ID: 1141110689

View in Genome Browser
Species Human (GRCh38)
Location 16:81268409-81268431
Sequence GACTCACTCCTTTTGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141110689_1141110694 0 Left 1141110689 16:81268409-81268431 CCCAGCAGCAAAAGGAGTGAGTC 0: 1
1: 0
2: 0
3: 21
4: 160
Right 1141110694 16:81268432-81268454 CTCAGTCCTTATGGAGAGCTGGG No data
1141110689_1141110691 -9 Left 1141110689 16:81268409-81268431 CCCAGCAGCAAAAGGAGTGAGTC 0: 1
1: 0
2: 0
3: 21
4: 160
Right 1141110691 16:81268423-81268445 GAGTGAGTCCTCAGTCCTTATGG 0: 1
1: 0
2: 2
3: 8
4: 118
1141110689_1141110693 -1 Left 1141110689 16:81268409-81268431 CCCAGCAGCAAAAGGAGTGAGTC 0: 1
1: 0
2: 0
3: 21
4: 160
Right 1141110693 16:81268431-81268453 CCTCAGTCCTTATGGAGAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141110689 Original CRISPR GACTCACTCCTTTTGCTGCT GGG (reversed) Intronic
900186757 1:1336497-1336519 GACCCACTGCTTTTGCTCCCTGG + Exonic
900621662 1:3590398-3590420 GACCCACTCCTCTTGCTGGGGGG - Intronic
900772663 1:4558170-4558192 CAGCCACTCCTTTTGCTTCTCGG + Intergenic
902701670 1:18176465-18176487 GACTGACTCCTTTTGCAGATGGG - Intronic
903104995 1:21069722-21069744 GACTCAGTCTTTTTTCTGTTTGG - Intronic
903591398 1:24458614-24458636 GTCTCACACCTTTGGCTGCACGG - Intronic
904411177 1:30325770-30325792 GACTCACTGCGTCTGCTGATGGG + Intergenic
907170148 1:52455576-52455598 GTCTCACTCCTGTTGCTGCCCGG - Intronic
908716630 1:67077663-67077685 GACTTACTCTTTTAGTTGCTGGG - Intergenic
910840852 1:91560133-91560155 GACTGAGTCCTTTTGTTACTTGG - Intergenic
912307967 1:108590108-108590130 CACTCACTCATTTTGCTAGTGGG - Intronic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
915396743 1:155590734-155590756 GCCTCAGGCCTTTTGTTGCTGGG - Intergenic
915588574 1:156858374-156858396 AACTAACTGCTTTTCCTGCTGGG + Intronic
916421191 1:164639377-164639399 ATCTCTCTCCTTTTGATGCTGGG + Intronic
919254745 1:195106320-195106342 GAATAACACCTTTTGCTTCTAGG + Intergenic
920549394 1:206845931-206845953 TGCCCTCTCCTTTTGCTGCTAGG + Intergenic
923273145 1:232375310-232375332 GCCTCACTCCCCTGGCTGCTTGG - Intergenic
1064888309 10:20137962-20137984 GCCTCACTCCCTTAGCTGCCAGG + Intronic
1068200056 10:53772348-53772370 AGCTCACTGCTTATGCTGCTGGG + Intergenic
1068779316 10:60902634-60902656 AACTCTCTCCTTTTTCTCCTGGG + Intronic
1072082990 10:92051960-92051982 GATTCACACCTTTGTCTGCTTGG - Exonic
1075461976 10:122622585-122622607 GACTGACTCCTTCTCCTGGTGGG - Intronic
1080984895 11:37450731-37450753 CTCTCTCTCCTATTGCTGCTTGG - Intergenic
1082960169 11:58912377-58912399 GACTTCCTGCTTTTGCTTCTGGG + Intronic
1082970358 11:59013850-59013872 GACTAATTCTTTTTTCTGCTTGG - Intronic
1083039187 11:59669398-59669420 GACTCACTCCTCAGGCTGCTCGG + Intergenic
