ID: 1141112388

View in Genome Browser
Species Human (GRCh38)
Location 16:81281018-81281040
Sequence TATTATGTAAAGAGGCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 158}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141112388_1141112398 16 Left 1141112388 16:81281018-81281040 CCCAGAGGCCTCTTTACATAATA 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1141112398 16:81281057-81281079 GGACAAGGGCCAAAAAGGAAAGG 0: 1
1: 0
2: 1
3: 29
4: 287
1141112388_1141112400 23 Left 1141112388 16:81281018-81281040 CCCAGAGGCCTCTTTACATAATA 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1141112400 16:81281064-81281086 GGCCAAAAAGGAAAGGGTCTTGG 0: 1
1: 0
2: 1
3: 25
4: 293
1141112388_1141112393 2 Left 1141112388 16:81281018-81281040 CCCAGAGGCCTCTTTACATAATA 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1141112393 16:81281043-81281065 TCCCTCCTGTGCATGGACAAGGG 0: 1
1: 0
2: 3
3: 8
4: 204
1141112388_1141112399 17 Left 1141112388 16:81281018-81281040 CCCAGAGGCCTCTTTACATAATA 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1141112399 16:81281058-81281080 GACAAGGGCCAAAAAGGAAAGGG 0: 1
1: 0
2: 3
3: 32
4: 370
1141112388_1141112392 1 Left 1141112388 16:81281018-81281040 CCCAGAGGCCTCTTTACATAATA 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1141112392 16:81281042-81281064 TTCCCTCCTGTGCATGGACAAGG 0: 1
1: 0
2: 1
3: 14
4: 284
1141112388_1141112397 11 Left 1141112388 16:81281018-81281040 CCCAGAGGCCTCTTTACATAATA 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1141112397 16:81281052-81281074 TGCATGGACAAGGGCCAAAAAGG 0: 1
1: 0
2: 0
3: 13
4: 139
1141112388_1141112401 24 Left 1141112388 16:81281018-81281040 CCCAGAGGCCTCTTTACATAATA 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1141112401 16:81281065-81281087 GCCAAAAAGGAAAGGGTCTTGGG 0: 1
1: 1
2: 2
3: 11
4: 271
1141112388_1141112391 -5 Left 1141112388 16:81281018-81281040 CCCAGAGGCCTCTTTACATAATA 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1141112391 16:81281036-81281058 TAATAATTCCCTCCTGTGCATGG 0: 1
1: 0
2: 0
3: 22
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141112388 Original CRISPR TATTATGTAAAGAGGCCTCT GGG (reversed) Intronic
900125449 1:1067106-1067128 TATTATGCAAAGAGCCCTGGTGG - Intergenic
901569282 1:10146521-10146543 AATTCTGTCAACAGGCCTCTAGG + Intronic
905531436 1:38682157-38682179 TATTCTGTACAGAGGCATTTTGG + Intergenic
911622676 1:100083950-100083972 TATTCTGGAAAGAAGCCTCTTGG - Exonic
914247544 1:145897211-145897233 TAGGATGAAAAGAGGGCTCTAGG - Intronic
917274231 1:173314068-173314090 TATTATGTAAAGATGACAGTAGG - Intergenic
918696484 1:187551759-187551781 TATTAAGAGATGAGGCCTCTGGG - Intergenic
919500019 1:198326678-198326700 TATTATGGAAAGAAGCATCATGG - Intergenic
922989304 1:229892800-229892822 TTGTGTGTAAAGATGCCTCTGGG - Intergenic
