ID: 1141120125

View in Genome Browser
Species Human (GRCh38)
Location 16:81347393-81347415
Sequence ATGGACTGGCTTCCTTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141120122_1141120125 -5 Left 1141120122 16:81347375-81347397 CCTTCTACTGTCACCAGAATGGA 0: 1
1: 0
2: 2
3: 11
4: 177
Right 1141120125 16:81347393-81347415 ATGGACTGGCTTCCTTCTGCTGG 0: 1
1: 1
2: 0
3: 25
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141120125 Original CRISPR ATGGACTGGCTTCCTTCTGC TGG Intronic
901481595 1:9529036-9529058 AGGGTCTGGGTCCCTTCTGCAGG + Intergenic
901661619 1:10801652-10801674 ATGTGCTGGGTTCCTTCTCCTGG + Intergenic
902230324 1:15023477-15023499 ATGCACTGGCCTCCTTCCTCGGG - Intronic
902555145 1:17242541-17242563 GTGGTCTGGCCTCCATCTGCCGG + Intronic
905066798 1:35191945-35191967 AGGGACAGGATACCTTCTGCAGG + Intronic
905214592 1:36397823-36397845 CTGGACTGGCTGCCTCCCGCCGG + Exonic
905459443 1:38113072-38113094 AGAACCTGGCTTCCTTCTGCAGG - Intergenic
906150695 1:43585805-43585827 AAGGACCTACTTCCTTCTGCTGG + Intronic
906563324 1:46777614-46777636 TTGGAGTTTCTTCCTTCTGCTGG + Intronic
906935645 1:50211957-50211979 ATGGGCTGTGTTCCTTCTGGAGG - Intergenic
908802786 1:67897530-67897552 ATAGACAGTCTTCCTGCTGCAGG + Intergenic
915197353 1:154199678-154199700 TTGGATAGGCTTCCCTCTGCTGG - Intronic
915272796 1:154767066-154767088 GTGGTCTTGCTTCCTGCTGCTGG + Intronic
915581384 1:156815136-156815158 AGGAACAGGCTTCCTTCTCCAGG + Exonic
920826540 1:209428350-209428372 ATGGACTGGCCTATCTCTGCTGG + Intergenic
920878308 1:209857985-209858007 TTGGACTTTCTTCCTTCTGGTGG + Intergenic
921096190 1:211889198-211889220 ATGGATGGGGTTCCTTCTGAGGG + Intergenic
921910381 1:220542523-220542545 AGGGATTGGGTTGCTTCTGCTGG + Intronic
922595258 1:226808523-226808545 AAGCACTGGCTTCCTGCTTCTGG + Intergenic
923814867 1:237366261-237366283 ATGGACTGGCTTACTTGGGATGG - Intronic
924778576 1:247127839-247127861 AAGGAAGGGCTTCATTCTGCCGG - Intronic
924783078 1:247170582-247170604 AAGGAAGGGCTTCATTCTGCCGG + Intronic
1064624714 10:17250747-17250769 AAGGACAGGCTACCTACTGCAGG - Intergenic
1065285594 10:24184642-24184664 ATGGGCTGGAATCCTGCTGCTGG - Intronic
1066682577 10:37948268-37948290 AGGGACTGGCTTTCTTTTGGTGG + Intergenic
1069659748 10:70115953-70115975 CTGGACTGGCTTCCTTTTCCTGG + Intronic
1070598811 10:77851500-77851522 AGGGACAGTCTTCCTGCTGCCGG + Intronic
1071693212 10:87844386-87844408 AGGGAGTGCCTTCCCTCTGCTGG - Intergenic
1072370670 10:94763911-94763933 CTGGAGTTTCTTCCTTCTGCTGG + Intronic
1076589086 10:131570865-131570887 CTGGCCTGGCTTCCCTCTTCAGG - Intergenic
1077443951 11:2581539-2581561 ATGGCCTGGCTTCACCCTGCAGG + Intronic
