGATGGATGGTGGATGG + Intergenic
1076845225 10:133066368-133066390 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076845241 10:133066417-133066439 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076845254 10:133066450-133066472 ATGGGTGGATGGTTGGTGGATGG + Intergenic
1076845269 10:133066508-133066530 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076845285 10:133066557-133066579 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076845298 10:133066590-133066612 ATGGGTGGATGGTTGGTGGATGG + Intergenic
1076845313 10:133066648-133066670 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076845355 10:133066760-133066782 GTGGATGGGTGGATGGTGGATGG + Intergenic
1076867468 10:133175118-133175140 ATGGGTGGATGGATGGTGGGTGG + Intronic
1076867588 10:133175651-133175673 GTGGATAGATGGGTGGAGGATGG + Intronic
1076931874 10:133536885-133536907 ATGGGTGGATGGATGGAGGATGG + Intronic
1077015139 11:395995-396017 GTGGGTGGGCAGAGGGTGGAGGG - Intronic
1077159474 11:1106174-1106196 TTGGGTAGGTGGATGGTGGATGG - Intergenic
1077159485 11:1106209-1106231 GATGGTAGATGGATGGTGGATGG - Intergenic
1077159495 11:1106246-1106268 GTGGATGGATGGATGGTGGATGG - Intergenic
1077159503 11:1106276-1106298 GTGGGTGGGTGGATGGTAGATGG - Intergenic
1077159513 11:1106311-1106333 GATGGTAGACAGATGGTGGATGG - Intergenic
1077159524 11:1106357-1106379 GATGGTAGACAGATGGTGGATGG - Intergenic
1077159547 11:1106443-1106465 GATGGTAGACAGATGGTGGGTGG - Intergenic
1077159570 11:1106513-1106535 ATGGATGGATGGATGGTGGATGG - Intergenic
1077159577 11:1106540-1106562 GATGGTAGATGGATGGTGGATGG - Intergenic
1077248986 11:1552313-1552335 GTGGGTAGATGGGTGGATGAGGG - Intergenic
1077280507 11:1742914-1742936 ATGGATAGATGGATGGAGGATGG + Intronic
1077280512 11:1742937-1742959 ATGGATAGATGGATGGAGGATGG + Intronic
1077312157 11:1893680-1893702 ATGGATAGATAGATAATGGAGGG + Intergenic
1077312208 11:1893937-1893959 GTGGGTGGATGGATGGGTGAAGG + Intergenic
1078028236 11:7720535-7720557 GTTGGTAGCTTGATGGGGGATGG - Intergenic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078093443 11:8282146-8282168 ATGGATAGATACATGGTGGGTGG + Intergenic
1078215903 11:9311587-9311609 GTGGGTTGATAGGTGGTGAGTGG + Intronic
1078421082 11:11213510-11213532 GGGGCTAGATAGGAGGTGGAAGG - Intergenic
1079367107 11:19819054-19819076 GTGGGTGGGTAGATGGATGAAGG - Intronic
1079515750 11:21266308-21266330 ATAGGTAGATAGATGATTGATGG - Intronic
1079602871 11:22331029-22331051 TTGGGTAGAGAGATGGAGGCAGG - Intergenic
1080163287 11:29205102-29205124 GTAGGTAGATAGATGATGAAAGG - Intergenic
1080415115 11:32062562-32062584 ATGGATGGATGGATGGTGGATGG + Intronic
1081674404 11:44960208-44960230 GTGGGAAGAGAAAAGGTGGAGGG + Intergenic
1081738341 11:45420805-45420827 ATGGGTAGATAGGTGGATGACGG - Intergenic
1083201253 11:61122360-61122382 GTGGGTGGATGGATGATGGATGG + Intronic
1083293668 11:61703652-61703674 GTGAGTGGGTAGATGGAGGATGG + Intronic
1083826896 11:65209044-65209066 TTGGGTAGAAAGATGGGGCAGGG - Intronic
1083989851 11:66240300-66240322 GGGGGCAGAGAGAGGGTGGAGGG + Intronic
1084413444 11:69016880-69016902 GTGGATGGATGGATGATGGATGG - Intergenic
1084413445 11:69016884-69016906 GTGGGTGGATGGATGGATGATGG - Intergenic
1084464718 11:69315529-69315551 GTGGGTGGATGGGTGATGGATGG + Intronic
1084543902 11:69804227-69804249 ATGGATAGATGGATGATGGATGG + Intergenic
1084545957 11:69815199-69815221 ATGGATAGGTGGATGGTGGATGG + Intronic
1084576524 11:69992156-69992178 GTGGGTAGATGAATGGATGATGG + Intergenic
1084596323 11:70119015-70119037 GTGGGTGGATGGATGATGGAAGG + Intronic
1084596358 11:70119177-70119199 GTGGGTGGATGGGTGATGGAAGG + Intronic
1084596394 11:70119313-70119335 GTGGGTGGATGGATGATGGAAGG + Intronic
1084596402 11:70119354-70119376 GTGGGTGGATGAATGATGGATGG + Intronic
1084609661 11:70194152-70194174 ATGGATGGATGGATGGTGGATGG + Intergenic
1084609760 11:70194630-70194652 ATGGATGGATGGATGGTGGATGG + Intergenic
1084609817 11:70194932-70194954 ATGGGTGGGTAGATGGTAGATGG + Intergenic
1084609818 11:70194936-70194958 GTGGGTAGATGGTAGATGGATGG + Intergenic
1084609820 11:70194943-70194965 GATGGTAGATGGATGGTGGATGG + Intergenic
1084609837 11:70195037-70195059 ATGGATGGATGGATGGTGGATGG + Intergenic
1084684656 11:70686492-70686514 ATGGATAGACAGATGATGGATGG - Intronic
1084773455 11:71359118-71359140 GTGAATAGAAAGATGATGGATGG - Intergenic
1084781803 11:71414780-71414802 GTGGGTAGATGGATGATGGATGG + Intergenic
1084781846 11:71414986-71415008 ATGGGTAGATGGATGATGGATGG + Intergenic
1084785710 11:71440584-71440606 GAGGGTAGATGGATGGATGATGG + Intronic
1084958971 11:72706269-72706291 CTGGGTAGAAAGATGAAGGAGGG - Intronic
1085271568 11:75273068-75273090 GTGGCTAGCCAGATGGGGGATGG - Intronic
1085406834 11:76268536-76268558 ATGGATGGATGGATGGTGGAGGG - Intergenic
1085406877 11:76268699-76268721 GTGGATGGATGGATGATGGATGG - Intergenic
1085528583 11:77178329-77178351 GTGGATGGATGGATGGTGGATGG - Intronic
1085690327 11:78658997-78659019 GTGGGTGGATGGATGGATGAAGG - Intronic
1087832969 11:102839618-102839640 GTGTGTAGAAAGATTCTGGAAGG + Intronic
1088105278 11:106200063-106200085 ATAGGTAGATAGATGATAGATGG - Intergenic
1088695871 11:112365533-112365555 GTGGGTGGATGAATGGCGGATGG - Intergenic
1089129171 11:116198948-116198970 CTGGGTAGAAAGAAGTTGGAGGG + Intergenic
1089276019 11:117336530-117336552 GTGGATTGATAGGTGGTGGGTGG + Intronic
1089457514 11:118634181-118634203 GTGGGTACAGAGGGGGTGGACGG - Intronic
1089682550 11:120127253-120127275 GTGGATGGATGGATGTTGGAGGG + Intronic
1089998926 11:122936499-122936521 GTAGATAGATAGATGATAGATGG + Intronic
1090857096 11:130619709-130619731 ATGGATAGATGGATGGAGGATGG - Intergenic
1091187346 11:133658421-133658443 GTGGGTGGATGGATGGATGATGG + Intergenic
1091187383 11:133658556-133658578 GTGGGTGTATAGATGGATGATGG + Intergenic
1091321159 11:134652961-134652983 GTGGGAAGGGAGATGGAGGAGGG - Intergenic
1091502013 12:1027633-1027655 GTGAGTACATACATGGTAGAAGG + Intronic
1092660109 12:10729481-10729503 GTGGGTCCTTACATGGTGGAAGG + Intergenic
1094810295 12:34130377-34130399 CTGGGTAGATACATGGTAGTGGG - Intergenic
1096406438 12:51347313-51347335 GAGGGTAGATGGAGGGTGGAGGG + Intergenic
1096595626 12:52693228-52693250 GTGGGAAGCTATATGGTGGGTGG - Intronic
1097240962 12:57575003-57575025 ATGGGTAGGTAGAAGGTGGGAGG + Intronic
1097946933 12:65379222-65379244 ATGGATGGGTAGATGGTGGATGG - Intronic
1098534017 12:71574523-71574545 ATGGGTAGAGAGATGATAGAAGG - Intronic
1099011701 12:77298885-77298907 GTGGGGATAGAGATAGTGGAAGG - Intergenic
1100224907 12:92546644-92546666 GAGTGTAGATAGGTGGAGGAAGG - Intergenic
1100841032 12:98612011-98612033 GTAGGTAGGTGGGTGGTGGATGG - Intergenic
1101369137 12:104108899-104108921 GTGGGTAGAATGGTGGTGGTGGG - Intergenic
1102043155 12:109813743-109813765 GTGGATAGATAGATGATATATGG + Intronic
1102401062 12:112630164-112630186 ATGGGTGGATGGATGATGGATGG - Intronic
1102504242 12:113373827-113373849 ATGGGTAGATGGATGGATGATGG - Intronic
1102507108 12:113390567-113390589 GTGGGTAGATGGATGATAAATGG - Exonic
1102507133 12:113390703-113390725 GTGGGTAGATGGATGATAAATGG - Exonic
1102640235 12:114360668-114360690 GTGGATAGATAGATGAGTGATGG + Intronic
1102785955 12:115604986-115605008 ATGGACAGATAGATGATGGATGG + Intergenic
1102813190 12:115841705-115841727 GTGGGAAGAGAGAAGGGGGAAGG - Intergenic
1102856099 12:116295468-116295490 ATGGGTAGATGGATGGAGGATGG + Intergenic
1102856118 12:116295549-116295571 GTGGGTGGATGGATAATGGATGG + Intergenic
1102856122 12:116295572-116295594 ATGGATGGATAGATGATGGATGG + Intergenic
1102856133 12:116295635-116295657 ATGGGTAGATGAATGATGGATGG + Intergenic
1102894442 12:116587478-116587500 ATGGGTAGCTAGATGGATGAAGG - Intergenic
1102920646 12:116789195-116789217 GTGGGTGGATGGATGGTAGATGG + Intronic
1102920697 12:116789423-116789445 GTGGGTGGATGGATGGTAGATGG + Intronic
1102920740 12:116789597-116789619 GTGGGTGGATGGATGGTAGATGG + Intronic
1102920811 12:116789895-116789917 GTGGGTGGATGGATGGTAGATGG + Intronic
1102920821 12:116789933-116789955 GTGGATGGATGGATGGTGGATGG + Intronic
1103024063 12:117559068-117559090 ATGGATGGATGGATGGTGGATGG + Intronic
1103435870 12:120925004-120925026 GAAGGTAAAGAGATGGTGGAAGG + Intergenic
1103444826 12:120987993-120988015 GTGGGTAGATGGATGATGGATGG - Intronic
1103444827 12:120987997-120988019 GTGGGTGGGTAGATGGATGATGG - Intronic
1103444842 12:120988056-120988078 GTGGGTGGATGGATGATGGATGG - Intronic
1103444859 12:120988119-120988141 GTGGGTGGATGGATGATGGATGG - Intronic
1103444876 12:120988182-120988204 GTGGGTAGATGGATGATGGATGG - Intronic
1103444877 12:120988186-120988208 GTGGGTGGGTAGATGGATGATGG - Intronic
1103444892 12:120988245-120988267 GTGGGTGGATGGATGATGGATGG - Intronic
1103444909 12:120988308-120988330 ATGGGTGGATGGATGATGGATGG - Intronic
1104034673 12:125090055-125090077 GTGGATGGATAGATGGATGAGGG - Intronic
1104092295 12:125526939-125526961 GTGGATAGAAGGGTGGTGGATGG - Intronic
1104310291 12:127648713-127648735 GTGGTTAGATAGATGTGTGATGG - Intergenic
1104417111 12:128604791-128604813 GATAGTAGATAGATGATGGATGG + Intronic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1104778428 12:131404731-131404753 GTGGGTGGATGGATGATGGGTGG - Intergenic
1104778449 12:131404805-131404827 GTGGATGGATGGATGATGGATGG - Intergenic
1104778505 12:131405022-131405044 GTGGATGGATGGATGATGGATGG - Intergenic
1104778520 12:131405084-131405106 GTGGATGGATGGATGATGGATGG - Intergenic
1104778534 12:131405135-131405157 GTGGATGGATGGATGATGGATGG - Intergenic
1104778549 12:131405190-131405212 GTGGGTGGATGGATGATGGATGG - Intergenic
1104778580 12:131405306-131405328 GTGGATGGATGGATGATGGATGG - Intergenic
1104778629 12:131405466-131405488 ATGGGTGGATGGATGATGGATGG - Intergenic
1104779309 12:131409677-131409699 GTGGATAGATGGATGATGGATGG - Intergenic
1104779310 12:131409681-131409703 ATGGGTGGATAGATGGATGATGG - Intergenic
1104813972 12:131635339-131635361 GAAGGTAGATGGATGATGGATGG - Intergenic
1104896087 12:132164537-132164559 GTGGGTGGACGGATGATGGATGG - Intergenic
1104896219 12:132166301-132166323 CTGGGTGGATGGATGATGGATGG - Intergenic
1104896270 12:132166519-132166541 CTGGGTGGATGGATGATGGATGG - Intergenic
1104896304 12:132166644-132166666 GTGGGTGGATGGATGGATGATGG - Intergenic
1104896388 12:132166955-132166977 ATGGGTAGGTGGATGATGGATGG - Intergenic
1104896431 12:132167121-132167143 GTGGGTGGATGGATGATGGATGG - Intergenic
1105565993 13:21548813-21548835 GGAGGTAGATAGAAGGTGGGAGG + Intronic
1108539964 13:51432295-51432317 GTGGGAGGATAGATGTTGTAGGG - Intronic
