ID: 1141116445

View in Genome Browser
Species Human (GRCh38)
Location 16:81314022-81314044
Sequence GCAGATGTTTAGATTCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141116445_1141116452 24 Left 1141116445 16:81314022-81314044 CCTGTCTGAATCTAAACATCTGC No data
Right 1141116452 16:81314069-81314091 ATTTCCTAGCTCTCCCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141116445 Original CRISPR GCAGATGTTTAGATTCAGAC AGG (reversed) Intergenic
No off target data available for this crispr