ID: 1141115684

View in Genome Browser
Species Human (GRCh38)
Location 16:81307068-81307090
Sequence GCCTCAGCCTCCCGAGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 970158
Summary {0: 542, 1: 98232, 2: 265758, 3: 289060, 4: 316566}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141115682_1141115684 5 Left 1141115682 16:81307040-81307062 CCGGCTTCTGCTTTCAAGTGATT No data
Right 1141115684 16:81307068-81307090 GCCTCAGCCTCCCGAGTTGCTGG 0: 542
1: 98232
2: 265758
3: 289060
4: 316566
1141115680_1141115684 15 Left 1141115680 16:81307030-81307052 CCTCTGCCTTCCGGCTTCTGCTT No data
Right 1141115684 16:81307068-81307090 GCCTCAGCCTCCCGAGTTGCTGG 0: 542
1: 98232
2: 265758
3: 289060
4: 316566
1141115681_1141115684 9 Left 1141115681 16:81307036-81307058 CCTTCCGGCTTCTGCTTTCAAGT No data
Right 1141115684 16:81307068-81307090 GCCTCAGCCTCCCGAGTTGCTGG 0: 542
1: 98232
2: 265758
3: 289060
4: 316566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141115684 Original CRISPR GCCTCAGCCTCCCGAGTTGC TGG Intergenic
Too many off-targets to display for this crispr