1109781533 13:67116704-67116726 TTGTGTATATTGATGGTGGATGG - Intronic
1113340371 13:109417123-109417145 ATGGATCGATAGATGATGGAAGG - Intergenic
1113417572 13:110140288-110140310 ATGGATGGATGGATGGTGGATGG + Intergenic
1113780265 13:112972745-112972767 GTGGGTGGATGGATGGAGGGAGG + Intronic
1113910468 13:113838967-113838989 GTGTGGAGGTAGATGGTGGGAGG + Intronic
1114146210 14:19980746-19980768 GTGGGTAGGTGGAAGCTGGATGG - Intergenic
1114498001 14:23147206-23147228 ATGGATGGATAGATGATGGATGG - Intronic
1114600679 14:23953604-23953626 GGCGGAAGGTAGATGGTGGAGGG + Exonic
1117267166 14:54101659-54101681 TTGGATAGATAGATGATGGATGG - Intergenic
1117445911 14:55803801-55803823 GTGTCTAGATGGGTGGTGGAAGG + Intergenic
1117819540 14:59633162-59633184 GTGTGGAGAGAGATGTTGGATGG + Intronic
1118722248 14:68602475-68602497 GTGGGTGGATGGATGATGGATGG + Intronic
1119157896 14:72428349-72428371 GTGGGTGGGTGGATGGTAGATGG + Intronic
1119177967 14:72583368-72583390 CTGGATAGATAGATGATAGACGG + Intergenic
1119648551 14:76366823-76366845 GTGGGTGGGTGGATGGTGCAGGG + Intronic
1121029945 14:90649760-90649782 GTGGATGGTTGGATGGTGGATGG - Intronic
1121029954 14:90649791-90649813 GTGGATGGGTGGATGGTGGATGG - Intronic
1121259617 14:92556525-92556547 ATGGGAAGATAGATGATGGATGG + Intronic
1121423186 14:93830050-93830072 ATGGATGGATGGATGGTGGATGG + Intergenic
1121423210 14:93830168-93830190 ATGGATGGATAGATGGAGGAAGG + Intergenic
1121504704 14:94467993-94468015 ATGGGTAGATGAAGGGTGGAGGG + Intronic
1121616730 14:95318839-95318861 TTGGGTGGATAGGTTGTGGAGGG + Intronic
1121637771 14:95465436-95465458 GTGGGTAGATAGGTGGTGAAGGG + Intronic
1121733534 14:96202742-96202764 GTGGGTGGATGGATGGAGGGAGG + Intergenic
1121816029 14:96929183-96929205 TTAGGTAGATGGATGGGGGATGG - Intronic
1122138379 14:99647443-99647465 GTGGGCAGGTGGATGGAGGAAGG + Intronic
1122140944 14:99662732-99662754 ATATGTAGATGGATGGTGGAAGG + Intronic
1122600599 14:102919802-102919824 GTTGGATGATGGATGGTGGATGG - Intergenic
1122600613 14:102919865-102919887 GTTGGATGATGGATGGTGGATGG - Intergenic
1122600656 14:102920050-102920072 GTTGGATGATGGATGGTGGATGG - Intergenic
1122600704 14:102920301-102920323 GTGGATGGATAGATGGTGGATGG - Intergenic
1122600758 14:102920568-102920590 GTGGATGGATGGATGGTGGATGG - Intergenic
1122600779 14:102920672-102920694 GTGGATGGATGAATGGTGGATGG - Intergenic
1122600787 14:102920703-102920725 GTGGATGGATGGATGGTGGATGG - Intergenic
1122600791 14:102920718-102920740 GTGGATAAGTGGATGGTGGATGG - Intergenic
1122600813 14:102920828-102920850 GTGAATAGGTGGATGGTGGATGG - Intergenic
1122600890 14:102921260-102921282 GTGAATAGATAGATGGTAAATGG - Intergenic
1122625190 14:103081780-103081802 GATGGTAGATGGTTGGTGGATGG + Intergenic
1122625217 14:103082025-103082047 ATGGATGGATAGGTGGTGGATGG + Intergenic
1122636984 14:103134671-103134693 ATAGGTAGATGGATGGTGGGTGG - Intronic
1122877520 14:104675678-104675700 GTGGGTGAATGGATGATGGATGG + Intergenic
1122958313 14:105083068-105083090 GTGGATGGATGGATGATGGAGGG - Intergenic
1122958335 14:105083149-105083171 GTGGATGGATGGATGATGGAGGG - Intergenic
1122958447 14:105083551-105083573 GTGGATAGAGAGATGGTGGATGG - Intergenic
1122958524 14:105083822-105083844 ATGGGTGGATGGAGGGTGGAGGG - Intergenic
1123058836 14:105585356-105585378 GTGGGTAGGCGGATGGAGGATGG - Intergenic
1123058880 14:105585543-105585565 GTGGGTAGATGAAGGATGGATGG - Intergenic
1125726870 15:41872604-41872626 ATGGGTAGATGGATGCTGGGTGG - Intronic
1126759613 15:51957431-51957453 ATGAGTAGATGGGTGGTGGAGGG + Intronic
1127559089 15:60118106-60118128 GTGGGGAGGTAGGTGGGGGAGGG + Intergenic
1128162857 15:65435832-65435854 GGGAGAAGATAGATGCTGGAAGG - Intergenic
1128773701 15:70302735-70302757 GTGGGTGGATAGGAAGTGGATGG + Intergenic
1129998981 15:80031088-80031110 GTGGATGGATAGATGATGGTTGG - Intergenic
1130912339 15:88279430-88279452 GTGGGGAGATAGACGGTGTGAGG + Intergenic
1131826596 15:96326556-96326578 GTGGTAGGAGAGATGGTGGAGGG + Intronic
1132030943 15:98438128-98438150 GTGGATGGATGGATGATGGATGG + Exonic
1132329100 15:100998610-100998632 GTGGGTAGGTAGAAAATGGATGG + Intronic
1132358493 15:101191874-101191896 GTGAGTAGATAGATGGATGAAGG - Intronic
1132653706 16:1032785-1032807 GTGGATGGATGGATGATGGATGG - Intergenic
1132653748 16:1032990-1033012 GTGGATGGATGGATGGTGGATGG - Intergenic
1132653760 16:1033060-1033082 GTGGATGGATGGATGATGGATGG - Intergenic
1132653776 16:1033142-1033164 ATGGATTGATGGATGGTGGATGG - Intergenic
1132653782 16:1033169-1033191 ATGGGTGGATGGATGGTGGATGG - Intergenic
1132653867 16:1033565-1033587 GTGGATGGATGGATGATGGATGG - Intergenic
1132653907 16:1033750-1033772 GTGGATGGATGGATGGTGGATGG - Intergenic
1132712021 16:1273085-1273107 ATGGGTAGACAGATGGTAGATGG + Intergenic
1133204868 16:4227230-4227252 GTGGGTGGATGGATGGATGAAGG + Intronic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1134105942 16:11486115-11486137 ATGGGTAGACAGATGATGGGTGG + Intronic
1134105983 16:11486306-11486328 ATGGGTAGACAGATGATGGGTGG + Intronic
1134106008 16:11486455-11486477 ATGGGTAGACAGATGATGGGTGG + Intronic
1134106023 16:11486539-11486561 GTGGGTGGATAGATGATGGGTGG + Intronic
1134106982 16:11492306-11492328 GTGGGTGGATGGATGATGGGTGG - Intronic
1134224423 16:12380445-12380467 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224428 16:12380460-12380482 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224454 16:12380540-12380562 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224460 16:12380559-12380581 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224468 16:12380582-12380604 ATGGGTGGATGGATGGTGGGTGG - Intronic
1134224475 16:12380601-12380623 GTGGATGGATGGATGGTGGATGG - Intronic
1134224482 16:12380624-12380646 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224488 16:12380643-12380665 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224495 16:12380662-12380684 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224500 16:12380677-12380699 GTGGATGGGTGGATGGTGGATGG - Intronic
1134224519 16:12380743-12380765 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224526 16:12380762-12380784 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224541 16:12380812-12380834 GTGGGTGGATGGATGGCGGGTGG - Intronic
1134224552 16:12380839-12380861 GTGGATGGATAGATGGTGGGTGG - Intronic
1134224557 16:12380858-12380880 GTGGATGGATAGATGGTGGGTGG - Intronic
1134224562 16:12380877-12380899 GTAGGTGGATGGATGGTGGGTGG - Intronic
1134224574 16:12380915-12380937 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224579 16:12380930-12380952 GTGGATGGATGGATGGTGGATGG - Intronic
1134224588 16:12380970-12380992 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224596 16:12380993-12381015 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224603 16:12381012-12381034 GTGGGTGGGTGGATGGTGGGTGG - Intronic
1134224609 16:12381027-12381049 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224616 16:12381046-12381068 GTGGGTAGATGGATGGTAGGTGG - Intronic
1134224621 16:12381065-12381087 GTGGGTGGATGGATGGTAGGTGG - Intronic
1134224627 16:12381084-12381106 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224636 16:12381107-12381129 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224647 16:12381134-12381156 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224653 16:12381153-12381175 GTGGATGGATGGATGGTGGGTGG - Intronic
1134224681 16:12381226-12381248 GTGGATAGGTAGATGGATGAGGG - Intronic
1134224700 16:12381294-12381316 GTGGGTAGATGGATAATGGGTGG - Intronic
1134224740 16:12381433-12381455 GTGGGTAGATGAATGATGGATGG - Intronic
1134224789 16:12381603-12381625 GTGGGTGGATGGATGATGGATGG - Intronic
1134488439 16:14677764-14677786 CTGGATAGATGGATGGTGGGTGG + Intronic
1134488442 16:14677779-14677801 GTGGGTGGATGGATGGAAGATGG + Intronic
1134488447 16:14677798-14677820 ATGGGTGGATGGATGATGGATGG + Intronic
1134819995 16:17239326-17239348 GTGGATGGATGGATGATGGATGG - Intronic
1134820023 16:17239464-17239486 GTGGATGGATGGATGATGGATGG - Intronic
1134820024 16:17239468-17239490 GTGGGTGGATGGATGGATGATGG - Intronic
1135400155 16:22161381-22161403 GTGGAAGGATAGATGATGGAAGG + Intergenic
1135931931 16:26745640-26745662 ATAGGTGGATAGATGGTGAATGG - Intergenic
1135933146 16:26756715-26756737 GTGGGTGGATGAATGATGGATGG + Intergenic
1136240418 16:28939873-28939895 TTGGGTAGCTGGATGGTGGGAGG - Intergenic
1136279092 16:29197593-29197615 GTGGGTGGATGTATGATGGATGG + Intergenic
1136295225 16:29297800-29297822 GTGGGTGGATGGATGGTGGGTGG + Intergenic
1137386121 16:48044097-48044119 GTGGTTGGATGGATGGTGGATGG - Intergenic
1137386128 16:48044120-48044142 GTGGATGGATGGATGGTGAATGG - Intergenic
1137569421 16:49555628-49555650 ATAGATGGATAGATGGTGGATGG + Intronic
1137579716 16:49626586-49626608 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579717 16:49626590-49626612 GTGGATGGGTAGATGGAGGATGG - Intronic
1137579735 16:49626696-49626718 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579753 16:49626771-49626793 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579770 16:49626846-49626868 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579792 16:49626947-49626969 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579801 16:49626982-49627004 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579818 16:49627057-49627079 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579841 16:49627158-49627180 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579856 16:49627225-49627247 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579867 16:49627272-49627294 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579878 16:49627319-49627341 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579891 16:49627374-49627396 ATGGATAGGTAGATGGAGGATGG - Intronic
1137579900 16:49627414-49627436 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579911 16:49627461-49627483 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579934 16:49627564-49627586 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579967 16:49627719-49627741 GCGGGTAGATAGAAGATGGATGG - Intronic
1137579999 16:49627862-49627884 ATGGGTAGATGGAGGATGGATGG - Intronic
1137580016 16:49627937-49627959 ATGGGTAGATGGAGGATGGATGG - Intronic
1137580028 16:49627985-49628007 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580037 16:49628028-49628050 ATGGGTAGATGGAAGATGGATGG - Intronic
1137580049 16:49628087-49628109 ATGGGTAGATGGAGGGTGGATGG - Intronic