923183791 1:231549954-231549976 TGTCATGGAAAGAGGCCTCAGGG - Intronic
924012038 1:239675942-239675964 TAATATCTAAAGGAGCCTCTGGG - Intronic
924715856 1:246573486-246573508 TATTATATCAGGTGGCCTCTTGG + Intronic
924899437 1:248380632-248380654 TATTATGTATGGAAGCCTATAGG - Intergenic
1063211637 10:3886249-3886271 TATTTTGTAAAGGGGGCTGTGGG + Intergenic
1063513326 10:6668809-6668831 TTTTATTTAAAGGGGCCTGTGGG - Intergenic
1063846708 10:10136543-10136565 TTTTATAAAAAGTGGCCTCTCGG - Intergenic
1065955815 10:30692749-30692771 TGGTACGTAAAGAGGCCTTTTGG + Intergenic
1071176727 10:82934953-82934975 GTTTATATAAATAGGCCTCTAGG - Intronic
1076295520 10:129380865-129380887 TATTATGAGATGGGGCCTCTGGG + Intergenic
1077394831 11:2315713-2315735 TTTTCTGAAAAGATGCCTCTGGG + Intronic
1079901773 11:26195740-26195762 TATTATGTAATGATGACCCTTGG - Intergenic
1080698999 11:34628390-34628412 TATTTTGAGAAGAGGCCTGTAGG + Intronic
1080711039 11:34748437-34748459 TACTCTGTGGAGAGGCCTCTTGG - Intergenic
1081416132 11:42818330-42818352 GATTATGTAAAAAGTCCTGTGGG - Intergenic
1086281072 11:85189709-85189731 TATAAAGTAAAGATGCCTTTTGG - Intronic
1087392632 11:97557352-97557374 TATTATGTAAAGAAGTATATGGG - Intergenic
1088740540 11:112763406-112763428 TGATAGGGAAAGAGGCCTCTTGG - Intergenic
1092890844 12:12967925-12967947 TATTAGGAGAAGAGGCTTCTCGG - Intergenic
1094250879 12:28359652-28359674 TATTTTGTAAAGCAGTCTCTGGG + Intronic
1095799645 12:46258475-46258497 TATTATGTAAAATTGCCTTTAGG - Intronic
1098054840 12:66493964-66493986 GAATCTGTAAAGATGCCTCTGGG + Intronic
1098767670 12:74510126-74510148 TATAATGAAAAGAGTCCTGTAGG + Intergenic
1099627846 12:85098164-85098186 TATTATTTAAACTGGCATCTGGG - Intronic
1105361007 13:19716131-19716153 TATTATGTAATGAGATATCTTGG - Intronic
1106003345 13:25745510-25745532 TATTATCTCATGAGGACTCTTGG + Intronic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1106803393 13:33280230-33280252 TACTATGTCAAAAGGCATCTTGG - Intronic
1108560262 13:51636343-51636365 TATTATCAAAACAGGCCTATAGG + Intronic
1109964773 13:69677990-69678012 TATTAGGAAAAAAGTCCTCTAGG + Intergenic
1113855178 13:113440277-113440299 TATTAGGTACAGAGACATCTAGG + Intronic
1115706004 14:35998785-35998807 TGTTATGGAAAGAGGTCGCTGGG - Intergenic
1116089531 14:40287238-40287260 CATTATAAAAAGAGGTCTCTAGG - Intergenic
1116400227 14:44497401-44497423 TATTGTGTGAGGAGGCCTCTGGG - Intergenic
1118023985 14:61750426-61750448 TTTTCTGTACAGAGGCTTCTAGG - Intergenic
1120502691 14:85316573-85316595 TATTATGTTATGTTGCCTCTAGG + Intergenic
1120807402 14:88767419-88767441 TATAATGAAAAGGGACCTCTGGG - Intronic
1121879008 14:97482694-97482716 TTTTATTTAAAGAGGGCTGTGGG - Intergenic
1126392262 15:48171184-48171206 TATTATGTAAACAGGCCCTTTGG - Intronic
1126958353 15:53960615-53960637 TACTATTTAATGAGTCCTCTGGG - Intergenic
1129496521 15:75987462-75987484 TATTATGAAGAGGGGCCTTTTGG + Intronic