1085250923 11:75143326-75143348 GAGTCACTTCCTCTGCTGCTGGG - Intronic
1088171617 11:107004126-107004148 GACTCATTCCTCTAGATGCTAGG - Intronic
1089851187 11:121498000-121498022 TACTCCCTGCTTTTCCTGCTGGG - Intronic
1091350858 11:134892882-134892904 GAGACACCCCTTTCGCTGCTTGG + Intergenic
1091535405 12:1403356-1403378 GAATTACTCCTTTTGCTTTTTGG + Intronic
1093471768 12:19509855-19509877 GTCTCACTCACTTTGTTGCTTGG + Intronic
1096017162 12:48287058-48287080 GACTCACTCCTTGAGCTCCTGGG + Intergenic
1101732613 12:107439352-107439374 GACTCAGTCCTCTTGCTCCAGGG + Intronic
1102045482 12:109827440-109827462 GGCTCACTCCTGTCCCTGCTTGG - Intronic
1103251027 12:119500185-119500207 GACTCAACCCTTTGGCTCCTAGG + Intronic
1104401687 12:128481591-128481613 CACTCACTCCCTGTGCGGCTTGG - Intronic
1105564168 13:21526923-21526945 GACTCCCTCCTTTATTTGCTTGG - Intronic
1107825765 13:44327507-44327529 GACTCAGTCCTTTTGCTAAGCGG + Intergenic
1108074431 13:46665014-46665036 TACTCACTCAATTGGCTGCTTGG - Intronic
1112794457 13:103040245-103040267 GATTCTGTCCTTTTGCTACTGGG - Intergenic
1113946686 13:114048462-114048484 GCCTCCCTCCTTTTCCCGCTAGG - Intronic
1114455638 14:22851550-22851572 CACTCACTCAGTTTCCTGCTAGG + Intergenic
1114643466 14:24240412-24240434 CACTCACTCCTTTTGCTCTGTGG + Exonic
1115436263 14:33378288-33378310 GATTCCCTCCTGTTGCTTCTAGG - Intronic
1117498006 14:56324817-56324839 TACCCACCCTTTTTGCTGCTTGG - Intergenic
1120973250 14:90227082-90227104 GACTCACTCATTCTACTTCTAGG + Intergenic
1124887942 15:33704363-33704385 CACTTACTCCGTTTGCAGCTGGG - Intronic
1126107878 15:45158783-45158805 GAGTCTCCCCTTCTGCTGCTGGG - Intronic
1126350498 15:47740671-47740693 GGCTCGCTCCTTTGGCTCCTGGG - Intronic
1127705647 15:61544999-61545021 GACTCACTGAGTTTACTGCTTGG - Intergenic
1128091968 15:64925425-64925447 GTCTCCTTCCTTTTGCTTCTAGG + Intronic
1129611265 15:77059875-77059897 GACTCACACTTAGTGCTGCTTGG + Intronic
1130632480 15:85582705-85582727 AACTCCTTCCTTTTCCTGCTTGG + Intronic
1131396179 15:92088147-92088169 CACTCACTCCTTCTTCTGCATGG + Intronic
1131566621 15:93491723-93491745 GAGTGATTCCTTTTGCTGCTGGG + Intergenic
1133031985 16:3015492-3015514 GCCTCAGGCCTTTTGTTGCTGGG - Exonic
1139946608 16:70646631-70646653 GACTCTCTCCTCCTGCTCCTTGG + Exonic
1140536451 16:75714282-75714304 GACTCACCCCTTCTGCCTCTGGG - Intronic
1141110689 16:81268409-81268431 GACTCACTCCTTTTGCTGCTGGG - Intronic
1143516210 17:7420463-7420485 AACTCTGTCCTGTTGCTGCTGGG + Exonic
1146563102 17:33888632-33888654 GACTCACTCCTTTGGCCCCTGGG - Intronic
1147469508 17:40646840-40646862 GACTCATTCCTTATGCTCCAGGG - Intronic
1152075616 17:78157988-78158010 AAGTCATTCCTTTTGATGCTGGG - Intronic
