ID: 1141110914

View in Genome Browser
Species Human (GRCh38)
Location 16:81270054-81270076
Sequence CCCCGCCAGGAGCTAGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141110914_1141110927 26 Left 1141110914 16:81270054-81270076 CCTGAGCCTAGCTCCTGGCGGGG 0: 1
1: 0
2: 2
3: 18
4: 159
Right 1141110927 16:81270103-81270125 CACAGTGCCAGGCTGAGAGAGGG 0: 1
1: 1
2: 14
3: 98
4: 713
1141110914_1141110921 15 Left 1141110914 16:81270054-81270076 CCTGAGCCTAGCTCCTGGCGGGG 0: 1
1: 0
2: 2
3: 18
4: 159
Right 1141110921 16:81270092-81270114 CCCCCAGATGCCACAGTGCCAGG 0: 1
1: 0
2: 2
3: 19
4: 344
1141110914_1141110926 25 Left 1141110914 16:81270054-81270076 CCTGAGCCTAGCTCCTGGCGGGG 0: 1
1: 0
2: 2
3: 18
4: 159
Right 1141110926 16:81270102-81270124 CCACAGTGCCAGGCTGAGAGAGG 0: 1
1: 0
2: 11
3: 103
4: 610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141110914 Original CRISPR CCCCGCCAGGAGCTAGGCTC AGG (reversed) Intronic
900322772 1:2093315-2093337 GCCCGCCAAGAGCAAGGCTGGGG - Intronic
900629749 1:3628042-3628064 CCCCGCCAGGCTCTGGGCTCTGG - Intronic
902218023 1:14946955-14946977 TCCCGCCCGGAGCTAGACACGGG + Intronic
904822809 1:33256379-33256401 CCGCGCCAGGCGCCCGGCTCCGG - Intergenic
912246487 1:107965734-107965756 CCTCGCGAGGAAATAGGCTCAGG - Intergenic
912488575 1:110048458-110048480 GCCACCCAGGAGCTGGGCTCAGG - Intronic
913975419 1:143451207-143451229 CCCGGCCCGGGGCTAGGGTCTGG - Intergenic
914069811 1:144276823-144276845 CCCGGCCCGGGGCTAGGGTCTGG - Intergenic
914109344 1:144689531-144689553 CCCGGCCCGGGGCTAGGGTCTGG + Intergenic
915036354 1:152928985-152929007 CCCCACCAGGATGTAAGCTCTGG + Intergenic
915141333 1:153770488-153770510 GCCCACCATGAGCCAGGCTCTGG + Intronic
916502461 1:165398734-165398756 CAGAGCCAGGAGCCAGGCTCTGG + Intergenic
1062910149 10:1206883-1206905 TCCCCCCAGGAACTGGGCTCTGG + Intronic
1066004290 10:31133066-31133088 CCTCCCCAGGAGCTGGGCTGAGG + Intergenic
1066422952 10:35278806-35278828 CCCTGCCAGGAGCCAGGGGCTGG + Intronic
1067576029 10:47409221-47409243 GCCCTCCAGTAGCTGGGCTCTGG + Intergenic
1069849438 10:71395900-71395922 ACCTGCCTGGAGCCAGGCTCTGG - Intergenic
1070592465 10:77810768-77810790 CCCGGCCAGGCCCTGGGCTCTGG - Intronic
1072951009 10:99846766-99846788 ACCAGCCAGGGGCTAGGCACAGG - Intronic
1073285155 10:102383025-102383047 CCCCGCCAGATGCTAGGCCGGGG + Intergenic
1073930150 10:108566454-108566476 CCCCAGGAGGAGCTAGGCTGGGG + Intergenic
1076378103 10:130005310-130005332 CCCTGCCAGCAGCCAGGCTTAGG + Intergenic
1076555824 10:131320894-131320916 CCCAGCCTGGGGCTCGGCTCTGG - Intergenic
1079589356 11:22163678-22163700 CTGCTGCAGGAGCTAGGCTCTGG - Intergenic
1085393708 11:76195478-76195500 CGCCACCAGGAGCTAGGGACGGG + Intronic