1130687464 15:86051414-86051436 TATTAGGTAGTGAGGCCTTTTGG - Intergenic
1131715580 15:95107195-95107217 TACTATTTAAAGAACCCTCTAGG - Intergenic
1133344318 16:5059963-5059985 GAGTCTGAAAAGAGGCCTCTAGG + Intronic
1134606944 16:15578811-15578833 TATTAAGAAATGAGGCCTTTGGG - Intronic
1134809562 16:17155752-17155774 TATTCTGTCAAGAGGCCTTTGGG + Intronic
1138902475 16:61290071-61290093 TATTATGTAAAGAGGCACCTCGG - Intergenic
1139824516 16:69746417-69746439 TGTTCTGTAGGGAGGCCTCTGGG - Intronic
1140622484 16:76752038-76752060 TATTCTGTAAGGTGGCCTATGGG - Intergenic
1141112388 16:81281018-81281040 TATTATGTAAAGAGGCCTCTGGG - Intronic
1144908629 17:18659554-18659576 TATTATGAAATGGGGCCTTTTGG + Exonic
1145392014 17:22462303-22462325 TATGATGTAAAGATCCATCTGGG - Intergenic
1146396366 17:32470867-32470889 TGTTAAGTATAGAGGCCTCAAGG - Intronic
1148726488 17:49794884-49794906 TATTGTGAAAGGAGGCCCCTTGG + Intronic
1151247360 17:72805158-72805180 TACTATTTAAAGAGGCATGTGGG + Intronic
1151834477 17:76573992-76574014 TATAATGTAGAGGGGGCTCTGGG + Intronic
1153295267 18:3540102-3540124 TTTTATGTAATGAGACATCTTGG - Intronic
1155369658 18:25084181-25084203 TAATATGTGATGAGGCCTTTAGG - Intronic
1155863252 18:30931563-30931585 TATTATGTAAAGTTACCTTTAGG - Intergenic
1156865850 18:41887948-41887970 TGATATGTAGAGAGGACTCTGGG - Intergenic
1159808399 18:72984193-72984215 TATTATGTAAACTTTCCTCTTGG + Intergenic
1168497521 19:56866243-56866265 AAATATGTATTGAGGCCTCTCGG + Intergenic
925267839 2:2579601-2579623 TATTATGTAAAATGTCATCTCGG + Intergenic
928740517 2:34346817-34346839 TATTAAGTACAGATGACTCTTGG - Intergenic
929769819 2:44882343-44882365 AGTTGTTTAAAGAGGCCTCTTGG + Intergenic
930851721 2:55968325-55968347 TATTTTGAAATGAGGCCTTTAGG + Intergenic
934587865 2:95519951-95519973 CAGTATGTACAAAGGCCTCTGGG + Intergenic
935204367 2:100884885-100884907 TAATATATAAAGAGACATCTTGG + Intronic
937591105 2:123614366-123614388 TATTATGAAAAGAGGCATTGAGG + Intergenic
937691267 2:124757995-124758017 TATTATGTAAACATGTTTCTTGG + Intronic
938945395 2:136207796-136207818 GATTATGTAACAGGGCCTCTGGG - Intergenic
946068514 2:217010892-217010914 TAATGTGTAAAAAGGCCTATAGG + Intergenic
1170306503 20:14944576-14944598 TATTAAGAAAAGAGGACTCTGGG - Intronic
1176735801 21:10545307-10545329 TATTATGTAAAGGTGCTCCTGGG - Intronic
1177713134 21:24805857-24805879 TCTTTTTTAAAAAGGCCTCTAGG - Intergenic
1181888969 22:26044839-26044861 TATAAGGAGAAGAGGCCTCTAGG + Intergenic
1184514109 22:44950694-44950716 TATTATGCAAAGAGGGCTTGGGG + Intronic
1184952807 22:47856560-47856582 CATTATGTAAATAGTGCTCTTGG - Intergenic
951293301 3:20900611-20900633 TTTTATATAAAAAGGACTCTAGG - Intergenic
952749067 3:36809797-36809819 TATTAGGAAACGAGGCCTTTGGG - Intergenic
954871231 3:53769034-53769056 TTTAATGTAAAGATGCCTCCTGG + Intronic