1153271541 18:3327285-3327307 GGCTCACTCCTGTGGCTGGTGGG - Intergenic
1156625962 18:38909400-38909422 GACTCCTTCATTTTGCTGGTGGG - Intergenic
1158914367 18:62106822-62106844 GACTTACTGCCTTTGCAGCTTGG - Exonic
1159377498 18:67612508-67612530 CACTCACTCCCTTTGCTCCTCGG - Intergenic
1160412333 18:78683482-78683504 GCCTCACTCCTGCTGCTGCCTGG - Intergenic
1162747787 19:12808583-12808605 GACTACCTTCTGTTGCTGCTTGG - Intronic
1164692192 19:30219724-30219746 GACTCTGTTCTTTTGGTGCTGGG + Intergenic
1164882187 19:31741701-31741723 GACTGACTGCTTTTCCTGCCTGG + Intergenic
1166678852 19:44755509-44755531 GACTCACTCCCTCAGCTTCTGGG - Intronic
1166743495 19:45128811-45128833 GAGTCATTCCTTTTGATGCTGGG - Intronic
925344399 2:3160330-3160352 GACTCACTCCTCAGGCTCCTGGG + Intergenic
927550019 2:23990123-23990145 GATTCCCTCCTCTTCCTGCTAGG + Intronic
927946756 2:27139312-27139334 GCCCCATTCCTTCTGCTGCTGGG - Exonic
934900813 2:98158623-98158645 GACTCCATCCTCTTGCTGCCAGG - Intronic
937145628 2:119641783-119641805 GACTGCCTCATTTTGCTGCGGGG + Intronic
938022110 2:127914508-127914530 GTCCCAATCTTTTTGCTGCTGGG + Intergenic
938067316 2:128288149-128288171 GGCTCACTCCTTCTGCTTCTAGG + Intronic
938130653 2:128713579-128713601 TACTCAGTCCTTTTCCTGCCAGG + Intergenic
938938737 2:136149940-136149962 GACAAATTCCTCTTGCTGCTGGG + Intergenic
942487871 2:176458168-176458190 GACTCACTCATATTGTTCCTTGG - Intergenic
943781360 2:191827774-191827796 GACCCATTCCTATTACTGCTGGG + Intergenic
946117113 2:217472783-217472805 GGCTCCCTCCTTTTTCTTCTTGG + Intronic
946504318 2:220282607-220282629 GAATCATTCCTTCTGCAGCTGGG - Intergenic
947105489 2:226663879-226663901 TACTCTTTCCTTTTGCTCCTGGG - Intergenic
947282511 2:228471035-228471057 TACTCACTCCTTTCTCTGCTTGG + Intergenic
947878133 2:233481133-233481155 GACTCTCTCTTATTCCTGCTTGG - Intronic
948970931 2:241426224-241426246 GACTCATTTCTTTTGCTGGACGG + Intronic
1170911059 20:20568926-20568948 AAATAAATCCTTTTGCTGCTAGG + Intronic
1171410142 20:24941084-24941106 GACCCACCCCCTTTGCTTCTAGG - Intergenic
1172385933 20:34534268-34534290 TAGTCTCTCCTTTTACTGCTGGG + Intronic
1172641396 20:36442536-36442558 GGCTCACTCCTTCTGGGGCTGGG - Intronic
1173384907 20:42578236-42578258 GATTCACTCCTTTTGCTTCCAGG + Intronic
1176051081 20:63120074-63120096 GACTGACCTCTTTTGGTGCTGGG + Intergenic
1177008901 21:15707793-15707815 TCCCCACTCGTTTTGCTGCTAGG + Intergenic
1177760289 21:25395471-25395493 GTCTCACCCCTTTTGGTGTTGGG - Intergenic
1178431965 21:32525340-32525362 GGCCCACTGCTTTTGCTTCTGGG - Intergenic
1182554245 22:31120419-31120441 AACTCACTCCCTTTTCAGCTGGG + Intergenic
1183214710 22:36472055-36472077 GTCTCTCTCTCTTTGCTGCTGGG - Intronic
1185119691 22:48958577-48958599 GCCTCCCTCCTCTGGCTGCTGGG + Intergenic