1085711312 11:78831345-78831367 CCCGGCCAGGAGCTGGGAGCTGG - Intronic
1086157249 11:83681326-83681348 TCCCGCCTGGAGCTAGGACCTGG + Intronic
1086916688 11:92537825-92537847 CCCAGTCAGGAGAGAGGCTCAGG + Intronic
1090393620 11:126405448-126405470 CCCAGCCATGGGCTAAGCTCAGG - Intronic
1090394693 11:126411088-126411110 CACTGCCAGGAGCTGGGTTCAGG - Intronic
1092242398 12:6843308-6843330 CCCAGCTGGGAGCTTGGCTCCGG + Intronic
1093619963 12:21277251-21277273 GCCAGCCAGGAGCTAGGGCCTGG - Intronic
1096111537 12:49031866-49031888 CCCCTCCAGGAGCTAGGGGCAGG - Exonic
1099610126 12:84857516-84857538 CACCCCCAGGAGCTAGGGTCTGG + Intergenic
1101800712 12:108019670-108019692 CTCCTCTAGGAGCTAGGCTTTGG + Intergenic
1101970730 12:109310104-109310126 CCCCGCCTGGAGCCAGCCGCGGG + Intergenic
1105426161 13:20296738-20296760 CACCACCAGGAGCTAGGGACAGG - Intergenic
1105704985 13:22963044-22963066 CCCAACCAGGAGCTGGGCACAGG + Intergenic
1113741850 13:112716599-112716621 CCCAGCCCCGAGCCAGGCTCTGG - Intronic
1114631330 14:24161279-24161301 CCCAGCCAGGAGTTAAGCTGAGG + Exonic
1117954388 14:61111388-61111410 CCGCGGCAGGAGCGAGGCCCCGG - Intergenic
1119124967 14:72117127-72117149 CCCCTCCAGGACCTGGGCACTGG - Intronic
1121827263 14:97020624-97020646 CCCCACCATGTGCCAGGCTCTGG - Intergenic
1122309938 14:100788074-100788096 CGCCTGCACGAGCTAGGCTCTGG + Intergenic
1123003837 14:105311972-105311994 TCCTGCCAGGAGCTGGGCTGAGG - Exonic
1123019031 14:105388996-105389018 CCCCGCCGGCAGCTAGGGTGAGG - Intronic
1123461785 15:20479263-20479285 CCCAGCCAGGAACACGGCTCAGG + Intergenic
1123656271 15:22521117-22521139 CCCAGCCAGGAACACGGCTCAGG - Intergenic
1124310182 15:28616295-28616317 CCCAGCCAGGAACACGGCTCAGG - Intergenic
1126787247 15:52187169-52187191 CCCCACCATGGGCCAGGCTCTGG - Intronic
1127842822 15:62845620-62845642 CTCCTCCAGGAATTAGGCTCGGG - Intergenic
1128349907 15:66881736-66881758 TCCAGCCAGGGGCAAGGCTCAGG - Intergenic
1128814714 15:70599218-70599240 CCCAGCCACCCGCTAGGCTCAGG + Intergenic
1135775903 16:25257563-25257585 CCCCGCCCGGCGCCAGGTTCCGG + Exonic
1137397483 16:48126373-48126395 CCAAGCCAGGAGCTGGGCTTCGG + Intronic
1138658095 16:58502094-58502116 CCCTGCCAGGTGCCAGTCTCAGG - Intronic
1140027222 16:71301682-71301704 CACCCCCAGTAGCCAGGCTCAGG + Intergenic
1140412483 16:74749272-74749294 ACCGGCCAGGAGCTGAGCTCTGG + Intronic
1141110914 16:81270054-81270076 CCCCGCCAGGAGCTAGGCTCAGG - Intronic
1141668687 16:85480184-85480206 CCCAGCCAGGAGTAAGACTCAGG + Intergenic
1142535720 17:616565-616587 CCAGGCCAGGAGCTTGGCCCTGG + Intronic
1143059201 17:4185847-4185869 CCCCGCCCGGACCTAAGCCCCGG + Intronic
1144590643 17:16520910-16520932 CCCAGCCAGGAGACAGGCTCTGG - Intergenic