1137580060 16:49628131-49628153 ATGGGTAGATGGACGATGGATGG - Intronic
1137580074 16:49628190-49628212 GTGGGTAGATGAAGGATGGATGG - Intronic
1137625577 16:49905934-49905956 ATGGGTGGATGGATGGTTGATGG + Intergenic
1138223029 16:55269239-55269261 GTGGATAGGTAGGTGGAGGATGG - Intergenic
1138445438 16:57060331-57060353 GTGGGAAGGAACATGGTGGAAGG - Intronic
1138495662 16:57407702-57407724 ATGGGTTGATGGATGATGGATGG - Intronic
1139982645 16:70872436-70872458 ATGGATGGATAGATGATGGATGG - Intronic
1139982701 16:70872660-70872682 GTGGATAGGTGGATGGTGGATGG - Intronic
1139982708 16:70872683-70872705 GTGGGTAGGGAGATGATGGATGG - Intronic
1139982789 16:70873062-70873084 GTGGGTGAATGGATGATGGATGG - Intronic
1140067641 16:71625228-71625250 GTGAGTGGATGAATGGTGGATGG + Intergenic
1140067682 16:71625367-71625389 GTGGGTGGATGGATGGTGGATGG + Intergenic
1140067740 16:71625550-71625572 GCGGGTAGATGGGTGGTGGATGG + Intergenic
1140067784 16:71625713-71625735 ATGGGTGGATGGATGGTGGATGG + Intergenic
1140310613 16:73844810-73844832 ATGGGTAGACAGATGGTAGACGG + Intergenic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1140678923 16:77364634-77364656 GTGGATGGATGGATGGTGGATGG + Intronic
1140783190 16:78315042-78315064 GATGATTGATAGATGGTGGATGG - Intronic
1140853252 16:78954301-78954323 CTGAGTGGATAGAAGGTGGATGG + Intronic
1140979405 16:80092487-80092509 ATGGGTGGGTAGATGGGGGATGG - Intergenic
1141031992 16:80597079-80597101 GTGGATAGATGGATGGATGATGG + Intergenic
1141048810 16:80742424-80742446 GTGGGTAGAAGGGTGGAGGATGG + Intronic
1141048837 16:80742584-80742606 GTGGGTAGATAGGTGGAGGATGG + Intronic
1141048887 16:80742869-80742891 GTGGGTAGATGGGTGAAGGATGG + Intronic
1141096795 16:81168573-81168595 GTGGGTGGATGGATGGTAGATGG + Intergenic
1141110048 16:81265060-81265082 GATGGTAAATAGATGATGGATGG - Intronic
1141110073 16:81265208-81265230 ATGGGTGGACGGATGGTGGATGG - Intronic
1141110102 16:81265317-81265339 GTGGGTAGATGGATGGATGGAGG - Intronic
1141110140 16:81265456-81265478 GTGGGTAGATAGATGGTGGATGG - Intronic
1141110200 16:81265689-81265711 GTAGGTAGATGGATGGTGGATGG - Intronic
1141110230 16:81265822-81265844 GTGGGTAGATGGATGAATGATGG - Intronic
1141110239 16:81265875-81265897 GTGGATGGATGGATGGTAGATGG - Intronic
1141110255 16:81265956-81265978 GTGGATGGATAGATGGTGGATGG - Intronic
1141163731 16:81646323-81646345 GTGGGTGAGTAGATGATGGATGG + Intronic
1141178356 16:81735318-81735340 ATGGATAGATAGATGGATGATGG + Intergenic
1141391324 16:83667074-83667096 ATGGATAGATGGATGATGGATGG + Intronic
1141421535 16:83921001-83921023 ATGGGTGGATGGATGGTGGAGGG + Exonic
1141421616 16:83921379-83921401 ATGGATAGATGGATGGAGGAGGG + Exonic
1141421637 16:83921444-83921466 GTGGGTGGATGGATGGCGCAGGG + Exonic
1141483827 16:84325571-84325593 GTGGGTGGATGGATGGTGGGTGG - Intronic
1141641867 16:85346301-85346323 ATGGGTGGATGGATGATGGATGG + Intergenic
1141642253 16:85348155-85348177 ATGGGTGGATGGATGATGGATGG - Intergenic
1141659375 16:85433708-85433730 GATGTTGGATAGATGGTGGATGG + Intergenic
1142083485 16:88163686-88163708 GTGGGTGGATGTATGATGGATGG + Intergenic
1142101126 16:88271811-88271833 GTGGGTGGATGGATGGTGGGTGG + Intergenic
1142124128 16:88401779-88401801 ATGGGTGGATGGATAGTGGATGG + Intergenic
1142124131 16:88401794-88401816 GTGGATGGATGGATGGTAGATGG + Intergenic
1142124138 16:88401821-88401843 TTGGGTGGATGGATGGTGGATGG + Intergenic
1142124194 16:88402064-88402086 ATGGATGGATAGATGGTAGATGG + Intergenic
1142124216 16:88402151-88402173 ATGGATGGAGAGATGGTGGATGG + Intergenic
1142152397 16:88518440-88518462 ATGGATAGATGGATGGTGGGTGG + Intronic
1142152629 16:88519433-88519455 ATGGATAGATGCATGGTGGATGG + Intronic
1142152860 16:88520443-88520465 GTGGGTAGATGGATGGTGGATGG + Intronic
1142244718 16:88964783-88964805 CTGGATGGATAGATGGTGGATGG - Intronic
1142244740 16:88964889-88964911 ATAAGTGGATAGATGGTGGATGG - Intronic
1142244761 16:88964981-88965003 ATGGATAAATAGATGGTGGGTGG - Intronic
1142248304 16:88979718-88979740 GTGGGTAGATGATGGGTGGATGG + Intergenic
1142248375 16:88979993-88980015 GTGGGTGAATGAATGGTGGATGG + Intergenic
1142248479 16:88980403-88980425 GTGGGTGAATGAATGGTGGATGG + Intergenic
1142255623 16:89012411-89012433 ATGGGTGGATGGATGGTGGATGG - Intergenic
1142255670 16:89012602-89012624 ATGGGTGGATGGATGGTGGGTGG - Intergenic
1142960568 17:3549974-3549996 ATGAGTGGATAGATGATGGATGG + Intronic
1143737740 17:8925085-8925107 GTGGATAGATAGAAAGTAGATGG + Intronic
1143737741 17:8925104-8925126 ATGGATAGATAGATAGTAGATGG + Intronic
1143737747 17:8925223-8925245 ATGGATAGATAGATAGTAGATGG + Intronic
1144100713 17:11939907-11939929 ATGGGTAGATGGGTGATGGATGG + Intronic
1144728573 17:17513992-17514014 GAGGATAGATGGATGGAGGAAGG - Intronic
1144839492 17:18177018-18177040 GTGGATAGATGGATGGATGAAGG + Intronic
1144966097 17:19078094-19078116 GTGGGTGGATGGATAGTGGGTGG + Intergenic
1144966098 17:19078098-19078120 GTGGATGGATAGTGGGTGGATGG + Intergenic
1144981870 17:19174091-19174113 GTGGATGGATAGTGGGTGGATGG - Intergenic
1144981871 17:19174095-19174117 GTGGGTGGATGGATAGTGGGTGG - Intergenic
1144986352 17:19204144-19204166 GTGGGTGGATGGATAGTGGGTGG + Intergenic
1144986353 17:19204148-19204170 GTGGATGGATAGTGGGTGGATGG + Intergenic
1145052814 17:19676912-19676934 TGGGGCAGACAGATGGTGGATGG + Exonic
1145261420 17:21356983-21357005 ATGGGTAGATGAATGGTGGGTGG - Intergenic
1146073455 17:29705502-29705524 GTGAGTAGATAGATAATCGAGGG - Intronic
1146939192 17:36832292-36832314 ATGGACAGATGGATGGTGGATGG - Intergenic
1147948025 17:44091553-44091575 GGGGGTAGATAGTGGGTAGATGG - Intronic
1148161049 17:45450273-45450295 TTAGATAGATGGATGGTGGATGG - Intronic
1148202012 17:45755721-45755743 GTGGCTGGGCAGATGGTGGATGG - Intergenic
1148701475 17:49589549-49589571 TTGGGTAAATAGAGGGTAGACGG + Intergenic
1148987129 17:51632744-51632766 GTGGAAAGAAAGATGGAGGAAGG - Intronic
1150392281 17:64796911-64796933 ATAGATAGATGGATGGTGGATGG - Intergenic
1150501296 17:65653440-65653462 GTGGGTAGATTGAAGGGGGCAGG + Intronic
1150632682 17:66891009-66891031 GTGGGGAGACAGTTGGAGGAAGG + Intergenic
1150634543 17:66903803-66903825 GTGGATAGATGGATGGTGGAGGG + Intergenic
1151511820 17:74565460-74565482 GTGGGTAGATGAAAGATGGATGG - Intergenic
1151941779 17:77297003-77297025 GATAGAAGATAGATGGTGGATGG + Intronic
1151961345 17:77407595-77407617 GTGGGCACCTAGATGGTTGAAGG + Intronic
1152006601 17:77686084-77686106 ATGGATGGATAGATGGAGGAAGG - Intergenic
1152006655 17:77686339-77686361 TGGGATAGATAGATGGAGGAAGG - Intergenic
1152018162 17:77765566-77765588 ATGGGAAGTTAGATGATGGATGG + Intergenic
1152312481 17:79559540-79559562 GTGGATAGATGAATGGTGGGTGG + Intergenic
1152312586 17:79559930-79559952 GTGGGTAGGTGGATGGTCGGTGG + Intergenic
1152767172 17:82147904-82147926 GTGGGTGGATGGATGGTAGATGG + Intronic
1152767205 17:82148019-82148041 GTGGGTGGATGGATGGTAGATGG + Intronic
1152767419 17:82148780-82148802 GTGGGTGGATAGATGGTAGATGG + Intronic
1152767466 17:82148936-82148958 GTGGGTGGGTGGATGGTAGATGG + Intronic
1152947567 17:83206189-83206211 GTAGGTAGATATATGATAGATGG + Intergenic
1153059637 18:982008-982030 GTGGGGAGAGAGAAAGTGGAAGG - Intergenic
1153660549 18:7322022-7322044 ATGGGTAGATGGATGATGGATGG + Intergenic
1154307812 18:13243518-13243540 GTGGATGGATGGATGATGGATGG - Intronic
1154307832 18:13243605-13243627 GTGGGTGGCTGGATGGTGGATGG - Intronic
1154463336 18:14618322-14618344 GTGGGGAGATGGAAGCTGGATGG - Intergenic
1156636735 18:39040452-39040474 CTTGGTAGATAGATGGTCTAAGG - Intergenic
1159928239 18:74288254-74288276 GTGTGTGGTGAGATGGTGGAGGG - Intronic
1159963374 18:74573182-74573204 ATGGATAGATAGATAATGGATGG - Intronic
1160226833 18:77018411-77018433 ATGAGTGGATAGATGGTGGGTGG - Intronic
1160526551 18:79542048-79542070 GTGGGTGGATGGATGGATGAAGG - Intergenic
1160526572 18:79542138-79542160 GTGGATGGATGGATGTTGGATGG - Intergenic
1160588028 18:79923301-79923323 GTGGATGGGTGGATGGTGGACGG + Intronic
1160687131 19:442332-442354 GTGGGTGGATGGATGGAGGGTGG + Intronic
1160687132 19:442336-442358 GTGGATGGATGGAGGGTGGAAGG + Intronic
1160687367 19:443071-443093 GTGGGTGGATGGATGGAGGGTGG + Intronic
1160687368 19:443075-443097 GTGGATGGATGGAGGGTGGATGG + Intronic
1160687608 19:443950-443972 GTGGGTGGATGGAGGGTGGATGG + Intronic
1160687643 19:444073-444095 GTGGATGGATGGAGGGTGGATGG + Intronic
1160692131 19:465040-465062 ATGGGTGGATAGATGATGGATGG + Intronic
1160692340 19:465817-465839 GTGGGTGGGTGGATGGTGGATGG + Intronic
1160692430 19:466161-466183 ATGGTTAGGTAGATGGTAGATGG + Intronic
1160692456 19:466252-466274 ATGGTTAGGTAGATGGTGGATGG + Intronic
1160692499 19:466406-466428 AAGGTTAGGTAGATGGTGGATGG + Intronic
1160692521 19:466493-466515 ATGGTTAGGTAGATGGTGGATGG + Intronic
1160692724 19:467192-467214 GTGGAAAGATGGTTGGTGGAGGG + Intronic
1160767799 19:816171-816193 ATGGGTGGATAGATGATGGGTGG - Intronic
1160926812 19:1550401-1550423 GTGGGTGGGTGGGTGGTGGATGG - Intergenic
1160960383 19:1718267-1718289 GTGGGTGGGTGGATGGTGGGTGG + Intergenic
1161105279 19:2440752-2440774 ATGGATAGATAGATGATGGATGG - Intronic
1161227675 19:3154648-3154670 GTGGGTGGATGGATGATGGATGG + Intronic
1161258563 19:3323091-3323113 GTGGATAGATAGATGGATAAAGG + Intergenic
1161287291 19:3475434-3475456 GTGGGTGGATAGTGGGTGGGTGG + Intronic
1161287294 19:3475449-3475471 GTGGGTGGATGGATGATGGATGG + Intronic
1161287320 19:3475548-3475570 GTGGATAGATGGATGATGAATGG + Intronic
1161287340 19:3475638-3475660 GTAGGTGGATAGGTGATGGATGG + Intronic
1161287583 19:3476939-3476961 GTGGGTGGATGGATGGTGAATGG + Intronic
1161287632 19:3477134-3477156 GTCGGTGGATGGATGGTGGGTGG + Intronic
1161287682 19:3477318-3477340 GTGGGTGGATGGATGGTGGGTGG + Intronic
1161449152 19:4334947-4334969 GTGGGTGGATGGATGATGGACGG - Intronic
1161449181 19:4335060-4335082 GTGGGTGGATGGATGATAGATGG - Intronic
1161449196 19:4335147-4335169 GTAGGTGGATGGATGATGGAGGG - Intronic
1161449206 19:4335189-4335211 GTGGATGGATGGATGATGGATGG - Intronic
1161449211 19:4335216-4335238 GTAGGTGGATGGATGATGGAGGG - Intronic
1161449221 19:4335270-4335292 GTGGGTGGGTGGATGGTGAATGG - Intronic
1161449239 19:4335379-4335401 GTGGGTGGGTGGATGATGGATGG - Intronic
1161466429 19:4433192-4433214 GTGTGCAGGTAGGTGGTGGAGGG - Exonic
1161633097 19:5369236-5369258 TTGGGTAGATATATTATGGATGG - Intergenic
1161641102 19:5423850-5423872 GTGGGTGGATGAATGGTGGATGG - Intergenic
1161681462 19:5681760-5681782 GTGGATGGATGGATGATGGACGG - Intronic
1161899212 19:7105269-7105291 GTAGGTGGATAGATGATGAATGG + Intergenic