949472918 3:4415482-4415504 GACTCAATCATTTCACTGCTGGG + Intronic
949754011 3:7388248-7388270 GACTTCCTCCTTTTCCTACTTGG + Intronic
951867975 3:27328760-27328782 GGCTCCCTGCTTTTGATGCTTGG - Intronic
952508812 3:34034085-34034107 GAATCGCTCATTTTGCTACTCGG - Intergenic
952581714 3:34841128-34841150 GACCCAGCCCTTTTGCTCCTGGG + Intergenic
953000652 3:38930073-38930095 GACTCAGTATTTTTGCAGCTTGG - Intronic
957182348 3:76895930-76895952 GACGCTTTCCTTTTGCTCCTTGG + Intronic
958588484 3:96121699-96121721 GACTTACTCCTTTTCAGGCTTGG + Intergenic
960726830 3:120678635-120678657 AACTCACACCTCTTGGTGCTTGG - Intronic
969313294 4:6366779-6366801 GGCTCACTCCTTCAGCTGCTGGG - Intronic
971252281 4:24983367-24983389 CCTTCCCTCCTTTTGCTGCTTGG + Intergenic
972934735 4:44119486-44119508 GACTCACTCCCTTTGCTCATTGG - Intergenic
973802458 4:54492842-54492864 GACACACTCTATCTGCTGCTTGG + Intergenic
975202469 4:71607755-71607777 GACACCCTCCTCATGCTGCTTGG + Intergenic
976127284 4:81847478-81847500 CACTCACTCCTTCAGCTGCTGGG + Intronic
977754347 4:100649298-100649320 GACTCATTCCCCTGGCTGCTGGG - Intronic
982186435 4:152806316-152806338 GACAAACTTCTTTTGCTGCTGGG + Intronic
984388481 4:179096377-179096399 GACACATTTCTTTTGCTTCTAGG + Intergenic
984652536 4:182286093-182286115 GCCTCACACCTCTTGCTTCTGGG + Intronic
984706934 4:182854369-182854391 GCATCATTCCTTTCGCTGCTGGG - Intergenic
985310459 4:188592214-188592236 GACTTACTCCTTTTTCTTCTAGG + Intergenic
987246764 5:16056893-16056915 GACTCTCTCCTTTAGGTGCTGGG + Intergenic
994040667 5:95256319-95256341 GGCCCACTCCCTGTGCTGCTTGG + Intronic
995438536 5:112164282-112164304 GCCTCAGTCCTTTTGCATCTGGG + Exonic
995455865 5:112351653-112351675 GTCTCTCTCTTTTTGTTGCTGGG - Intronic
996341614 5:122444717-122444739 CACTTACTCCTTTAGCTGCTTGG - Exonic
999443304 5:151619746-151619768 AACTAACTCCTTTTGCAGGTGGG - Intergenic
999780910 5:154849367-154849389 TCTTCACTCCTTTTGCTGCATGG + Intronic
999824076 5:155257675-155257697 GCCTCACTCCTGTTGCTGGAGGG + Intergenic
1000802656 5:165747955-165747977 GACTCTCTCCTTTTCCAGTTAGG + Intergenic
1001318153 5:170659019-170659041 GTCTCAATGCTTTTGATGCTGGG - Intronic
1001759097 5:174192845-174192867 GACACACACCTTCTGCTGGTTGG + Intronic
1002467941 5:179417155-179417177 GAGACATTCCTGTTGCTGCTGGG - Intergenic
1002530843 5:179843913-179843935 GACTCTCTCCTCTGTCTGCTTGG - Intronic
1005622286 6:27631138-27631160 GAGTCTCTCCTTTTTCTCCTCGG + Intergenic
1005706244 6:28456533-28456555 GACATACTCCCTTTGCTGCCAGG - Intergenic
1005756402 6:28928332-28928354 GTCCCACTCAGTTTGCTGCTTGG - Intergenic
1007667411 6:43523399-43523421 CACTGAGCCCTTTTGCTGCTGGG - Exonic
1007749220 6:44061993-44062015 GACTCACTGATTCTGCTTCTGGG + Intergenic