955011783 3:55024438-55024460 TATTAAGAAGAGAGGCCTTTAGG + Intronic
956000169 3:64721439-64721461 TATTATGTACAAAGGACTATAGG - Intergenic
956146068 3:66191953-66191975 TATTAGGAAATGGGGCCTCTAGG + Intronic
959200628 3:103242109-103242131 AATTATGTAAAAAGTACTCTGGG + Intergenic
961279318 3:125753420-125753442 TAGTCTGAAAAGTGGCCTCTTGG + Intergenic
962107305 3:132404491-132404513 TCTTCTGGAAACAGGCCTCTTGG - Intergenic
964968474 3:162528648-162528670 TCTTAAGTCAAGAGGCATCTGGG + Intergenic
965193917 3:165569215-165569237 TTTTTTTTAAAGAGGTCTCTAGG + Intergenic
967011444 3:185438609-185438631 TATTATGAAAAGAATCATCTAGG - Intronic
969999494 4:11350343-11350365 TATTAAGGAAAACGGCCTCTGGG + Intergenic
970615180 4:17762091-17762113 TCTTATGGAAAGAGGTCTCTTGG - Intronic
974391254 4:61272466-61272488 TTTTATGTAATGAGGACTATAGG + Intronic
975420642 4:74159866-74159888 TATTTTTTAAAGAGGGCACTAGG + Intronic
977565266 4:98574440-98574462 CATAAGGTAAAGAGGTCTCTAGG - Intronic
978452268 4:108847317-108847339 TATTATGGTAAGGGGCTTCTAGG + Intronic
978595425 4:110372686-110372708 GATTATGTAATGAGCCCTCATGG - Intronic
980153477 4:129077839-129077861 TATGAGGTAAAGAACCCTCTAGG + Intronic
980196829 4:129600269-129600291 TATTAAGTGGTGAGGCCTCTGGG + Intergenic
982488725 4:156001458-156001480 TATAATATAAAGAGGCATCATGG + Intergenic
982537777 4:156628076-156628098 AATTATTTAAAAAGTCCTCTTGG - Intergenic
983175087 4:164579021-164579043 TATTATATAAGGATGACTCTTGG + Intergenic
984360215 4:178720287-178720309 TATTTGGTAAAGAGGAATCTAGG - Intergenic
984730752 4:183065966-183065988 TGTTCTGTAAACTGGCCTCTGGG - Intergenic
986534280 5:8770496-8770518 AATTATGTAAGGAGGCTGCTCGG - Intergenic
988429294 5:31100740-31100762 TATTATGGAAAGTGTCCTGTGGG - Intergenic
990397564 5:55398959-55398981 TATTATGTGAAGGGTCCTGTTGG - Intronic
990635333 5:57719508-57719530 TATTATGTAAAGAGGAAACATGG + Intergenic
991178607 5:63721496-63721518 TATCAAGTAATGAGGCCTCTTGG - Intergenic
992931931 5:81656474-81656496 TAATATATAAAGAGGTTTCTGGG + Intronic
996970788 5:129365438-129365460 TACTATCTAAAGTGGCCTATAGG + Intergenic
997402681 5:133614209-133614231 GATTATGTAATAAGGCCACTAGG - Intergenic
999838153 5:155396844-155396866 TATTATGTAGAAAGTCCTGTTGG - Intergenic
1000925258 5:167186183-167186205 GTTTATGTGAAGAGGACTCTTGG + Intergenic
1001589548 5:172855933-172855955 TGTGAATTAAAGAGGCCTCTTGG - Intronic
1003380753 6:5622485-5622507 TATTAAGAAACGAGGCCTTTGGG + Intronic
1004212384 6:13662510-13662532 TATTATGAGATGGGGCCTCTGGG + Intronic
1004803415 6:19176095-19176117 TATTCTTTACAGAAGCCTCTAGG + Intergenic
1005807226 6:29486358-29486380 TCTTATGTGATGATGCCTCTTGG + Intergenic
1007863034 6:44934572-44934594 TATTAGGATAAGAAGCCTCTGGG + Intronic
1009563162 6:65274941-65274963 TAAAATCTAAAGAGGCCACTAGG - Intronic
1010635506 6:78254757-78254779 TATAATGAAAAGAAGACTCTGGG + Intergenic