1077834320 11:5910930-5910952 AGGAACTGGATTGCTTCTGCAGG - Intronic
1078528524 11:12118988-12119010 GAGAACTGGCTGCCTTCTGCAGG - Intronic
1081268616 11:41057733-41057755 AGGGAATGGCTTCTCTCTGCAGG - Intronic
1083065556 11:59920216-59920238 ATGGACTTTCTTCCTTCCCCCGG + Intergenic
1083385843 11:62309545-62309567 ATGGACTAATTTCATTCTGCTGG + Intergenic
1083806992 11:65080295-65080317 ATGGACTTGCCCCCATCTGCTGG + Intronic
1087575559 11:99985129-99985151 ATGGGATGGCTTCCCTCTGCTGG + Intronic
1087806026 11:102556537-102556559 ATTGACTGCCTTCCTACAGCAGG - Intergenic
1089353457 11:117834614-117834636 ATGGCCTAGCCTCCTTCAGCAGG - Intronic
1090831613 11:130424616-130424638 AAGGACTGGCTTCCATTTGCAGG + Intronic
1090944490 11:131417784-131417806 ATTGACTGACTTCCTTCTTGGGG - Intronic
1092334949 12:7623868-7623890 ATGGAATTGGTTCCTTCTGGTGG - Intergenic
1093565746 12:20601082-20601104 ATGGTCTGTCTTCCTCCTTCAGG - Intronic
1099046003 12:77720421-77720443 ATTTACTGGCTTCTTTTTGCAGG + Intergenic
1101343336 12:103862604-103862626 CTGTACTGGCTGCCTTCTGTAGG - Intergenic
1103618670 12:122172175-122172197 ATGGAATGCTTTTCTTCTGCAGG - Exonic
1104584806 12:130039332-130039354 ATGGACTGCCTTTGTCCTGCTGG - Intergenic
1104741019 12:131173692-131173714 CTGGACAGGCTTCCTGCTGAAGG + Intergenic
1104757749 12:131279490-131279512 ATGGCCAGGCTTTCTCCTGCTGG + Intergenic
1105488807 13:20866047-20866069 AGGGATTGGCTTACTTCTTCTGG - Intronic
1106085685 13:26539886-26539908 ATAGACTGGTTACCTTCTACAGG + Intergenic
1107817192 13:44254725-44254747 ATGTATTGGTTTCTTTCTGCTGG - Intergenic
1107990195 13:45812951-45812973 ATACACTGGCTTCCTTCTCCTGG - Intronic
1108188833 13:47916777-47916799 AGGAAGTGGCTTGCTTCTGCAGG + Intergenic
1108275214 13:48801598-48801620 TGGGAATGGCTTCCTTCTTCAGG + Intergenic
1109147332 13:58795958-58795980 AAGGGCTGCATTCCTTCTGCAGG - Intergenic
1110805138 13:79745431-79745453 TTGGACTGGCTTTCTTCCTCCGG + Intergenic
1112474860 13:99722169-99722191 ATGGACTGGCTAGCTTCTTAAGG + Intronic
1113082126 13:106531327-106531349 ATGGACTGTCGTTGTTCTGCAGG - Intronic
1114578062 14:23731180-23731202 CTGGGCTGGCCTCTTTCTGCTGG + Intergenic
1118347679 14:64951663-64951685 AGGGACTGGCTTTCTCCTGCAGG - Exonic
1119196104 14:72717820-72717842 AAGGATTGGCTTCCTTTGGCTGG - Intronic
1119778842 14:77265102-77265124 ATGCTCTGTCATCCTTCTGCTGG - Intergenic
1120189061 14:81423512-81423534 AGTGCCTGGCTTCCTTCTGCTGG - Intronic
1122131485 14:99606399-99606421 GTGCACAGGCTTCATTCTGCAGG - Intergenic
1122343554 14:101044353-101044375 ATGGCCTGGCTTCCATGTCCGGG + Intergenic
1125278016 15:38013874-38013896 CTGGGCTGCATTCCTTCTGCAGG + Intergenic
1129740933 15:77989254-77989276 ATGGGCAGGATACCTTCTGCTGG + Intronic
