ID: 1141115686

View in Genome Browser
Species Human (GRCh38)
Location 16:81307069-81307091
Sequence CCTCAGCCTCCCGAGTTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1082217
Summary {0: 586, 1: 103763, 2: 294290, 3: 335866, 4: 347712}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141115680_1141115686 16 Left 1141115680 16:81307030-81307052 CCTCTGCCTTCCGGCTTCTGCTT No data
Right 1141115686 16:81307069-81307091 CCTCAGCCTCCCGAGTTGCTGGG 0: 586
1: 103763
2: 294290
3: 335866
4: 347712
1141115681_1141115686 10 Left 1141115681 16:81307036-81307058 CCTTCCGGCTTCTGCTTTCAAGT No data
Right 1141115686 16:81307069-81307091 CCTCAGCCTCCCGAGTTGCTGGG 0: 586
1: 103763
2: 294290
3: 335866
4: 347712
1141115682_1141115686 6 Left 1141115682 16:81307040-81307062 CCGGCTTCTGCTTTCAAGTGATT No data
Right 1141115686 16:81307069-81307091 CCTCAGCCTCCCGAGTTGCTGGG 0: 586
1: 103763
2: 294290
3: 335866
4: 347712

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141115686 Original CRISPR CCTCAGCCTCCCGAGTTGCT GGG Intergenic
Too many off-targets to display for this crispr