1161974470 19:7600551-7600573 GTGGGTGGATGGATGGGGGGTGG - Intronic
1162085817 19:8248566-8248588 GTGGACAGATGGATGATGGATGG + Intronic
1162085849 19:8248707-8248729 GTGGGTAGATGGATGACAGATGG + Intronic
1162085884 19:8248858-8248880 GTGGGTGGATGGATGGTGGGTGG + Intronic
1162158593 19:8696305-8696327 TTGGGAAGATGGATGGGGGATGG + Intergenic
1162180842 19:8867693-8867715 ATGGATGGATGGATGGTGGATGG + Intronic
1162480589 19:10924764-10924786 GTGGCTAGATAGGTGGGGGTGGG - Intronic
1162526409 19:11209265-11209287 GTGGGGAGATAGATGAGGGATGG - Intronic
1163171641 19:15535586-15535608 GTGGATAGGTGGAAGGTGGATGG - Intronic
1163188331 19:15656775-15656797 GTGGAGAGATAGATCATGGATGG - Intronic
1163207383 19:15813650-15813672 GTGGGGAGATAGAGAGTGGGAGG + Intergenic
1163382599 19:16978805-16978827 ATGGATGGGTAGATGGTGGATGG - Intronic
1163383633 19:16985655-16985677 ATGAATAGATAGATGGAGGATGG + Intronic
1163492641 19:17625802-17625824 GTGGGTAGATGGATGGATGCTGG - Intronic
1163495173 19:17642347-17642369 GTGGCTAGATGGATGATGGATGG - Intronic
1163571257 19:18083697-18083719 ATGGATGGGTAGATGGTGGACGG - Intronic
1163609837 19:18295127-18295149 GTGGGTGGATGGATGGTAGATGG - Intergenic
1163609877 19:18295284-18295306 GTGGATGGGTAGATGGTGCATGG - Intergenic
1163609880 19:18295299-18295321 GTGGATGGGCAGATGGTGGATGG - Intergenic
1163609884 19:18295314-18295336 GTAGATGGATGGATGGTGGATGG - Intergenic
1163609885 19:18295318-18295340 GTGGGTAGATGGATGGATGGTGG - Intergenic
1163609890 19:18295337-18295359 GTGGGTAGATGGATGGATGGTGG - Intergenic
1163609916 19:18295424-18295446 GTGGATGGTTAGGTGGTGGATGG - Intergenic
1163609920 19:18295439-18295461 GTGGATGGATGGCTGGTGGATGG - Intergenic
1163609931 19:18295482-18295504 GTGGGTGAGTGGATGGTGGATGG - Intergenic
1163609963 19:18295587-18295609 GTGGATGGGTAGATGGTGGATGG - Intergenic
1163609967 19:18295602-18295624 GATGGTGGATGGATGGTGGATGG - Intergenic
1163609970 19:18295613-18295635 GATGGTAGGTGGATGGTGGATGG - Intergenic
1163609972 19:18295620-18295642 ATGGGTAGATGGTAGGTGGATGG - Intergenic
1163609977 19:18295639-18295661 GATGGTGGATGGATGGTGGATGG - Intergenic
1163609984 19:18295669-18295691 GTGGATGGGTAGATGGTAGATGG - Intergenic
1163609987 19:18295684-18295706 GATGGTGGATGGATGGTGGATGG - Intergenic
1163609994 19:18295714-18295736 GTGGATGGGTAGATGGTAGATGG - Intergenic
1163609997 19:18295729-18295751 ATGGATGGATGGATGGTGGATGG - Intergenic
1163610016 19:18295803-18295825 GTGGATGGGTGGATGGTGGATGG - Intergenic
1163675701 19:18654296-18654318 GTTGGTAGATGGATAGTGGTAGG - Intronic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1164670297 19:30068536-30068558 ATGGATAGATGGATGATGGATGG - Intergenic
1164670370 19:30068948-30068970 GTGGATGGATAAATGGAGGAAGG - Intergenic
1164670376 19:30068971-30068993 ATGGGTAGATCAGTGGTGGAAGG - Intergenic
1164678877 19:30120983-30121005 GTAGGTGGATGGATGATGGATGG - Intergenic
1164701403 19:30287447-30287469 ATGGGTGGATTGATGGAGGATGG + Intronic
1164701504 19:30287798-30287820 GAGGATGGATGGATGGTGGATGG + Intronic
1164706510 19:30324033-30324055 ATGGATAGATGGATGGAGGATGG - Intronic
1165098331 19:33422619-33422641 GTAGGTAGATAGATGATAGAGGG - Intronic
1165098346 19:33422693-33422715 ATGGGTAGATGGATGGTAGATGG - Intronic
1165102069 19:33444802-33444824 GTGGAGAGAGACATGGTGGATGG - Intronic
1165144331 19:33721802-33721824 GTGGGCAGATAGGTGATGGAGGG + Intronic
1165190314 19:34057442-34057464 ATGGGTAGATGGATGGATGATGG + Intergenic
1165378158 19:35458605-35458627 GATGATAGATAGATGGGGGAAGG + Intergenic
1165759112 19:38310228-38310250 TTGGCTAGATGGGTGGTGGATGG - Intronic
1165867152 19:38945878-38945900 TTGGGTAGGTAGTTGGGGGACGG + Intronic
1166201473 19:41240228-41240250 GTGGGTGGATATATGGAGGGTGG + Intronic
1166201474 19:41240232-41240254 GTGGATATATGGAGGGTGGATGG + Intronic
1166907989 19:46127649-46127671 GTAGGTAGATAGATAGATGATGG + Intergenic
1166907990 19:46127653-46127675 GTAGATAGATAGATGATGGATGG + Intergenic
1166935586 19:46330538-46330560 GATGGCAGATGGATGGTGGATGG + Intronic
1166935589 19:46330549-46330571 GATGGTGGATGGATGGTGGATGG + Intronic
1166935606 19:46330627-46330649 ATGGATGGATGGATGGTGGATGG + Intronic
1166935610 19:46330649-46330671 GTTGGCAGATGTATGGTGGATGG + Intronic
1166935621 19:46330707-46330729 ATGGATGGATGGATGGTGGATGG + Intronic
1166935641 19:46330792-46330814 ATGGATGGATGGATGGTGGATGG + Intronic
1166935645 19:46330814-46330836 GCTGGCAGACAGATGGTGGATGG + Intronic
1167161409 19:47769678-47769700 ATGGATGGATAGATGATGGATGG - Intergenic
1167161431 19:47769789-47769811 GTGGATGGATGGATGATGGATGG - Intergenic
1167308309 19:48721322-48721344 GTGGGTGGGTGGCTGGTGGAGGG + Intronic
1168086896 19:54054769-54054791 GTAGGTAGATAGATGGATGAAGG + Intronic
1168326912 19:55543201-55543223 GTGGATGGATGGATGGTGGATGG - Intronic
1168508272 19:56954604-56954626 GTGGATAGATGGAGGATGGATGG - Intergenic
1168508273 19:56954608-56954630 ATGGGTGGATAGATGGAGGATGG - Intergenic
925119351 2:1405334-1405356 GTGGGTGGATGGATGATGAATGG - Intronic
925697111 2:6592171-6592193 ATAGGTAGATAGATGATAGATGG - Intergenic
925716010 2:6785159-6785181 ATGGGTAGATGGTTGGGGGATGG + Intergenic
925745313 2:7038911-7038933 GTGGATGGATAGATGGATGATGG + Intronic
926038258 2:9652212-9652234 ATGGGTGGATGGATGATGGAAGG - Intergenic
926519279 2:13889976-13889998 AAGGGTAGTTGGATGGTGGAGGG + Intergenic
926647272 2:15303257-15303279 GTGGGTTGATAGAAGCTGGATGG + Intronic
926698619 2:15787868-15787890 ATGGATAGATAGAGGATGGATGG - Intergenic
927319332 2:21724135-21724157 GTATGTAGATAAATGTTGGATGG - Intergenic
927364582 2:22279195-22279217 TTGGGTAGATACCTGGTGGTGGG + Intergenic
927934606 2:27069265-27069287 CTGTGTAGAAAGATAGTGGAGGG - Intronic
929119874 2:38475910-38475932 ATGAGTATAAAGATGGTGGAGGG - Intergenic
929745926 2:44658614-44658636 GAGGGTAGATAGATTGTCTACGG - Intronic
931152814 2:59593969-59593991 GTGGGGAAATGGAAGGTGGAGGG + Intergenic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931737774 2:65213198-65213220 GTAGGTAGGTAGGTTGTGGATGG - Intergenic
932316088 2:70784184-70784206 GTGGGGAGAGAGGTGGTGGGCGG - Intronic
932657819 2:73625700-73625722 GAGGGTAGAGAGATAGTGAAAGG - Intergenic
933694514 2:85207586-85207608 GTGGGTAGATGGAACGTGAAAGG + Intronic
933784797 2:85829977-85829999 GTGGGCAGAGAGATGGGAGAGGG + Intergenic
934028122 2:88017553-88017575 GCGGGCAGATAGATGGTGGCTGG - Intergenic
934768700 2:96894686-96894708 GTGGGTAGGTAGATGGGGGTGGG - Intronic
935106013 2:100044428-100044450 TTGGGTAGATAGATGGAAGGGGG - Intronic
935982407 2:108640277-108640299 GTGGGTAGATATTTGTTGGTTGG + Intronic
936267326 2:111020459-111020481 GGAGGTAGTTAGGTGGTGGAGGG + Intronic
937021126 2:118656826-118656848 GTGGGGATATAAATGGTGAAGGG + Intergenic
937227781 2:120379514-120379536 GTGGGTAGAAAGACTGGGGAGGG + Intergenic
937260702 2:120585346-120585368 GAGGCTAGAAAGATGGGGGAGGG + Intergenic
937458724 2:122067093-122067115 TTGGGAAGATGGATGGTGCAGGG + Intergenic
937970743 2:127546885-127546907 GTGGATAGATGGATGGTGGATGG - Intronic
937970744 2:127546889-127546911 GTGGGTGGATAGATGGATGGTGG - Intronic
937977118 2:127588965-127588987 GTGGGTGGATGGGTAGTGGATGG + Intronic
937977372 2:127589837-127589859 GTGGGTGGATGGGTGGTGGGCGG + Intronic
940227048 2:151410572-151410594 GTGGGGAGAAAGAAGGTGGTTGG + Intronic
941416818 2:165231365-165231387 ATAGATAGATAGATGATGGATGG + Intergenic
941563745 2:167082087-167082109 GTGGGTAGAGGGAGGGGGGAGGG - Intronic
944537618 2:200726508-200726530 ATGGGTGGATGGATGATGGATGG - Intergenic
945698578 2:213141300-213141322 GTGGGGAAAAAGATTGTGGATGG - Intronic
947812719 2:233014688-233014710 ATGGGTGGATGGATGGTGGATGG - Intronic
947812767 2:233014845-233014867 TTGGATGGATAGATGGTGGGTGG - Intronic
947812837 2:233015136-233015158 GTGGATGGATGGATGGTGGATGG - Intronic
947812851 2:233015186-233015208 ATGGATGGATAGATGGTGGGTGG - Intronic
947812912 2:233015413-233015435 GTGGATGGATGGATGGTGGATGG - Intronic
947812932 2:233015496-233015518 GTGGATGGATGGATGGTGGATGG - Intronic
948472572 2:238193731-238193753 GTTGGGAGATAGATGGTGTGGGG - Intronic
948700269 2:239755223-239755245 GTGGGCTGATGCATGGTGGAGGG + Intergenic
948769192 2:240239517-240239539 GTGGATGGATAGATGGCAGATGG + Intergenic
949065748 2:241989561-241989583 GTGGATGGATGGATGGTGGATGG - Intergenic
949065752 2:241989576-241989598 ATGGATGGATGGATGGTGGATGG - Intergenic
949065765 2:241989631-241989653 ATGGATGGATGGATGGTGGATGG - Intergenic
949065788 2:241989733-241989755 GTGGATGGATGGATGGTGGATGG - Intergenic
949065806 2:241989811-241989833 ATGGATGGATGGATGGTGGATGG - Intergenic
949065812 2:241989834-241989856 GTGGGTGGATGGATGGTGGATGG - Intergenic
949065825 2:241989891-241989913 GATGGTGGATGGATGGTGGATGG - Intergenic
949065838 2:241989948-241989970 GTGGATGGATGGATGGTGGATGG - Intergenic
949065862 2:241990050-241990072 GTGGATGGATGGATGATGGATGG - Intergenic
949065891 2:241990175-241990197 GATGGTGGATGGATGGTGGATGG - Intergenic
949065917 2:241990278-241990300 GATGGTGGATGGATGGTGGATGG - Intergenic
949065920 2:241990289-241990311 ATGGATGGATGGATGGTGGATGG - Intergenic
949065938 2:241990354-241990376 ATGGATGGATGGATGGTGGATGG - Intergenic
949065945 2:241990381-241990403 GATGGTGGATGGATGGTGGATGG - Intergenic
949065948 2:241990392-241990414 GTGGATAGATGGATGGTGGATGG - Intergenic
949065955 2:241990422-241990444 ATGGATGGATGGATGGTGGATGG - Intergenic
949065961 2:241990448-241990470 ATGGGTGGATGGATGGTGGATGG - Intergenic
949065971 2:241990483-241990505 GGTGGTGGATGGATGGTGGATGG - Intergenic
949065977 2:241990504-241990526 ATGGATGGATGGATGGTGGATGG - Intergenic
949065986 2:241990537-241990559 ATGGATGGATGGATGGTGGATGG - Intergenic
949065992 2:241990560-241990582 ATGGATGGATGGATGGTGGATGG - Intergenic
949066000 2:241990591-241990613 GTGGATGGATGGATGGTGGATGG - Intergenic
1168857642 20:1019879-1019901 ATAGGTGGGTAGATGGTGGATGG - Intergenic
1169434120 20:5569723-5569745 GTTTGGAGTTAGATGGTGGAGGG - Intronic
1169696747 20:8397506-8397528 GTGGGTAGGAATAGGGTGGAAGG - Intronic
1169834419 20:9862009-9862031 GTTAGTAGATAGAATGTGGAAGG + Intergenic
1170361181 20:15548103-15548125 GTGGACAGATGGATGGTGGATGG - Intronic
1170371065 20:15648704-15648726 ATGGGTGGATGGATGGTGGATGG + Intronic
1171213158 20:23332584-23332606 GTGTGTGGATAGATGGCTGAGGG - Intergenic
1171249041 20:23634862-23634884 GTGGGTAGATAGATGTATGAGGG - Intronic
1171283451 20:23919682-23919704 GTGGGTAGATGGATGTTTGAGGG - Intergenic
1171399178 20:24860730-24860752 ATGGGTGGATAGATGGAGGGAGG + Intergenic