1132526010 16:415055-415077 AGGGACAGCATTCCTTCTGCTGG + Intergenic
1133154317 16:3861996-3862018 AGTGACTCGCTTCCTTCTCCTGG - Intronic
1133758935 16:8782476-8782498 CTGGACTGGATTTCTTCTGGAGG + Exonic
1135591751 16:23710203-23710225 ATGTACAGGCTGCCATCTGCTGG + Exonic
1137712891 16:50579113-50579135 ATGCACTGTCTTACTCCTGCGGG + Intronic
1137712897 16:50579170-50579192 ATGCACTGTCTTACTCCTGCAGG + Intronic
1137712905 16:50579227-50579249 ATGCACTGTCTTACTCCTGCGGG + Intronic
1137712923 16:50579341-50579363 ATGCACTGTCTTACTCCTGCGGG + Intronic
1137712946 16:50579512-50579534 ATGCACTGTCTTACTCCTGCGGG + Intronic
1137712963 16:50579626-50579648 ATGCACTGTCTTACTCCTGCGGG + Intronic
1137712972 16:50579683-50579705 ATGCACTGTCTTACTCCTGCGGG + Intronic
1137712980 16:50579740-50579762 ATGCACTGTCTTACTCCTGCGGG + Intronic
1137811720 16:51359128-51359150 CTGGGCTGGCCTCCTGCTGCTGG + Intergenic
1138247295 16:55477459-55477481 AGGGCCTGGCTCCCTCCTGCGGG + Intronic
1138576674 16:57911875-57911897 ATGCGCTGTGTTCCTTCTGCAGG - Exonic
1138927067 16:61605324-61605346 ATGTAGTGGGTTCCTACTGCAGG + Intergenic
1140358161 16:74323300-74323322 ACTGACTGGCTTCCTTATGCTGG - Intergenic
1141100301 16:81192865-81192887 TTGGACTGCCTTCCTTCTTAAGG - Intergenic
1141120125 16:81347393-81347415 ATGGACTGGCTTCCTTCTGCTGG + Intronic
1142264283 16:89056664-89056686 AGCGAATGGGTTCCTTCTGCTGG + Intergenic
1142754952 17:2010925-2010947 ATGAACTGCCTGCCTACTGCTGG - Intronic
1143597630 17:7924700-7924722 AGGGGCTGGCTTCCTGCTGAGGG + Intronic
1144955162 17:19015419-19015441 TTGAGCTGGATTCCTTCTGCAGG + Intronic
1152916058 17:83036688-83036710 CTGGGCTGCCTTGCTTCTGCTGG - Intronic
1154181632 18:12144043-12144065 ATGGACTGGCCTCCTCTTTCTGG + Intergenic
1154182272 18:12147541-12147563 ATGGACTGGCCTCCTCTTTCTGG - Intergenic
1155357045 18:24962963-24962985 ATGGACTGGATTCCACATGCAGG - Intergenic
1155532781 18:26784127-26784149 ATAGACTGGCTCCCTTCAGTAGG - Intergenic
1156039437 18:32803857-32803879 ATGGACTGCCTTCCTTCTGCTGG - Intergenic
1158688177 18:59633672-59633694 ATGGATTGGCTTCGTTCTGTTGG - Intronic
1159945824 18:74444214-74444236 ATGGTATGGCTTCCTACTCCAGG - Intronic
1161945624 19:7434749-7434771 ATGGACAGGCTTCTTTCTGTGGG - Intronic
1162375100 19:10300129-10300151 TGGGACTGGCTTCCTTCTCTAGG - Intergenic
1165346356 19:35250706-35250728 TGGGACTGGCGTCCTTGTGCGGG + Intronic
1165882700 19:39054784-39054806 AAGGACTGCCTGCCTTCTGGAGG + Intergenic
1166079406 19:40434183-40434205 GGGGACTCGGTTCCTTCTGCAGG + Intergenic
926432945 2:12808266-12808288 ATGAACACGCTTGCTTCTGCAGG + Intergenic
928158211 2:28895227-28895249 CTGGGGCGGCTTCCTTCTGCCGG + Intronic