1144672988 17:17143442-17143464 CCTCGCCAGGAGCAAGGCCCTGG + Intronic
1145273174 17:21415293-21415315 CCCTGCCTGGAGCTAGCCTGGGG + Exonic
1145311367 17:21702737-21702759 CCCTGCCTGGAGCTAGCCTGGGG + Exonic
1146182317 17:30706215-30706237 CCGCGCCAGCAACTGGGCTCCGG - Intergenic
1146463464 17:33066434-33066456 CCCAGCCTGGTGCTAGGCTTAGG + Intronic
1148202450 17:45758274-45758296 CCCAGCCAGGAGCAGGGCTCTGG + Intergenic
1150479542 17:65498857-65498879 CCTCGCCTGGAGAGAGGCTCTGG - Intergenic
1152242143 17:79166284-79166306 CCTTGGCAGGAGCTATGCTCAGG + Intronic
1152363420 17:79842597-79842619 CCCCACCAGGAGCGAGCCTGTGG - Intergenic
1154049033 18:10935806-10935828 CCTCGCCAGCAGCAACGCTCCGG + Intronic
1157623115 18:49027296-49027318 CCCCTTCAGGAGCTGGGCTGGGG + Intergenic
1160770157 19:827573-827595 GCCCGCCATGTGCTGGGCTCCGG + Intronic
1160970858 19:1767207-1767229 CCCTGAGAGGAGCTGGGCTCTGG - Intronic
1161031398 19:2059453-2059475 CCCTGCAAGGACCTAGGCTTGGG - Intergenic
1161088422 19:2345487-2345509 CCACTCCGGGAGCTGGGCTCGGG + Intronic
1161723898 19:5917713-5917735 CCCCGCCAGGAGATCAGCACTGG + Intronic
1162908412 19:13836693-13836715 CCCCTCCAGGTGCCAGCCTCTGG - Intergenic
1163406395 19:17125823-17125845 ACCCGGCAGCAGCTAGGCTAGGG + Intronic
1165012632 19:32859811-32859833 CCCCGCCAGCAGCGATGCCCGGG + Intronic
1165117664 19:33538680-33538702 CACACCCAGGAGTTAGGCTCAGG - Intergenic
1165420047 19:35718049-35718071 CCCCGCGCGGAGCCAGGCCCGGG - Exonic
1165958320 19:39515589-39515611 CCCTGCCAGGAGCTGGGCTGGGG - Exonic
1167247746 19:48383898-48383920 CCCAGCCAGGTGCTAGGCTCTGG - Intronic
1167722264 19:51186700-51186722 CCCCGCCAGGAAATGGGCGCGGG + Intergenic
925978147 2:9155463-9155485 CCACGCCAGGTGCTGGGCTAGGG - Intergenic
926226702 2:10971918-10971940 CCCTGCCTGGGGCCAGGCTCTGG + Intergenic
930255577 2:49086583-49086605 CACCTCCAGGAGAGAGGCTCAGG - Intronic
930373218 2:50531253-50531275 CTCCGCCTGGAGCTAGACGCAGG - Exonic
934180120 2:89612180-89612202 CCCGGCCCGGGGCTAGGGTCTGG - Intergenic
934290411 2:91686440-91686462 CCCGGCCCGGGGCTAGGGTCTGG - Intergenic
934554476 2:95280060-95280082 CCACACCGGGAGCTATGCTCAGG - Intronic
935728800 2:106047532-106047554 CCCTGACATGAGCTAGGCTTCGG - Intergenic
938075117 2:128327790-128327812 TCCTTCCAGGAGCTAGGCTCAGG + Intergenic
938337397 2:130511790-130511812 CACCGCCCTGACCTAGGCTCCGG + Intergenic
938352441 2:130608945-130608967 CACCGCCCTGACCTAGGCTCCGG - Intergenic
942148476 2:173050552-173050574 CCCGGTCAGGAGCCAGGGTCTGG + Intronic
947546679 2:231015375-231015397 GCCCGCCAGGACCTAGTCTTTGG + Intronic
947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG + Intergenic
947636665 2:231683773-231683795 CCCCGCAAGGAGCTGGGAGCAGG + Intergenic