1171451264 20:25237620-25237642 GTAGGGAGGAAGATGGTGGACGG + Intergenic
1171501470 20:25596877-25596899 GTTGGTAGACAGATGGTAGATGG - Intergenic
1172230773 20:33334154-33334176 ATGGGTAGATGGATGGTGGATGG + Intergenic
1172230790 20:33334240-33334262 ATGGGTAGATGGATGATGGATGG + Intergenic
1172230814 20:33334342-33334364 GTGGGTAGATGGATGGTGGATGG + Intergenic
1172230832 20:33334421-33334443 TTGGGTAGATGGATGGTGGATGG + Intergenic
1172230839 20:33334456-33334478 GTACGAAGATGGATGGTGGATGG + Intergenic
1172592751 20:36128957-36128979 GTGGGTGGAGAGAGGGAGGAAGG + Intronic
1172849031 20:37947358-37947380 ATGGATAGATAGATGATGGATGG + Intergenic
1172976133 20:38907413-38907435 ATAGGTAGATAGATGGATGAAGG + Intronic
1173159081 20:40639105-40639127 GTGGGTAGGCAGTTGGTAGAAGG - Intergenic
1173437039 20:43042732-43042754 GTGGGAGGAGAGATGGTGGGTGG - Intronic
1173437045 20:43042751-43042773 GTGGGAGGAGAGATGGTGGGTGG - Intronic
1173871490 20:46344855-46344877 ATGGGTAGATGGATGATGGATGG - Intergenic
1173871511 20:46344948-46344970 ATGGGTAGATATATGATGGATGG - Intergenic
1173976581 20:47191400-47191422 ATGAGTAGATAAGTGGTGGATGG + Intergenic
1174198423 20:48789873-48789895 GTGGGGAGATGGATGGGTGATGG + Intronic
1174279725 20:49430467-49430489 GTGGATGGATGGATGATGGATGG - Intronic
1174289268 20:49496212-49496234 GTGGAAAGACAGATGGTGTACGG - Intergenic
1174306805 20:49619219-49619241 TTGGATAGATGGATGATGGATGG + Intergenic
1174410253 20:50330549-50330571 GTGGGTGGATAGATGGTGGGCGG + Intergenic
1174422180 20:50406379-50406401 GTGGGTGGATGGATGGCAGATGG + Intergenic
1174479986 20:50824436-50824458 GTGGGAGGATAGTTGGGGGAAGG + Intronic
1174940919 20:54926168-54926190 TTAGGTAAATGGATGGTGGATGG - Intergenic
1175245016 20:57577008-57577030 GTGGGTGGATAGACGGTGGGTGG - Intergenic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175407375 20:58743968-58743990 GTGGGTGGATACATGGAGGAGGG + Intergenic
1175530694 20:59672741-59672763 ATGAGGAGAGAGATGGTGGAGGG - Intronic
1175687970 20:61045164-61045186 ATGGGTGGATGAATGGTGGATGG - Intergenic
1175687978 20:61045191-61045213 GATGGCAGATGGATGGTGGATGG - Intergenic
1175687992 20:61045277-61045299 ATGGATGGATAGATGGTTGATGG - Intergenic
1175687995 20:61045296-61045318 ATGGATGGATGGATGGTGGATGG - Intergenic
1175770477 20:61620244-61620266 ATGGGTAGATAGATGATGGATGG + Intronic
1175770482 20:61620263-61620285 ATGGGTGGGTAGATGGTTGATGG + Intronic
1175770483 20:61620267-61620289 GTGGGTAGATGGTTGATGGATGG + Intronic
1175770498 20:61620398-61620420 ATGGATAGATAGATGGATGATGG + Intronic
1175770505 20:61620469-61620491 ATGGATAGATAGATGGATGATGG + Intronic
1175779208 20:61671691-61671713 GTGGGTGGATAGATGGTAGATGG + Intronic
1175779244 20:61671862-61671884 ATGGATGGATGGATGGTGGATGG + Intronic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175779257 20:61671930-61671952 GATGGATGATAGATGGTGGATGG + Intronic
1175779306 20:61672177-61672199 GTGGGTATATGGATAATGGATGG + Intronic
1175780278 20:61677763-61677785 ATGGTTAGATAGATGATGAATGG + Intronic
1175780301 20:61678028-61678050 ATAGGTAGATAGATGGATGATGG + Intronic
1175780302 20:61678032-61678054 GTAGATAGATGGATGATGGATGG + Intronic
1175780310 20:61678142-61678164 ATAGGTAGATAGATGGATGATGG + Intronic
1175781016 20:61682132-61682154 ATGGGTGGATAGAGGGTAGATGG + Intronic
1175781023 20:61682163-61682185 GTGGATGGGTAGATGATGGATGG + Intronic
1175781064 20:61682358-61682380 ATGGATGGATGGATGGTGGATGG + Intronic
1175817234 20:61889604-61889626 ATGGGTGGATAGATGATGGATGG + Intronic
1175817248 20:61889681-61889703 GTGGATAGTTGGATGATGGATGG + Intronic
1175817250 20:61889696-61889718 ATGGATGGATAGATGATGGATGG + Intronic
1175817282 20:61889859-61889881 ATGGATAGATGGATGGTGGATGG + Intronic
1175817288 20:61889894-61889916 ATGGATGGATAGATGATGGATGG + Intronic
1175817313 20:61890032-61890054 GTGGATAGTTGGATGATGGATGG + Intronic
1175817341 20:61890180-61890202 ATGGATGGATAGATGATGGATGG + Intronic
1175817344 20:61890199-61890221 ATGGATAGATGGATGTTGGATGG + Intronic
1175817364 20:61890310-61890332 ATGGATAGATGGATGATGGATGG + Intronic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1175817856 20:61892990-61893012 GTGAGTAGAGGGATGGTGGATGG + Intronic
1175817877 20:61893073-61893095 GTGAGTAGAGGGATGCTGGATGG + Intronic
1175817960 20:61893389-61893411 GTGAATAGAGGGATGGTGGATGG + Intronic
1175817979 20:61893472-61893494 ATGAGTAGAGGGATGGTGGATGG + Intronic
1175817992 20:61893523-61893545 GCGAATAGAGAGATGGTGGATGG + Intronic
1175818038 20:61893710-61893732 GTGAATAGAGGGATGGTGGATGG + Intronic
1175818052 20:61893761-61893783 GTGAATAGAGGGATGGTGGATGG + Intronic
1175921395 20:62452000-62452022 GGGGGGAGAGAGATGGGGGAGGG + Intergenic
1176057911 20:63158475-63158497 ATGGGTGAATAGATGGTGGGTGG + Intergenic
1176057933 20:63158551-63158573 GTTGGTGGATGGATGGTGGATGG + Intergenic
1176811190 21:13540051-13540073 GTGGGGAGATGGAAGCTGGATGG + Intergenic
1177824078 21:26063113-26063135 TTAAGTACATAGATGGTGGATGG + Intronic
1178199831 21:30390911-30390933 GTGGGGAGCTAGAAGGGGGATGG - Intronic
1178280895 21:31281864-31281886 GTGGATAGATGGATGGTAGATGG + Intronic
1178381784 21:32115997-32116019 ATAGGTAGATAGATGATAGATGG - Intergenic
1178561360 21:33642406-33642428 GGGCGGAGATGGATGGTGGATGG + Intronic
1178589596 21:33898316-33898338 GTGGGTGGATGGATGGTTTAGGG + Exonic
1178856879 21:36257722-36257744 GTAGGTAGATAGATGTAGGTAGG + Intronic
1178856921 21:36258043-36258065 GTAGGTAGATAGATGTAGGTAGG + Intronic
1179549151 21:42132379-42132401 GTGGATGGATGGATGATGGATGG - Intronic
1179818993 21:43925525-43925547 GTGGGTAGACAAAAGGGGGAGGG + Intronic
1180024906 21:45155579-45155601 GTGAGTGGATGGATGATGGATGG - Intronic
1180025094 21:45156336-45156358 GTGGATGGATAGATGGATGATGG - Intronic
1180182371 21:46123725-46123747 GTGTGTGGTTAGATGATGGATGG + Intronic
1180182413 21:46123907-46123929 GTGGGTGGATAGAGGATGGATGG + Intronic
1180182456 21:46124084-46124106 GTGGGTGGGTAGAGGATGGACGG + Intronic
1180182487 21:46124210-46124232 CTGGGTGGATGGATGATGGATGG + Intronic
1181536729 22:23550156-23550178 ATGGGTAGATGGATGATGGATGG - Intergenic
1181783194 22:25207604-25207626 GTGGGTGGAAGGATGATGGATGG - Intergenic
1182039109 22:27222533-27222555 GTGGATAGATGGAGAGTGGATGG + Intergenic
1182099741 22:27649441-27649463 GTGGATGGATGGATGGTGGAAGG + Intergenic
1182458954 22:30470813-30470835 GTGGGTAGGTAGATGGAAAAAGG + Intronic
1183023734 22:35048263-35048285 GTGGGTAGATTGCTTGAGGACGG - Intergenic
1183082125 22:35463338-35463360 GTGGGTAGATGGATGGATGGTGG - Intergenic
1183100012 22:35578237-35578259 CTGGCTGGATGGATGGTGGATGG + Intergenic
1183100052 22:35578396-35578418 CTGGATGGATGGATGGTGGATGG + Intergenic
1183100062 22:35578439-35578461 ATGGATGGATGGATGGTGGATGG + Intergenic
1183303947 22:37072043-37072065 GTGGATGGATGGATGATGGATGG + Intronic
1183304081 22:37072753-37072775 ATGGATAGATGGATGATGGATGG + Intronic
1183304123 22:37072984-37073006 ATGGATAGATGGATGATGGATGG + Intronic
1183304137 22:37073048-37073070 GTGGATGGATGGATGATGGATGG + Intronic
1183425714 22:37738347-37738369 ATGGGTAGATGGATGATGGATGG + Intronic
1184123708 22:42471705-42471727 ATGGGTGGGTGGATGGTGGATGG - Intergenic
1184293046 22:43508502-43508524 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293071 22:43508583-43508605 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293145 22:43508832-43508854 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293156 22:43508867-43508889 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293214 22:43509056-43509078 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293321 22:43509408-43509430 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293378 22:43509631-43509653 ATGGATGGATAGATGGGGGATGG - Intergenic
1184389421 22:44194774-44194796 ATGGATGGATAGATGATGGATGG - Intronic
1184390133 22:44199070-44199092 ATGGGTGCATAGATGGTGGGTGG - Intronic
1184410416 22:44323022-44323044 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410462 22:44323191-44323213 GTGGACAGATGGATGGTGGATGG - Intergenic
1184410476 22:44323254-44323276 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410502 22:44323362-44323384 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410543 22:44323556-44323578 GTGGATGGATGGATGGTGGATGG - Intergenic
1184414695 22:44345496-44345518 ATGGGTAGGTAATTGGTGGATGG + Intergenic
1184434281 22:44460604-44460626 GTGGGTAGATGGATGGATGAGGG - Intergenic
1184444510 22:44539521-44539543 ATGGGTAGGTGGATGGTGGATGG + Intergenic
1184444604 22:44539903-44539925 ATGGGTAGGTGGACGGTGGATGG + Intergenic
1184460266 22:44633895-44633917 GTGGATGGATAGATGATGGGTGG + Intergenic
1184460774 22:44636701-44636723 GTGGGTGGATGGATGGATGATGG + Intergenic
1184460828 22:44636923-44636945 GTGGATGGATAGATGGATGATGG + Intergenic
1184460829 22:44636927-44636949 ATGGATAGATGGATGATGGATGG + Intergenic
1184460851 22:44637034-44637056 ATGGATAGATGGATGATGGATGG + Intergenic
1184460874 22:44637133-44637155 ATGGATAGATGGATGATGGATGG + Intergenic
1184731217 22:46372146-46372168 GTGAGTGGGTAGATGATGGATGG - Intronic
1184731222 22:46372173-46372195 GTGAGTAGATGGATGGGTGAGGG - Intronic
1184731229 22:46372201-46372223 GTGAGTAGATGGATGGTTGGAGG - Intronic
1184855180 22:47142687-47142709 ATGGGTAGATGGATGGGGGTGGG - Intronic
1184996808 22:48213205-48213227 ATGGGTGGATAGGTGGTGGATGG - Intergenic
1185018785 22:48361099-48361121 ATGGATGGATAGATGATGGATGG + Intergenic
1185018792 22:48361149-48361171 ATGGATAGATAGATGATGGATGG + Intergenic
1185018845 22:48361662-48361684 ATGGATGGATAGATGATGGATGG + Intergenic
1185018853 22:48361712-48361734 ATGGATAGATGGATGATGGATGG + Intergenic
1185027171 22:48421564-48421586 GTGGATAGATGGATGGGTGAAGG + Intergenic
1185053519 22:48566102-48566124 ATGGATAGATAGATGATGGATGG + Intronic
1185053533 22:48566168-48566190 ATGGGTGGATGGATGGTGGATGG + Intronic
1185053547 22:48566220-48566242 GTAGGTAGATGGATGATGGGTGG + Intronic
1185053573 22:48566353-48566375 ATGGGTGGACGGATGGTGGATGG + Intronic
1185053583 22:48566394-48566416 ATGGGTAGATGGTAGGTGGATGG + Intronic
1185063744 22:48620650-48620672 GGTGGTGGATGGATGGTGGATGG - Intronic
1185076682 22:48686978-48687000 ATGGGAGGATAGATGATGGATGG + Intronic
1185076745 22:48687265-48687287 GTGGATGAATGGATGGTGGACGG + Intronic
1185082791 22:48718944-48718966 GGGGACAGACAGATGGTGGAGGG - Intronic
1185103669 22:48855233-48855255 TTGGGTGGGTAGATGATGGATGG - Intergenic
1185103700 22:48855384-48855406 ATGGGTAGATGAATGATGGATGG - Intergenic
