ID: 1141115681

View in Genome Browser
Species Human (GRCh38)
Location 16:81307036-81307058
Sequence ACTTGAAAGCAGAAGCCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141115681_1141115684 9 Left 1141115681 16:81307036-81307058 CCTTCCGGCTTCTGCTTTCAAGT No data
Right 1141115684 16:81307068-81307090 GCCTCAGCCTCCCGAGTTGCTGG 0: 542
1: 98232
2: 265758
3: 289060
4: 316566
1141115681_1141115688 18 Left 1141115681 16:81307036-81307058 CCTTCCGGCTTCTGCTTTCAAGT No data
Right 1141115688 16:81307077-81307099 TCCCGAGTTGCTGGGATTACAGG 0: 270
1: 46582
2: 223063
3: 576901
4: 432749
1141115681_1141115686 10 Left 1141115681 16:81307036-81307058 CCTTCCGGCTTCTGCTTTCAAGT No data
Right 1141115686 16:81307069-81307091 CCTCAGCCTCCCGAGTTGCTGGG 0: 586
1: 103763
2: 294290
3: 335866
4: 347712

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141115681 Original CRISPR ACTTGAAAGCAGAAGCCGGA AGG (reversed) Intergenic
No off target data available for this crispr