ID: 1141115688

View in Genome Browser
Species Human (GRCh38)
Location 16:81307077-81307099
Sequence TCCCGAGTTGCTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1279565
Summary {0: 270, 1: 46582, 2: 223063, 3: 576901, 4: 432749}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141115680_1141115688 24 Left 1141115680 16:81307030-81307052 CCTCTGCCTTCCGGCTTCTGCTT No data
Right 1141115688 16:81307077-81307099 TCCCGAGTTGCTGGGATTACAGG 0: 270
1: 46582
2: 223063
3: 576901
4: 432749
1141115681_1141115688 18 Left 1141115681 16:81307036-81307058 CCTTCCGGCTTCTGCTTTCAAGT No data
Right 1141115688 16:81307077-81307099 TCCCGAGTTGCTGGGATTACAGG 0: 270
1: 46582
2: 223063
3: 576901
4: 432749
1141115682_1141115688 14 Left 1141115682 16:81307040-81307062 CCGGCTTCTGCTTTCAAGTGATT No data
Right 1141115688 16:81307077-81307099 TCCCGAGTTGCTGGGATTACAGG 0: 270
1: 46582
2: 223063
3: 576901
4: 432749

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141115688 Original CRISPR TCCCGAGTTGCTGGGATTAC AGG Intergenic
Too many off-targets to display for this crispr