1185104366 22:48858946-48858968 ATGGATGGATAGATGATGGAGGG - Intergenic
1185108528 22:48887713-48887735 GTGAATAGATAGATGGTGTGTGG - Intergenic
1185108605 22:48888127-48888149 GTGGATGGATGGATGGGGGATGG - Intergenic
1185154555 22:49185372-49185394 GTGGATAGATTAATGGTGGGTGG - Intergenic
1185193322 22:49452519-49452541 GCAGGTGGATGGATGGTGGAAGG + Intronic
1185193361 22:49452713-49452735 ATGGGTGGAGAGATGATGGATGG + Intronic
1185193379 22:49452813-49452835 GTGAGTCGATGGATGGTGGAAGG + Intronic
1185196810 22:49476847-49476869 ATGGATGGATGGATGGTGGATGG + Intronic
1185196821 22:49476893-49476915 ATGGATGGATGGATGGTGGATGG + Intronic
1185196831 22:49476927-49476949 GTGGGTGGATGGATGGTGGATGG + Intronic
1185196838 22:49476961-49476983 ATGGATAGATAGATGGTGGATGG + Intronic
1185196856 22:49477062-49477084 GTGGATGGATGGATGATGGATGG + Intronic
1185196871 22:49477125-49477147 ATGGATGGATGGATGGTGGATGG + Intronic
1185196874 22:49477140-49477162 GTGGATGGATGGATGGTGAATGG + Intronic
1185196886 22:49477190-49477212 ATGGATGGATGGATGGTGGATGG + Intronic
1185196893 22:49477212-49477234 GGTGGTGGATGGATGGTGGATGG + Intronic
1185196904 22:49477250-49477272 GTGGATGGATGGATGGTGGATGG + Intronic
1185196932 22:49477385-49477407 ATGGATGGATGGATGGTGGATGG + Intronic
1185196939 22:49477411-49477433 GTGGATGGATGGATGGTGGATGG + Intronic
1185196952 22:49477460-49477482 ATGGATGGATGGATGGTGGATGG + Intronic
1185196969 22:49477521-49477543 TTGGATGGATGGATGGTGGATGG + Intronic
1185196972 22:49477532-49477554 GATGGTGGATGGATGGTGGATGG + Intronic
1185196980 22:49477563-49477585 TTGGATGGATGGATGGTGGATGG + Intronic
1185196988 22:49477593-49477615 ATGGATGGATGGATGGTGGATGG + Intronic
1185197001 22:49477649-49477671 ATGGATGGATGGATGGTGGATGG + Intronic
1185197013 22:49477690-49477712 GATGGTGGATGGATGGTGGATGG + Intronic
1185197020 22:49477715-49477737 GATGGTGGATGGATGGTGGATGG + Intronic
1185197030 22:49477748-49477770 GATGGTGGATGGATGGTGGATGG + Intronic
1185197036 22:49477771-49477793 ATGGATGGATGGATGGTGGATGG + Intronic
1185197042 22:49477794-49477816 ATGGATGGATGGATGGTGGATGG + Intronic
1185197048 22:49477817-49477839 ATGGATGGATGGATGGTGGATGG + Intronic
1185224369 22:49644459-49644481 GTGGATAGGTGGATAGTGGATGG + Intronic
949130201 3:490682-490704 GTAGGTAGATAGATAGTACAAGG - Intergenic
950025774 3:9819072-9819094 GTGGATGGATGGCTGGTGGATGG - Intronic
950443803 3:13024639-13024661 ATGGGTGGATGGATGATGGACGG - Intronic
950573508 3:13816770-13816792 ATGGGTAGATGGATGGATGAAGG - Exonic
952036975 3:29214573-29214595 GAGGGTAGATGGGTGGTGCAAGG + Intergenic
952960293 3:38585091-38585113 GTGAGTGGACAGATGGTTGATGG + Intronic
955058304 3:55474862-55474884 GTGGGGAGGTAGAAGGTGGGGGG + Intronic
956343260 3:68249602-68249624 TTTGGTAGATTGGTGGTGGAGGG - Intronic
956748321 3:72327129-72327151 GTGGTTGAATAGATGGAGGATGG - Intergenic
957890320 3:86348788-86348810 GTGGGTAGTCAGAGGGTGGAAGG - Intergenic
957923301 3:86775267-86775289 GTGGGTACATAGTAGGTGTATGG + Intergenic
958700787 3:97586691-97586713 ATGGATGGATAGATGATGGATGG + Intronic
960171545 3:114467363-114467385 GTGGGCAGATAAAGGGAGGATGG + Intronic
961337143 3:126187354-126187376 GTGGGTAGCTAGATGGACGGTGG + Intronic
961785891 3:129346629-129346651 GTGAGTAGATCGATGGTGACAGG + Intergenic
961964360 3:130887438-130887460 GTGGGTCCAGAGATGGTGTATGG + Intronic
962464057 3:135640420-135640442 ATAGATAGATAGATGATGGATGG + Intergenic
962730035 3:138273509-138273531 GTGGGTAGGGAGATGGTCTATGG - Intronic
963707720 3:148708920-148708942 GTGGGTAGATAAATATTAGAGGG + Intronic
966042019 3:175503073-175503095 GAGGGTAGATGGTGGGTGGAAGG - Intronic
967850349 3:194077726-194077748 ATGGGTAGATGGATGGAGGGAGG + Intergenic
968594734 4:1476501-1476523 GTGGGTGGGTAGATGGATGATGG + Intergenic
968598386 4:1497026-1497048 GTGTATGGATAGATGCTGGATGG + Intergenic
968928114 4:3560642-3560664 ATGGTTGGATGGATGGTGGATGG - Intergenic
968936036 4:3611037-3611059 ATGGGTGGATGGATGATGGATGG - Intergenic
968960883 4:3743080-3743102 GTGGGGAGTTGGATGGGGGAAGG - Intergenic
969088602 4:4675333-4675355 ATGGGTGGATAGATGATGGATGG - Intergenic
969088626 4:4675428-4675450 GTGGATAGATGGATGATGGGTGG - Intergenic
969088628 4:4675432-4675454 ATGGGTGGATAGATGGATGATGG - Intergenic
969424819 4:7118049-7118071 ATGGATAGATGGATGGTGGGTGG + Intergenic
969424823 4:7118068-7118090 GTGGATGGATAGATGGAGGAAGG + Intergenic
969501579 4:7556704-7556726 GTGGGTGGATGAATGGTGGATGG - Intronic
969501608 4:7556808-7556830 ATGGGTAGATGGATGGATGATGG - Intronic
969501625 4:7556873-7556895 GTGGGTGGGTGGATGGTGGATGG - Intronic
969510389 4:7614352-7614374 GTGGATGGATTCATGGTGGATGG - Intronic
969510540 4:7615057-7615079 GTAGACAGAGAGATGGTGGATGG - Intronic
969510863 4:7617151-7617173 TTGGATAGATGGATGGTGGATGG - Intronic
969514939 4:7641922-7641944 ATGGATGGATAGATGATGGATGG + Intronic
969528492 4:7716520-7716542 ATGAATAGATGGATGGTGGATGG - Intronic
969528516 4:7716653-7716675 ATGAATAGATAGATGGTGGATGG - Intronic
969599276 4:8166476-8166498 ATGGGTGGATGGGTGGTGGATGG - Intergenic
969599384 4:8166960-8166982 ATGGGTGGATGGGTGGTGGAAGG - Intergenic
969798950 4:9547526-9547548 GTGGGTAGATGGATGATAGCTGG - Intergenic
969944115 4:10765263-10765285 GTGGGTAGAATGATGGCAGAAGG - Intergenic
969979456 4:11139614-11139636 GTGGGTAGATAGATGATGGATGG + Intergenic
971525446 4:27611603-27611625 ATAGGCAGATAGATGATGGATGG + Intergenic
972620937 4:40748126-40748148 GTGGATAGAAAGATGGCAGAAGG + Intergenic
972869459 4:43279347-43279369 GTGTGTGGGTAGATCGTGGATGG + Intergenic
973139541 4:46749404-46749426 TTGGGAAAATAGATGGAGGATGG - Intronic
978240872 4:106514856-106514878 ATGGATAGATAGATGGATGATGG + Intergenic
978284030 4:107053469-107053491 GAAGGAAGATAGATGGTGGTGGG - Intronic
978288848 4:107112918-107112940 TTAGGTAAATGGATGGTGGATGG + Intronic
979148806 4:117280940-117280962 ATAGGTAGATAGATGATAGATGG + Intergenic
980045026 4:127978226-127978248 GTGGGTACATAGTAGGTGTATGG + Intronic
980428971 4:132665427-132665449 GTGCATAGATAGATTTTGGAAGG + Intergenic
981578316 4:146227713-146227735 ATGGGAAATTAGATGGTGGAGGG + Intronic
982027110 4:151261864-151261886 GTGGGTAGGTGGATAGGGGAAGG + Intronic
982933398 4:161437766-161437788 GTGAGAAGTGAGATGGTGGATGG + Intronic
983770254 4:171540086-171540108 AGGGATAGATAGATGATGGATGG - Intergenic
983770262 4:171540140-171540162 ATGGATAGATAGATGATGGATGG - Intergenic
983770266 4:171540167-171540189 ATGGATAGATGGATGGTGGAAGG - Intergenic
983779994 4:171658068-171658090 GTGCGTTGATAGATGATGAATGG - Intergenic
983783947 4:171708233-171708255 GTAGGTAGGTAGATGATAGATGG + Intergenic
983892836 4:173048427-173048449 GATGGTAGATAGATGATGGGTGG + Intergenic
984473230 4:180203778-180203800 GTGCTTAGATGGATGGTGGAGGG + Intergenic
984599043 4:181705108-181705130 GTGGGTAGAGGGATGGGGAATGG + Intergenic
985090693 4:186359966-186359988 GTATATAGAGAGATGGTGGAAGG + Intergenic
985426408 4:189835645-189835667 GTGTGTTGATAGAGGGTGGAGGG - Intergenic
985529978 5:428424-428446 GTGGGCAGATGGAGGGTGAACGG + Intronic
985709151 5:1418595-1418617 GTGGATGGATGGATGATGGATGG - Intronic
985709197 5:1418821-1418843 GTGGGTGGATGGATGATGGGTGG - Intronic
985821160 5:2161130-2161152 GTGGGTGGATGGATGGGTGAGGG - Intergenic
985837272 5:2280621-2280643 ATGGGTGGGTAGGTGGTGGATGG + Intergenic
987063615 5:14266322-14266344 CTGGGTAGAAAGATGGATGAAGG - Intronic
987198402 5:15550273-15550295 GTTGGGAGATAGCTGGTGGCTGG + Intronic
987869184 5:23591152-23591174 TAGGATAGATAGATGATGGATGG + Intergenic
988272755 5:29037756-29037778 GTGGGTTGGTAGATGATGTACGG + Intergenic
992573977 5:78092112-78092134 GTGGGTAGATAGATGTACAAAGG - Intronic
993096416 5:83484318-83484340 ATGAATAGATAGATGATGGATGG - Intronic
993727425 5:91383777-91383799 GTGTGAAGAGAGATGGGGGAAGG + Intergenic
996876259 5:128243601-128243623 GTGGATAGATGGATGATGGATGG + Intergenic
996876287 5:128243722-128243744 GTAAGTAGATGGATGATGGATGG + Intergenic
999524166 5:152384212-152384234 ATGGATAGATAGATGGATGATGG - Intergenic
1000332852 5:160219526-160219548 ATGGGTGGATGGAAGGTGGAGGG + Intronic
1000397261 5:160788834-160788856 GTGGATGGATGGATGGTGGATGG - Intronic
1000997799 5:167976145-167976167 CTGGGTAGATGGATGAAGGAAGG - Intronic
1001082256 5:168676072-168676094 GTGGGTAGATGAAGGATGGATGG - Intronic
1001082257 5:168676076-168676098 GTGGGTGGGTAGATGAAGGATGG - Intronic
1001089026 5:168723337-168723359 GTGGGTGGATGGATGGTGGGAGG - Intronic
1001192916 5:169647307-169647329 GTGGGTAGATGGATGATAGATGG + Intronic
1001422550 5:171598812-171598834 GTGGATAGGTGGATGGTAGATGG + Intergenic
1001658415 5:173371998-173372020 GTGGGTAGAGAGGTGTTGGGGGG + Intergenic
1001865678 5:175103026-175103048 ATGGATAGATGGATGATGGATGG + Intergenic
1001981071 5:176037385-176037407 GTGGGTAGAAAGTGGGTAGATGG + Intergenic
1002259069 5:177981849-177981871 GTGGACACATGGATGGTGGATGG + Intergenic
1002303350 5:178269741-178269763 GTGGTTGGATGGATAGTGGATGG - Intronic
1002341595 5:178519819-178519841 ATGGACAGATAGATGGAGGATGG + Intronic
1002341632 5:178520069-178520091 ATGGATGGATAGATGGAGGATGG + Intronic
1002658975 5:180777584-180777606 GTGGGTGGATGGGTGGTGGGTGG - Intergenic
1002674700 5:180901370-180901392 GTGGGTACTTAGAAGGTGAAGGG + Intronic
1002683864 5:180991442-180991464 GTGGGTACTTAGAAGGTGAAGGG + Intronic
1002741731 5:181439341-181439363 GTAGGTAGATATATGATAGATGG + Intergenic
1003972560 6:11313201-11313223 ATGGGTAGATATATGATGGATGG + Intronic
1003972566 6:11313236-11313258 ATGAATAGATAGATGGTGGGTGG + Intronic
1003972583 6:11313327-11313349 ATGGGTGGATAGATAGTGGATGG + Intronic
1003972584 6:11313331-11313353 GTGGATAGATAGTGGATGGATGG + Intronic
1003972588 6:11313354-11313376 CTGAGTAGATGGATGGTGGATGG + Intronic
1004571551 6:16850551-16850573 GGGGGCAGATGGAGGGTGGAGGG - Intergenic
1005889350 6:30123957-30123979 GGGAGTAGATGGGTGGTGGAGGG + Intergenic
1007109558 6:39304996-39305018 ATGGGCAGATGGATGCTGGAGGG + Intronic
1007481754 6:42154866-42154888 GTTGGCAGATAGATGGTGGATGG - Intergenic
1008856753 6:56097416-56097438 TTGGGGAGATAGATGGTAAAAGG - Intronic
1013052100 6:106546209-106546231 GTGGGGAGATAGATGCCAGATGG + Intronic
1013309414 6:108879451-108879473 ATGGGTGGATGGATGGGGGATGG - Intronic
1015805380 6:137102975-137102997 GTGAGAAGAGAGATGGTAGAGGG + Intergenic
1016522057 6:144956720-144956742 ATGGATAGATAGATGATAGATGG - Intergenic
1016522060 6:144956804-144956826 ATGGATAGATAGATGATAGATGG - Intergenic
1016522064 6:144956910-144956932 ATGGATAGATAGATGATAGATGG - Intergenic
1016522065 6:144956929-144956951 ATGGATAGATAGATGATAGATGG - Intergenic