1008093670 6:47316769-47316791 TACTCACACCTTTTCCTGTTGGG - Intergenic
1009058576 6:58369902-58369924 GATTAACTGCTTTTGATGCTGGG - Intergenic
1011305896 6:85926403-85926425 GACCCTCTCCTTTAGATGCTTGG + Intergenic
1018887876 6:167956831-167956853 GCCTCTCTCCTTTTCCTGCCGGG + Intronic
1019835551 7:3379425-3379447 GAGTCACTCCTTTTCTTCCTTGG - Intronic
1020309930 7:6859733-6859755 GCCTCACTCCTGGTTCTGCTGGG - Intergenic
1020971190 7:14941687-14941709 AACTGACTCCTTTTGCTACCCGG - Intronic
1028581735 7:92416142-92416164 GACTCACTGTTTTTGGAGCTGGG - Intergenic
1030550821 7:110957488-110957510 GAATCACTCTTTCTGCTGCTTGG - Intronic
1032913486 7:136460856-136460878 GATTCTCTTCTTTTACTGCTAGG - Intergenic
1035838609 8:2786441-2786463 GACCCACACCTGTGGCTGCTCGG - Intergenic
1035975434 8:4305324-4305346 GTCTCACTTCTCTTGCTGCCTGG - Intronic
1039059901 8:33565253-33565275 GCCTTCCTCCTTTTGCTGGTCGG - Intronic
1039431604 8:37529321-37529343 CACTCACTCATTGTCCTGCTTGG - Intergenic
1043478029 8:80624062-80624084 CACTCATTCCCTTTGCTGCTGGG + Intergenic
1043776118 8:84271651-84271673 GATTCATTCCATTTACTGCTGGG - Intronic
1044393334 8:91679229-91679251 TACTAACTCCATTTGCTGGTTGG - Intergenic
1044954930 8:97470232-97470254 CACTCACTATTATTGCTGCTAGG + Intergenic
1050599053 9:7232392-7232414 GTCTCACTCCTTTTAGTGTTAGG - Intergenic
1052855682 9:33404822-33404844 GCCTCACTCCCTGTGCTTCTTGG - Intergenic
1054912994 9:70470980-70471002 GAATCACTGCATTTCCTGCTTGG + Intergenic
1057822358 9:98342440-98342462 GACTTCATCCTTTAGCTGCTGGG + Intronic
1057891358 9:98872384-98872406 CTCTGACTGCTTTTGCTGCTGGG + Intergenic
1058191713 9:101924415-101924437 GACTCAGACCTGTTACTGCTGGG - Intergenic
1058640703 9:107081403-107081425 GGCTCACTCATTTTGCTTTTAGG - Intergenic
1060150124 9:121283088-121283110 AACTCCCTCCTTTTGCTTCTGGG + Intronic
1060990919 9:127848412-127848434 GACTCATACCTGTAGCTGCTCGG - Intronic
1187402707 X:18975854-18975876 GAGTCACTCCATTGGCTGCATGG - Intronic
1187968641 X:24637858-24637880 GTCTCACTCCTTTTTCTCCATGG - Intronic
1189147473 X:38669904-38669926 GACTCTCCCATTTTGCTGATGGG - Intronic
1189772120 X:44437338-44437360 CACTCACTCCCTCAGCTGCTGGG - Intergenic
1192039722 X:67605724-67605746 GAGTTACTCTTTCTGCTGCTTGG - Intronic
1192363660 X:70454443-70454465 TCCTCTCTCCTTTTCCTGCTGGG + Intronic
1192576678 X:72248249-72248271 GTCACACTCCTTTTGCGCCTAGG + Intronic
1193902646 X:87201771-87201793 GACTTACTTCTTTTGTTTCTTGG - Intergenic
1195621014 X:106955147-106955169 GAGTCAATCCTTCTGATGCTAGG + Intronic
1199207358 X:145164464-145164486 GACTCACGCATTTTACTACTGGG + Intergenic
1200042085 X:153378219-153378241 GTCTCATTCCATTTGCTGGTGGG - Intergenic
1201448125 Y:14080655-14080677 GACACTCTACTTTTGCTGTTGGG + Intergenic