928174168 2:29022958-29022980 ATGGAATGGCACCCTGCTGCGGG + Intronic
928226907 2:29457480-29457502 ATGGACAGGTTTCCATCTGCAGG + Intronic
930286193 2:49431334-49431356 ATTGATTTGCATCCTTCTGCTGG - Intergenic
933581137 2:84128330-84128352 ATGGAGTTTCTTCCTTCTGGTGG - Intergenic
934162997 2:89270107-89270129 ATGGACTTCCTTCCTTCTGGAGG + Intergenic
934204276 2:89912417-89912439 ATGGACTTCCTTCCTTCTGGAGG - Intergenic
934568356 2:95352906-95352928 ATGGACTGGAGGCCTCCTGCAGG - Intronic
935695096 2:105764343-105764365 GTGGAAATGCTTCCTTCTGCAGG + Intronic
937417887 2:121731419-121731441 CTTCACTGGCTTCTTTCTGCAGG + Intronic
937433218 2:121858367-121858389 CTGGCCTGTCTTGCTTCTGCAGG - Intergenic
937926369 2:127170781-127170803 CTGCACTGGCTCCTTTCTGCAGG - Intergenic
938000410 2:127730304-127730326 ATGCAATTGCTTCCTTCTTCAGG + Intronic
939928367 2:148201549-148201571 ATGGGATGGCTGCCCTCTGCTGG + Intronic
943142563 2:184000928-184000950 CTGGATTTTCTTCCTTCTGCTGG - Intergenic
944450047 2:199833538-199833560 ATGGCCAGGAATCCTTCTGCTGG + Intronic
945190027 2:207178356-207178378 ATGGAATGGCCTCCTTCAGGTGG - Intergenic
946054145 2:216886299-216886321 CTGGACTTTCTTCCTTCTGGTGG - Intergenic
946884336 2:224208145-224208167 ATGCACTGGTTTCCATCTGTTGG + Intergenic
947510878 2:230753325-230753347 GGGGACAGGCTTCCTTCTGATGG - Intronic
947625423 2:231615379-231615401 AAGGCATGGCTGCCTTCTGCCGG - Intergenic
1169541437 20:6604247-6604269 ATGGACTGAGTTTCTTTTGCTGG - Intergenic
1169880425 20:10341309-10341331 ATTGCCTGGCCTCCTTCTCCTGG + Intergenic
1170574163 20:17649952-17649974 ACGCACTGGCCTCCTTCTGGAGG + Intronic
1171270337 20:23812120-23812142 CTGGAGTTTCTTCCTTCTGCTGG - Intergenic
1174661072 20:52213732-52213754 AAAGACTGCCTTCCTTCTGGAGG + Intergenic
1174752502 20:53125540-53125562 ATGGCCTGGCTTCCTACCTCAGG + Intronic
1175809308 20:61849219-61849241 AGGGAGGGGCTTCCTTCTCCAGG - Intronic
1176086642 20:63298240-63298262 ATGTACTGAATGCCTTCTGCAGG - Intronic
1178023248 21:28434539-28434561 TTCGACTGGCTTCTTTCTGTGGG + Intergenic
1182457580 22:30461713-30461735 ATGGGCTTGCTTCCGTCTCCTGG + Intronic
1183210517 22:36448492-36448514 AGGGACTGGGTTCCATCTGGTGG + Intergenic
1183747455 22:39699790-39699812 GAGGACTGGCTTCCTGCGGCTGG - Intergenic
1184805978 22:46795186-46795208 ATGCACTGACCGCCTTCTGCAGG + Intronic
1185170518 22:49291096-49291118 CTTGGCTGGCTTCCTTCTCCCGG + Intergenic
949171022 3:996806-996828 ATGGAATGGCTTCCTTTGACAGG - Intergenic
950368399 3:12506245-12506267 ATGGATTTATTTCCTTCTGCAGG + Intronic
951985584 3:28616665-28616687 ATGAATTGTCTTCTTTCTGCTGG - Intergenic
952457243 3:33484787-33484809 AGGGGCTGCCTTCCTTCTGGAGG + Intergenic
953801363 3:46026315-46026337 GTGAACTGGCTCCCTTTTGCTGG + Intronic