947715879 2:232338594-232338616 CCCAGCCAGGACCTGGGCTCAGG + Intronic
947734903 2:232449340-232449362 CCCAGCCAGGACCTGGGCTCAGG + Intergenic
948047542 2:234955239-234955261 CCTGGCCAGGAGCGAGCCTCAGG + Intronic
948714831 2:239854281-239854303 TCCACCCAGGAGCGAGGCTCAGG - Intergenic
948738502 2:240026287-240026309 TCCCGTCAGGACCTGGGCTCTGG + Intergenic
949069475 2:242015558-242015580 CACCGCCAGGGTCTAGGCTGAGG + Intergenic
1172880428 20:38196171-38196193 ACCCACTATGAGCTAGGCTCAGG + Intergenic
1173002241 20:39112545-39112567 AGCCACCAGGAGCTGGGCTCTGG + Intergenic
1175448384 20:59042416-59042438 CCCCACCATGAGGTAGCCTCGGG - Intronic
1175562350 20:59940684-59940706 CCTTGCCAGGAGCTGGTCTCAGG + Intronic
1178561920 21:33645827-33645849 CCACTTCAGGAGCTAGTCTCAGG - Intronic
1180046255 21:45307126-45307148 CCCAGGCAGGGGCTGGGCTCGGG + Intergenic
1180078345 21:45474712-45474734 CGCCCCCAGGAGCGAGGCTGTGG - Intronic
1180078359 21:45474762-45474784 CGCCCCCAGGAGCGAGGCTGTGG - Intronic
1180190856 21:46161828-46161850 CCCGGCCAGGAGCCAAGATCTGG + Intronic
1180233379 21:46441768-46441790 CCTCGACAGGAGGTAGGATCTGG - Intronic
1181236020 22:21448142-21448164 CCCAGCCTGGAGCCAGGCACTGG + Exonic
1183098809 22:35570824-35570846 CCCAGCCAGCAGCCAGGGTCAGG + Intergenic
1184412054 22:44331384-44331406 CTCCGCCAGGAGCTCCGCCCCGG + Intergenic
1184718774 22:46297022-46297044 CCCCGCCAGGAGCCGGGCCTGGG + Intronic
1184765521 22:46570150-46570172 CCCCGCCAGGCCCTAGGCTAGGG - Intergenic
950541123 3:13613923-13613945 CCCAGCCTGGAGCTAGGCTCAGG - Intronic
952762075 3:36923744-36923766 CTCCGGCAGGAGCTACACTCTGG + Intronic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
954608918 3:51934032-51934054 CACCACCAGGAGCCAGCCTCAGG - Intronic
957543503 3:81606956-81606978 CCAGGCCAGCTGCTAGGCTCTGG - Intronic
958265441 3:91432679-91432701 TCCAGCCAAGAGCCAGGCTCAGG - Intergenic
961376171 3:126467503-126467525 CTCCTCCAGGCGCTGGGCTCTGG - Intronic
962850737 3:139306683-139306705 CCCTGCCAGTACCTAGGCCCTGG - Intronic
963798738 3:149657173-149657195 TTCCGCCACGAGCTAGGCTTCGG + Exonic
965866964 3:173216431-173216453 GCCCGCCAGGAGCCAGGGCCTGG + Intergenic
967898827 3:194425892-194425914 ACCAGCGAGGAGGTAGGCTCAGG - Intronic
968107237 3:196009661-196009683 CACCGCCAGGGTCTAGGCTGAGG - Intergenic
968506860 4:974727-974749 ACCCTCCAGGAGCTGCGCTCTGG + Intronic
968560640 4:1279502-1279524 CCCCGCCAGGGTCGCGGCTCAGG + Intergenic
969096678 4:4737877-4737899 CCCCCCCAGGAGCTGAGCTCAGG - Intergenic
970407690 4:15778942-15778964 CCCGGCGAGGGGCTGGGCTCAGG - Intronic
981076594 4:140598534-140598556 CTCCGCCATGAGCAAGGCGCAGG + Intergenic
985575068 5:670135-670157 GGCCTCCAGGAGCTGGGCTCAGG + Intronic