1017051471 6:150397867-150397889 GTGGGGAGATTGATGGGGGCAGG + Intronic
1018748388 6:166780358-166780380 ATGGGGAGAGAGATGGGGGAAGG + Intronic
1018753950 6:166831889-166831911 ATGGATAGATAGATGATGGATGG + Intronic
1019287404 7:230511-230533 GTGGGTGGATGGAGGGTGGCCGG + Intronic
1019327014 7:443489-443511 GTGGATGGATGAATGGTGGATGG + Intergenic
1019327023 7:443520-443542 ATGGATGGATGGATGGTGGATGG + Intergenic
1019327048 7:443633-443655 GTGGATGGATGGATGGTGGATGG + Intergenic
1019327066 7:443727-443749 GTGAATAGATGGATGGTGGATGG + Intergenic
1019345620 7:528871-528893 ATGGATGGATAGATGATGGATGG + Intergenic
1019479979 7:1261893-1261915 ATGGATAGATAGATGGATGATGG - Intergenic
1019555878 7:1631070-1631092 GTGGGTAGATGGGTGGATGATGG - Intergenic
1019777424 7:2920662-2920684 ATGGATACATAGATGATGGATGG - Intronic
1019914699 7:4125219-4125241 ATGGATAGATGGATGATGGATGG + Intronic
1021433929 7:20592891-20592913 ATGGGAGGATAGAGGGTGGAAGG + Intergenic
1023022511 7:36022831-36022853 GTGGGGAGAGAGATGGAGGTGGG + Intergenic
1023075216 7:36474897-36474919 GTGGGGAGATGGATGTTGGAAGG - Intergenic
1023099072 7:36694885-36694907 GAGGATAGACAGATGATGGATGG + Intronic
1023116446 7:36867196-36867218 ATGGATAGATGGATGATGGATGG - Intronic
1024147862 7:46535589-46535611 GTGCGTAGACAGATGGGGGTGGG - Intergenic
1025120126 7:56294746-56294768 GTGGATGGATGGATGGTGAATGG + Intergenic
1025606872 7:63045768-63045790 GTGGATGGATAGATGATGGATGG - Intergenic
1025973035 7:66345958-66345980 GTGGGTAGGTGGGTGGGGGAGGG - Intronic
1026080160 7:67210857-67210879 ATGGATAGATAGATGATAGAAGG - Intronic
1026134662 7:67649188-67649210 GTCAGGAGAAAGATGGTGGATGG + Intergenic
1026275189 7:68870221-68870243 ATGGATAGATGGATGATGGATGG + Intergenic
1026275198 7:68870283-68870305 ATGGATAGATAATTGGTGGATGG + Intergenic
1026275413 7:68871851-68871873 GTGAGTAGATAGATGGATGGAGG - Intergenic
1026299876 7:69088641-69088663 ATAGATAGATAGATGATGGATGG + Intergenic
1026531244 7:71199398-71199420 GTGGACAGACAGATGATGGACGG - Intronic
1026696942 7:72603309-72603331 ATGGACAGATAGATGATGGATGG + Intronic
1026903439 7:74049470-74049492 ATAGATGGATAGATGGTGGATGG - Intronic
1026904277 7:74053911-74053933 ATGGGTAGATGGATGAGGGATGG + Intronic
1027191104 7:75995872-75995894 GTGGATAGGGAGATGGGGGAGGG + Intergenic
1027372058 7:77516750-77516772 GTCAGTAAATAGATGGTAGATGG - Intergenic
1028342122 7:89734632-89734654 GAGGGTAGAGAGTTGGAGGAAGG + Intergenic
1029604820 7:101592212-101592234 ATGAGTGGATGGATGGTGGATGG - Intergenic
1029972197 7:104800665-104800687 GTGGGTGGGTAGATGATGGTAGG - Intronic
1030282993 7:107796489-107796511 GTGGGTGGAGAGATGGAAGAGGG - Intronic
1030621291 7:111794074-111794096 GTGGGGACACAGATGCTGGAGGG + Intronic
1035278874 7:157765105-157765127 GTGAGTGGATGGATGGGGGAAGG - Intronic
1035278922 7:157765322-157765344 ATGGGTGGATGGATGATGGAGGG - Intronic
1035278964 7:157765505-157765527 GTGGGTGAATGGATGGAGGAAGG - Intronic
1035279154 7:157766343-157766365 ATGGGTAGATGGATGATGGATGG - Intronic
1035288624 7:157822715-157822737 ATGGGTAGATGGATAGTGGATGG - Intronic
1035288644 7:157822822-157822844 ATGGATAGATGGATAGTGGATGG - Intronic
1035290710 7:157837018-157837040 GTGGGTGGACAGGTGGTGGTGGG - Intronic
1035318751 7:158014607-158014629 GTGGGTGGATGGATGAGGGATGG - Intronic
1035501270 8:92855-92877 GTAGGTAGATATATGATAGATGG - Intergenic
1035929349 8:3763745-3763767 GTGAGGAGATAAATGGTGGTAGG + Intronic
1036701655 8:11017226-11017248 GTGGGTAGATAGGAGGTAGATGG + Intronic
1036778059 8:11627214-11627236 GTGGATTGATAGATGATGGATGG + Intergenic
1037598690 8:20375276-20375298 ATGGATGGATGGATGGTGGATGG - Intergenic
1038190368 8:25314572-25314594 GTGGGTGGATGGATGATAGATGG - Intronic
1038325129 8:26567231-26567253 ATGGATAGATGGATGATGGATGG - Intronic
1038325130 8:26567235-26567257 GTGGATGGATAGATGGATGATGG - Intronic
1038975153 8:32687301-32687323 GTGGGTGACTAGATGATGGATGG + Intronic
1039432079 8:37532797-37532819 GTGTGTAGTTAGGTGGGGGAGGG - Intergenic
1039786576 8:40839462-40839484 TTGGGTAGATACCTGGTGGTGGG - Intronic
1039953030 8:42187037-42187059 GATGGTAGATAGATGATAGATGG - Intronic
1040584391 8:48726252-48726274 ATGGATAGATAGATGATGGATGG - Intronic
1040805124 8:51386616-51386638 GTGGATAAATAGATGATAGATGG + Intronic
1042164509 8:65932859-65932881 GTGGGTGGATAGGAGGTAGATGG + Intergenic
1042578226 8:70246353-70246375 GTGGGGAAAAAGATGGTGTAAGG + Intronic
1042647788 8:71006480-71006502 GTGGATAGCTTGTTGGTGGATGG + Intergenic
1042964315 8:74334525-74334547 GTGGGTGGGTGGATGATGGATGG - Intronic
1042964324 8:74334560-74334582 ATGAGTGGATAGATGGTGGGTGG - Intronic
1042964340 8:74334660-74334682 GTGGATGGATAGATGATGGGTGG - Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044413442 8:91910069-91910091 GTGGATTGATAGGTGGTGGGTGG + Intergenic
1046204832 8:110979725-110979747 GTTGGTAGATGGATTGTGGGTGG - Intergenic
1047306780 8:123659071-123659093 ATGGATAGATGGATGATGGATGG - Intergenic
1047306789 8:123659120-123659142 GTGGATAGATGGATGATGGATGG - Intergenic
1047306790 8:123659124-123659146 GTGGGTGGATAGATGGATGATGG - Intergenic
1047306801 8:123659187-123659209 ATGGATAGATGGATGATGGATGG - Intergenic
1047306814 8:123659248-123659270 ATGGATGGATAGATGATGGATGG - Intergenic
1047306854 8:123659453-123659475 GTGGATGGATAGATGATGGATGG - Intergenic
1047306881 8:123659605-123659627 ATGGATGGATAGATGATGGATGG - Intergenic
1047813648 8:128438108-128438130 GTTGGTAGATAGATAGAGGGTGG - Intergenic
1048030136 8:130623416-130623438 GAGAGTAGATAGATATTGGAGGG - Intergenic
1048059987 8:130909033-130909055 ATGGATGGATGGATGGTGGATGG - Intronic
1048979739 8:139696917-139696939 GTGGATGGATAGATGGATGAAGG + Intronic
1048979765 8:139697005-139697027 GTGGACGGATGGATGGTGGATGG + Intronic
1048979784 8:139697087-139697109 GTGAACAGATGGATGGTGGATGG + Intronic
1048979802 8:139697172-139697194 GTGGACAGATGGATGGTGGATGG + Intronic
1048979835 8:139697297-139697319 GTGGATGGATAGATGGTGGGTGG + Intronic
1048979837 8:139697312-139697334 GTGGGTGGATGAATGGTGAATGG + Intronic
1048989285 8:139751909-139751931 GTGGATAGATGGATGGTGGATGG - Intronic
1048989302 8:139751990-139752012 ATGGATAGATGGATGGTAGACGG - Intronic
1048989335 8:139752185-139752207 GTAGATGGGTAGATGGTGGATGG - Intronic
1048989360 8:139752292-139752314 GTGGATGGATGGATGGTAGATGG - Intronic
1048989398 8:139752456-139752478 TTGGATAGATGGATGGTAGATGG - Intronic
1048989414 8:139752536-139752558 GTGGATAGATGGATGGTGGATGG - Intronic
1048989430 8:139752618-139752640 ATGGATAGATGGATGGTAGATGG - Intronic
1048989462 8:139752818-139752840 GTAGATGGGTAGATGGTGGATGG - Intronic
1048989510 8:139753029-139753051 ATGGGTAGATAGATGTTGGATGG - Intronic
1048989536 8:139753140-139753162 GTGGATGGGTGGATGGTGGATGG - Intronic
1048989541 8:139753155-139753177 ATGGATGGATGGATGGTGGATGG - Intronic
1048989576 8:139753312-139753334 GTGGATGGGTGGATGGTGGATGG - Intronic
1049155314 8:141062628-141062650 GTAGATAGACAGATGGGGGAGGG + Intergenic
1049223582 8:141439001-141439023 GTGGGTGGATGGATGAAGGATGG + Intergenic
1049350867 8:142163930-142163952 ATGGGTGGATGGATGGAGGATGG + Intergenic
1049359893 8:142207417-142207439 GTGGGTGGATGGATGGGGAATGG + Intergenic
1049359921 8:142207522-142207544 GTGGGTGGATTGATGGGGAATGG + Intergenic
1049359959 8:142207673-142207695 ATGGGTAGATGGATGGGGAATGG + Intergenic
1049364284 8:142229217-142229239 GTGGGTGGATGGATGGATGATGG + Intronic
1049364285 8:142229221-142229243 GTGGATGGATGGATGATGGATGG + Intronic
1049364302 8:142229294-142229316 ATGGATGGATGGATGGTGGATGG + Intronic
1049371953 8:142272225-142272247 ATGGGTAGATGGAAGGAGGAAGG - Intronic
1049371973 8:142272301-142272323 GTGGATGGGTAGATGGAGGAAGG - Intronic
1049372043 8:142272581-142272603 GTGGGTGGATGGAAGGAGGAAGG - Intronic
1049375080 8:142285501-142285523 GTGGGTGGGTAGATGATGGATGG + Intronic
1049405153 8:142449102-142449124 GTGGGTGGATGGACGGTGGACGG - Intergenic
1049423306 8:142526266-142526288 GTGGGGAGCTCGCTGGTGGAAGG + Intronic
1049428488 8:142548464-142548486 GTGGGTGGATGGATGGGGGATGG + Intergenic
1049428492 8:142548479-142548501 GGGGATGGATGGATGGTGGATGG + Intergenic
1049428495 8:142548494-142548516 GTGGATGGATGAATGGTGGATGG + Intergenic
1049428499 8:142548509-142548531 GTGGATGGATGGATGGTGGATGG + Intergenic
1049464328 8:142744142-142744164 ATGGGTGGATGGATGGGGGATGG + Intergenic
1049464417 8:142744451-142744473 ATGGGTGGATAGATGGGGGATGG + Intergenic
1049464907 8:142746690-142746712 GTGGATAGATAGATGGGGGATGG + Intergenic
1049464934 8:142746779-142746801 ATGGGTGGATGGATGGGGGATGG + Intergenic
1049464985 8:142746985-142747007 GTGGATGGATGGATGGTGGATGG + Intergenic
1049474794 8:142791872-142791894 GTGGGTGGATGGATGGAGGATGG - Intergenic
1049474899 8:142792572-142792594 GTGGGTGGATGGATGGAGGATGG - Intergenic
1049576463 8:143392106-143392128 GTGGGTGGATGGGTGGTGGATGG - Intergenic
1051709171 9:19912514-19912536 ATGGTTAGATAGATGGAGGAAGG - Intergenic
1052617527 9:30860812-30860834 CTGGGTGGATAGATGGGTGATGG + Intergenic
1052617528 9:30860816-30860838 GTGGATAGATGGGTGATGGATGG + Intergenic
1052793653 9:32902287-32902309 GTGGGGAGCTAGAAGGGGGATGG - Intergenic
1053600395 9:39603758-39603780 GCGGGCAGATAGATGCTGGCTGG + Intergenic
1053802979 9:41775744-41775766 ATGGATGGATGGATGGTGGATGG - Intergenic
1054142280 9:61539362-61539384 ATGGATGGATGGATGGTGGATGG + Intergenic
1054253133 9:62738626-62738648 GCGGGCAGATAGATGCTGGCTGG - Intergenic
1054451886 9:65407681-65407703 GTGTGTAGATGGATGGTGAGGGG - Intergenic
1054454305 9:65421712-65421734 ATGGGTAGATGGATGATGAATGG + Intergenic
1054462029 9:65470513-65470535 ATGGATGGATGGATGGTGGATGG + Intergenic
1054567249 9:66773125-66773147 GCGGGCAGATAGATGCTGGCTGG - Intergenic
1054650218 9:67618917-67618939 GTGGGTGGATAGATGGATAATGG - Intergenic
1054809662 9:69425047-69425069 GTGGGAAGACAGCTGGTGGGAGG - Intergenic
1055710496 9:79055725-79055747 GTAGATAGATAGATGGATGAGGG - Intergenic
1056302000 9:85251449-85251471 GTGGGTGTGTAGATGGTAGATGG + Intergenic
1056989582 9:91398253-91398275 GTGGATAGACAGATGATAGATGG + Intergenic
1057548927 9:96038020-96038042 GTGGGTAGGTGGGTGGTGGTGGG + Intergenic
1057690075 9:97276182-97276204 GTGGGTAGGTAGATGGGAGGAGG - Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058669703 9:107350537-107350559 GTGGGCAGATGGAGGGTGGGAGG - Intergenic
1059252158 9:112895531-112895553 GTGGGTAGATGGATGGATGATGG - Intergenic
1059252230 9:112895801-112895823 ATGGGTAGATGGATGGATGATGG - Intergenic
1059252238 9:112895832-112895854 GTGGGTGGATGGATGGATGATGG - Intergenic
