ID: 1141112352

View in Genome Browser
Species Human (GRCh38)
Location 16:81280634-81280656
Sequence TACCAGGTATGTGACCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141112346_1141112352 28 Left 1141112346 16:81280583-81280605 CCCTGTGAGGGATAAGGCAGGCT 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1141112352 16:81280634-81280656 TACCAGGTATGTGACCTTGGAGG No data
1141112347_1141112352 27 Left 1141112347 16:81280584-81280606 CCTGTGAGGGATAAGGCAGGCTC 0: 1
1: 0
2: 1
3: 13
4: 125
Right 1141112352 16:81280634-81280656 TACCAGGTATGTGACCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141112352 Original CRISPR TACCAGGTATGTGACCTTGG AGG Intronic
No off target data available for this crispr