985579709 5:690213-690235 CTCAGCCAGGAGCCAGGATCAGG - Intronic
985594555 5:782272-782294 CTCAGCCAGGAGCCAGGATCAGG - Intergenic
988066624 5:26233306-26233328 CACCGCCAGGGTCTAGGCTGAGG - Intergenic
997613993 5:135233741-135233763 TCCCTCCAGGTGCGAGGCTCGGG + Intronic
1001641393 5:173246402-173246424 CCCCACCAGCCGCTAGGCCCTGG + Intergenic
1002101467 5:176860127-176860149 CCCCGCCAAGAGGCAGGCACAGG + Intronic
1002141597 5:177144282-177144304 CCCAGCCAGGAGCCAAGATCAGG - Intronic
1002989916 6:2228939-2228961 TGCCTCCAGGAGCTAGCCTCTGG - Intronic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1005914670 6:30341972-30341994 ACCCGCCAGTAGCCAGTCTCAGG - Exonic
1007419869 6:41712958-41712980 CCCAGCCAGTGGCTAGACTCAGG - Intronic
1008989927 6:57589977-57589999 TCCAGCCAAGAGCCAGGCTCAGG + Intronic
1009178509 6:60488517-60488539 TCCAGCCAAGAGCCAGGCTCAGG + Intergenic
1019319582 7:409501-409523 CCCCGCCAGGACCTTGGCTGGGG + Intergenic
1019459907 7:1152277-1152299 GCCCGCCAGGAGCCAGGGTGAGG + Intronic
1019574275 7:1728799-1728821 CCCCGACAGGAGCTGGGACCCGG - Intronic
1025230656 7:57201547-57201569 CCACCCCAGGAGATAGGCTGTGG + Intergenic
1026973265 7:74480609-74480631 GCCTGCCAGGAGCCAGGCTCAGG + Intronic
1034201578 7:149285931-149285953 CACAGCCAGGAGCCAGACTCTGG - Intronic
1034848434 7:154470485-154470507 CCCCTCCAGCAGCTATGCTCGGG + Intronic
1034872790 7:154698783-154698805 TCCAGCCAGGAGCTAGTCTCAGG + Intronic
1039563242 8:38529687-38529709 GCCAGCCAAGAGCTAGGCACAGG - Intergenic
1041449829 8:57994750-57994772 CCGAGCCGGGAGCCAGGCTCCGG - Exonic
1048943467 8:139423316-139423338 CACCTCCAGGAGCTTGGCTGTGG + Intergenic
1049159653 8:141089125-141089147 ACCAGCCAGGAGCCAGGCTGGGG + Intergenic
1049462294 8:142735779-142735801 CCGAGCCAGGATCTAGGCTCGGG - Exonic
1049710413 8:144060647-144060669 CCCCACCTGGCGCTCGGCTCCGG + Exonic
1052122074 9:24730520-24730542 CCCCAGCAGGAGCAAGCCTCCGG + Intergenic
1057081501 9:92177418-92177440 CCCCACCAGGACCCAGGCACTGG + Intergenic
1058905345 9:109478078-109478100 ACCTGCCAGGAGAGAGGCTCAGG + Intronic
1060529837 9:124341683-124341705 CCCACCCAGGAGCTGGGCTGTGG - Intronic
1060659734 9:125397789-125397811 CCCGGCCAGGAGCGCAGCTCTGG + Intergenic
1061431869 9:130536369-130536391 CCTCCCCAGGAGCCAGGCTCTGG - Intergenic
1061587543 9:131578629-131578651 CTCCCCCAGGAGCTCAGCTCTGG + Exonic
1062591497 9:137276712-137276734 CCCCTCCAGGAGCCAGGCCTAGG - Intergenic
1062723757 9:138059372-138059394 CCCTCCCAGGACCTAGGCTGGGG - Intronic
1190058159 X:47194089-47194111 CCCCGACAGCAGCGTGGCTCAGG - Intronic
1195654892 X:107324420-107324442 ACCCGGCAGGAGCTAGGAGCAGG + Intergenic
1200361515 X:155612242-155612264 CCCCCTCTGGAGCAAGGCTCTGG - Intronic