1059409082 9:114120795-114120817 CTGGATAGATAGATGATGGATGG + Intergenic
1059409111 9:114120969-114120991 ATGGATGGATGGATGGTGGATGG + Intergenic
1059452414 9:114378716-114378738 GTGGGTAGATGGATGGATGTTGG - Intronic
1059498567 9:114731047-114731069 GTGGATCGATGGATGGTAGAAGG - Intergenic
1059995936 9:119909377-119909399 ATAGATAGATAGATGATGGATGG + Intergenic
1060824354 9:126679477-126679499 ATGGGTGGATAGATGGTTGAAGG + Intronic
1061244642 9:129395144-129395166 ATGGGAGGATAGATGGAGGATGG + Intergenic
1061245043 9:129397286-129397308 GTGGGAGGATGGATGGAGGATGG + Intergenic
1061245103 9:129397537-129397559 ATGGGTAGATGGATGATGGTCGG + Intergenic
1061256519 9:129456734-129456756 GTGGGTGAATGGAGGGTGGATGG + Intergenic
1061385621 9:130287754-130287776 CTGGGTAAATAGCTGGTGAATGG + Intronic
1061417482 9:130454941-130454963 ATGGATAGATGGATGATGGATGG - Intronic
1061417534 9:130455250-130455272 ATGGATGGATAGATGATGGATGG - Intronic
1061584455 9:131556932-131556954 GAGGCTAGAGAGATGGTGGATGG - Intergenic
1061584462 9:131556969-131556991 GATGGTAGATGGATGATGGATGG - Intergenic
1061783075 9:133007193-133007215 TTGGGTGGATGGATGGTGGATGG + Intergenic
1061848259 9:133400286-133400308 GTGGGTGAATAGAAGGGGGAAGG - Intronic
1061950509 9:133933422-133933444 ATGGGTGGATGAATGGTGGATGG + Intronic
1061950533 9:133933543-133933565 ATGGATGGATGGATGGTGGATGG + Intronic
1061950538 9:133933562-133933584 ATGGATGGATGGATGGTGGATGG + Intronic
1061950597 9:133933828-133933850 ATGGATGGATGGATGGTGGATGG + Intronic
1061950625 9:133933937-133933959 ATGGATGGATGGATGGTGGATGG + Intronic
1061964066 9:134003373-134003395 GTGGATGGGTAGAGGGTGGATGG - Intergenic
1061980952 9:134103380-134103402 CTGGATGGATGGATGGTGGATGG - Intergenic
1061980956 9:134103395-134103417 GTGGATGGATGGATGCTGGATGG - Intergenic
1061980970 9:134103458-134103480 GTGGATGGATGGATGGTGGATGG - Intergenic
1061980976 9:134103480-134103502 GTGGATGGATGGATGCTGGATGG - Intergenic
1061981029 9:134103735-134103757 ATGGATAGATGGATGCTGGAAGG - Intergenic
1061981051 9:134103842-134103864 ATGGATAGATGGATGCTGGATGG - Intergenic
1061981081 9:134103991-134104013 GTGGATGGATGGATGGTGGATGG - Intergenic
1061981085 9:134104006-134104028 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981101 9:134104077-134104099 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981181 9:134104419-134104441 GATGGTGGATGGATGGTGGATGG - Intergenic
1061981184 9:134104430-134104452 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981191 9:134104467-134104489 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981246 9:134104695-134104717 GATGGTGGATGGATGGTGGATGG - Intergenic
1061981249 9:134104706-134104728 ATGGATGGATGGATGGTGGATGG - Intergenic
1062092308 9:134684890-134684912 GTGAATGGATAGATGGTGGATGG - Intronic
1062092338 9:134685038-134685060 GATGGTGGATGGATGGTGGATGG - Intronic
1062092341 9:134685049-134685071 ATGGATGGATGGATGGTGGATGG - Intronic
1062092349 9:134685080-134685102 GTGGATGGATGGATGGTGGGTGG - Intronic
1062092378 9:134685208-134685230 ATGGGTGAATGGATGGTGGATGG - Intronic
1062092395 9:134685286-134685308 GTGGATGGATGGATGGTGGATGG - Intronic
1062092411 9:134685356-134685378 ATGGGTGAATGGATGGTGGATGG - Intronic
1062092448 9:134685526-134685548 CTGGATGGATGGATGGTGGATGG - Intronic
1062092464 9:134685599-134685621 GTGGATGGATGGATGATGGATGG - Intronic
1062092467 9:134685614-134685636 GTGGATGGATGGATGGTGGATGG - Intronic
1062092477 9:134685660-134685682 GATGGTGGATGGATGGTGGATGG - Intronic
1062092480 9:134685671-134685693 GATGGTGGATGGATGGTGGATGG - Intronic
1062092495 9:134685746-134685768 GATGGTGGATGGATGGTGGATGG - Intronic
1062092498 9:134685757-134685779 GATGGTGGATGGATGGTGGATGG - Intronic
1062092520 9:134685868-134685890 GTGGGTGGATGGATGGATGATGG - Intronic
1062092538 9:134685934-134685956 ATGGATGGATGGATGGTGGATGG - Intronic
1062172282 9:135141651-135141673 ATGGATGGATAGATGATGGATGG + Intergenic
1062172296 9:135141736-135141758 ATGGATGGATAGATGATGGATGG + Intergenic
1062172306 9:135141799-135141821 ATGGATGGATAGATGATGGATGG + Intergenic
1062201271 9:135304094-135304116 ATGGATAGACAGATGATGGAGGG + Intergenic
1062201296 9:135304213-135304235 GTGGATGGATGGATGATGGAGGG + Intergenic
1062201322 9:135304337-135304359 GTGGATAGATGGATGATGGAGGG + Intergenic
1062201333 9:135304390-135304412 GTGGATAGATGAATGATGGAGGG + Intergenic
1062201344 9:135304439-135304461 ATGGATAGATGGATGATGGAGGG + Intergenic
1062201359 9:135304496-135304518 GTGGATGGATGGATGATGGAGGG + Intergenic
1062201373 9:135304549-135304571 GTGGATGGATGGATGATGGAGGG + Intergenic
1062201395 9:135304648-135304670 GTGGATAGATGGATGATGGAGGG + Intergenic
1062217059 9:135394893-135394915 GTGGATGGATGGGTGGTGGATGG + Intergenic
1062217086 9:135395020-135395042 GGGGGTGGATGGGTGGTGGATGG + Intergenic
1062246718 9:135572361-135572383 GGGGGTAGAGAGGTGGTGAATGG - Intergenic
1062247722 9:135578049-135578071 GTGGGTGGATGGATGGTGGATGG - Intergenic
1062247791 9:135578395-135578417 GTGGGTGGATGGATGGTGGATGG - Intergenic
1062247860 9:135578741-135578763 GTGGGTGGATGGATGGTGGATGG - Intergenic
1062247937 9:135579168-135579190 GGTGGAAGATAAATGGTGGATGG - Intergenic
1062247967 9:135579329-135579351 ATGGGTGGATAGATGGTGGATGG - Intergenic
1062248037 9:135579787-135579809 GAGGGTAGATGGATAGTGGGTGG - Intergenic
1062520837 9:136957243-136957265 GTGGGTGGATGGATGGATGATGG + Intronic
1062520958 9:136957636-136957658 GTGGGTGGATGGATGGATGAAGG + Intronic
1062649710 9:137569326-137569348 GTGGGTAGATGGATGGAAGGTGG - Intronic
1062649860 9:137569898-137569920 GTGAGTGGATGGATGGTGGGTGG - Intronic
1203607643 Un_KI270748v1:70557-70579 GTAGGTAGATATATGATAGATGG + Intergenic
1185480461 X:442383-442405 ATGGATAGATAGATGATAGATGG - Intergenic
1185495218 X:549578-549600 GTGGGTGGATGGATGGATGAAGG - Intergenic
1185495289 X:549972-549994 GTGGGTGGATGGATGGAAGAAGG - Intergenic
1185497455 X:566174-566196 GTGGGTGGATAGATGATAAATGG + Intergenic
1185497529 X:566570-566592 GTAGATGGATGGATGGTGGATGG + Intergenic
1185498672 X:580572-580594 ATGGATAGATAGATGATTGATGG + Intergenic
1185498680 X:580707-580729 ATGGATAGATAGATGATTGATGG + Intergenic
1185498684 X:580768-580790 ATGGATAGATAGATGATAGATGG + Intergenic
1185498715 X:581253-581275 GTGGATAGATAAATGATAGATGG + Intergenic
1185498716 X:581272-581294 ATGGATAGATAGATGATTGATGG + Intergenic
1185543743 X:925356-925378 ATGGATGGATGGATGGTGGATGG + Intergenic
1185543748 X:925375-925397 ATGGATGGATGGATGGTGGATGG + Intergenic
1185547215 X:955133-955155 AATGGTAGATAGATGATGGATGG - Intergenic
1185582291 X:1219556-1219578 GTACATAGATAGATGATGGATGG + Intergenic
1185582423 X:1220943-1220965 AGGGGTAGATAGATGATGGATGG + Intergenic
1185611440 X:1395711-1395733 GTGGGTGGATGGATAATGGATGG + Intergenic
1185613698 X:1407526-1407548 ATGGGTAGGTAGATGATGGATGG + Intronic
1185624532 X:1472968-1472990 GTGGGTGGATGGATGGGGGTGGG + Intronic
1185624620 X:1473334-1473356 ATGGGTGGATGAATGGTGGATGG + Intronic
1185624710 X:1473732-1473754 GTGGGTGGATGGATGATGAATGG + Intronic
1185624725 X:1473777-1473799 GTGGGTGGATGAATGGTGGGTGG + Intronic
1185636756 X:1558122-1558144 GTAGGTAGATAGATAGATGATGG - Intergenic
1185694369 X:2184338-2184360 ATGGATAGATACATGGTGGGTGG - Intergenic
1185695789 X:2193459-2193481 ATGGATTGATAGATGATGGATGG - Intergenic
1185695854 X:2194003-2194025 GTAGGTAGACAGATGATGGATGG - Intergenic
1185695859 X:2194053-2194075 GCAGGTAGATAGATGATAGATGG - Intergenic
1185780559 X:2840942-2840964 ATGGATAGATAGATGATGGATGG + Intronic
1185780568 X:2841118-2841140 ATGGATAGATAGATGATAGATGG + Intronic
1185867944 X:3639492-3639514 GTGGGTACATGGATGGATGAAGG + Intronic
1185883825 X:3764128-3764150 GTGGGTGGATGGGTGATGGATGG - Intergenic
1185895688 X:3856782-3856804 ATAGGTAGATAGATGTTAGATGG + Intergenic
1185895692 X:3856889-3856911 GTAGGTAGATAGATGATAGATGG + Intergenic
1185900807 X:3895206-3895228 ATAGGTAGATAGATGTTAGATGG + Intergenic
1185900811 X:3895313-3895335 GTAGGTAGATAGATGATAGATGG + Intergenic
1185905922 X:3933645-3933667 ATAGGTAGATAGATGTTAGATGG + Intergenic
1185905926 X:3933752-3933774 GTAGGTAGATAGATGATAGATGG + Intergenic
1186150436 X:6669193-6669215 ATGGATAGATTGATGATGGATGG + Intergenic
1186574058 X:10746572-10746594 GTGGCTAGGAAAATGGTGGAAGG - Intronic
1186724727 X:12345039-12345061 GTGGGTAGATGGATAATGGATGG + Intronic
1186955865 X:14681423-14681445 GTGGATAAATACATGGTGGATGG - Intronic
1187080798 X:15985056-15985078 GTGAGGATATTGATGGTGGAGGG - Intergenic
1187425796 X:19176361-19176383 GTTGGGAGACAGATGGTGGTGGG - Intergenic
1189260488 X:39675229-39675251 GTGTGTGGCTACATGGTGGATGG - Intergenic
1189692710 X:43633741-43633763 GTGTGTATATTGAGGGTGGAGGG + Intergenic
1189853100 X:45196282-45196304 ATGGGTGGATGGATGGTGGATGG + Intronic
1190433827 X:50403992-50404014 GTGGGTAGATATAGGGATGAAGG - Intronic
1190443582 X:50500319-50500341 GTGGGTAGAGAGATGATGATTGG - Intergenic
1190561185 X:51686910-51686932 ATGAGTAAATGGATGGTGGAGGG - Intergenic
1190563106 X:51706407-51706429 ATGAGTAAATGGATGGTGGAGGG + Intergenic
1190631293 X:52389432-52389454 ATGGGGAGCTAGAAGGTGGAGGG + Intergenic
1193248019 X:79253176-79253198 TTGGGTAGATAGAGGTGGGAAGG + Intergenic
1193490376 X:82142450-82142472 GTGGGAAGAAGGATGGTAGATGG - Intergenic
1193773607 X:85617738-85617760 GTGGGATGTTAGATGGTTGACGG + Intergenic
1194374234 X:93112547-93112569 GTGGGGAGAGATATGGGGGATGG + Intergenic
1195363493 X:104106782-104106804 GTGGGGAGATGGATGGAGCAGGG - Intronic
1195543738 X:106091893-106091915 GTTTGTATATAGGTGGTGGATGG + Intergenic
1195867598 X:109450033-109450055 GTGGGCAGAGAGAGGGAGGAAGG + Intronic
1196421937 X:115531801-115531823 GGGGGTTGAGAGGTGGTGGAGGG - Intergenic
1196807558 X:119602016-119602038 GAAGGTAGATAGATGTTGGCTGG - Intronic
1197862596 X:130986337-130986359 GAGGGTAGAGAGTTGGAGGAGGG - Intergenic
1198202591 X:134436788-134436810 GTGGGTAGATAGTTCAGGGAGGG - Intergenic
1198249478 X:134866305-134866327 GGGGTTAGATCGATGGTGCAGGG - Intergenic
1198322045 X:135527843-135527865 GGGGGTAGGGAGATGGTGAAGGG + Intronic
1199499698 X:148496406-148496428 CTGGTTAGATAGATCCTGGAAGG + Intergenic
1200682259 Y:6226615-6226637 GTGGGGAGAGATATGGGGGATGG + Intergenic
1201144757 Y:11058128-11058150 CTGGGTAGATGGGTGGCGGATGG + Intergenic
1201289494 Y:12408923-12408945 ATGGATAGATAGATGATGGATGG - Intergenic
1201289501 Y:12409055-12409077 ATGGATAGATAGATGATGGATGG - Intergenic
1201747138 Y:17389198-17389220 GTAGATAAATAGATGATGGATGG + Intergenic