1011812577 6:91150147-91150169 TATTTTATAATTAGGCCTCTGGG + Intergenic
1013499946 6:110739197-110739219 TATTAGGACATGAGGCCTCTGGG + Intronic
1015837166 6:137432838-137432860 TATTAGGTAAACTGGCCTCAGGG - Intergenic
1022888408 7:34670649-34670671 TAATATGTAAAGAGCCCTTGAGG + Intronic
1023280865 7:38568204-38568226 TAATATGTAAAGAATCCTTTAGG + Intronic
1023451752 7:40293723-40293745 TCTTATGTAGAGAGGCTTCTTGG + Intronic
1024570130 7:50716334-50716356 TATTCTGGAAAGAAGCTTCTTGG - Intronic
1027473917 7:78606357-78606379 TCATATGCAAAGAGGCCTCTGGG - Intronic
1031008104 7:116497477-116497499 TGTTGTCTAAAGAGTCCTCTTGG + Intronic
1031393237 7:121241664-121241686 TAATATGTGAACAGGCCTTTAGG - Intronic
1033872616 7:145774648-145774670 TATTAAGAAAAGAGGCCTTTGGG + Intergenic
1035204303 7:157284926-157284948 TATTGATTAAAGAGGTCTCTGGG - Intergenic
1037044214 8:14276952-14276974 AATTATGTAACGGGGCCTTTTGG + Intronic
1037646653 8:20798594-20798616 TATTAGGAAATGAGGCCTATGGG + Intergenic
1037967141 8:23144009-23144031 AAGTATGTAAGGAGGCTTCTGGG - Intronic
1038801415 8:30752644-30752666 TATTATTTTAAAAGGCTTCTAGG - Intronic
1043400585 8:79880452-79880474 GATTATGTAAAAAGGCTTGTTGG - Intergenic
1045837289 8:106537171-106537193 TATTAAGTAATGAGGCCTTTGGG - Intronic
1048965249 8:139610092-139610114 GATTTTGAAATGAGGCCTCTGGG - Intronic
1050190920 9:3025104-3025126 TATTATGCAAAGTTTCCTCTTGG - Intergenic
1052339523 9:27351583-27351605 TCATCTGTACAGAGGCCTCTGGG - Intronic
1058116280 9:101087693-101087715 TTTTATGTAAATAAGTCTCTAGG + Intronic
1059814377 9:117895083-117895105 CATTATGTGAACAGCCCTCTAGG + Intergenic
1060611787 9:124973134-124973156 TATTATGTAAAGTTACCTTTAGG - Intronic
1060884649 9:127142153-127142175 TATGATGTGACGAGGCATCTAGG - Intronic
1203655307 Un_KI270752v1:18290-18312 TATTATGTAAAGGAGTCTGTGGG + Intergenic
1186516039 X:10166741-10166763 TATTATGGGAAGAAGTCTCTGGG + Intronic
1187326011 X:18289299-18289321 TATGATGCAAAGAAGCATCTTGG - Intronic
1187630359 X:21162656-21162678 TAATGTGTATGGAGGCCTCTTGG + Intergenic
1188556836 X:31421608-31421630 TATGATGTAAACAGGCATTTTGG + Intronic
1189942338 X:46137712-46137734 GATGAGTTAAAGAGGCCTCTGGG + Intergenic
1191980414 X:66918489-66918511 TATTCTGGAAAGAAGACTCTGGG + Intergenic
1194509678 X:94778261-94778283 TTTTATATAATGAGGCCTTTTGG - Intergenic
1194559954 X:95407940-95407962 TATTAGGTAAAGAATCCTGTAGG - Intergenic
1195059385 X:101178739-101178761 TCTTATGTAAAGTGGCTTATAGG - Intergenic
1197339673 X:125251142-125251164 TATTATTTCAAGTGGGCTCTAGG - Intergenic
1198531660 X:137554260-137554282 TATTATAAAAAGAGTCCGCTGGG - Intergenic
1200021725 X:153217357-153217379 GATTATGTAAATAGTGCTCTTGG + Intergenic
1200370112 X:155715987-155716009 TATTATGGAAAGAGGCATTGAGG - Intergenic
1201056152 Y:9994234-9994256 TATTTTGGAAGGAGGACTCTCGG + Intergenic