959919161 3:111851701-111851723 TTGCACTGGCTTCTTGCTGCGGG - Intronic
961731654 3:128969599-128969621 ATGTCCTGGCTTCATTCTGCTGG + Exonic
963398071 3:144758089-144758111 TCGGACTGTCTTCCTTCTGGTGG - Intergenic
964982987 3:162709666-162709688 TTGGACTTTCTTCCTTCTGGTGG + Intergenic
965385631 3:168042643-168042665 ATGCACTGGTTTCTTTCTCCAGG + Intronic
966985182 3:185173521-185173543 ATGGATTTGCTTGCTTCTTCTGG - Intergenic
968047255 3:195631321-195631343 ATGGCCTGGCTTGCACCTGCTGG + Intergenic
968561648 4:1286331-1286353 ATGGGGTGGCTGCCCTCTGCTGG + Intergenic
972065609 4:34939500-34939522 TTGGGGTGGCTGCCTTCTGCAGG + Intergenic
972076980 4:35101894-35101916 AGGGGCTGGCTTCCCTCAGCAGG - Intergenic
972767224 4:42162512-42162534 ATGGAATGGATTCCTTCTCATGG - Intergenic
973131039 4:46648424-46648446 GTGGACTCACTGCCTTCTGCAGG - Intergenic
976529335 4:86134050-86134072 ATGGGTTGGCTTCCTTGTGAAGG - Intronic
976661745 4:87546920-87546942 ATAGACTGGCTTTGCTCTGCTGG + Intergenic
976970514 4:91096382-91096404 AGGGGCTGGCTTCCCTCGGCAGG + Intronic
977563068 4:98552767-98552789 TTGGACTGGCTTCATTCTTAGGG - Intronic
977634762 4:99284549-99284571 GTGGATGGGCTTCCTCCTGCAGG + Exonic
984095597 4:175428801-175428823 CTGGAGTTGCTTCCTTCTGGTGG - Intergenic
985528551 5:420504-420526 CAAGACTGGCTTCCTCCTGCAGG - Intronic
986520847 5:8616518-8616540 ATAGACTGGCTTCATTCTCAGGG - Intergenic
987747499 5:21995082-21995104 CTGGAGTGTCTTCCTTCTGGTGG - Intronic
988407214 5:30839208-30839230 ATGGCCTGGTTTCCTCATGCTGG + Intergenic
991767679 5:70004882-70004904 CTGGAGTGTCTTCCTTCTGGTGG - Intergenic
991846913 5:70879958-70879980 CTGGAGTGTCTTCCTTCTGGTGG - Intergenic
992134274 5:73727511-73727533 ATGGACTCTCTTCCTTATCCAGG - Intronic
993041218 5:82816913-82816935 AGGGAGTTGCTTCTTTCTGCTGG - Intergenic
993521200 5:88904002-88904024 CTGGTCTGGCTTTATTCTGCAGG - Exonic
993937941 5:94026269-94026291 ATGGGGTGGCTGCCCTCTGCTGG + Intronic
995854830 5:116579967-116579989 AGGGACTGGCCTCCTACTGGAGG - Intergenic
998213107 5:140216572-140216594 AGGGAGTGGGTTCCTTCTCCAGG + Intronic
999797807 5:155004531-155004553 GTGGAATGGCTGCCCTCTGCTGG + Intergenic
1001554940 5:172630805-172630827 AAGGAATCTCTTCCTTCTGCAGG + Intergenic
1001887757 5:175310942-175310964 ATGGGTTGGATTCCTTTTGCCGG - Intergenic
1001939970 5:175733472-175733494 TTGGGCTGTGTTCCTTCTGCAGG + Intergenic
1005484403 6:26285900-26285922 AGTGACTGGCTTTCTGCTGCCGG + Intergenic
1006022280 6:31124317-31124339 ATGTACTGACTGCCTGCTGCAGG + Intronic
1007221794 6:40284490-40284512 AAGGCCTGGATTCCTTCTACGGG + Intergenic
1008123243 6:47641547-47641569 CTGTACTGGCTTCCTTCTGATGG - Intergenic
1009691028 6:67031908-67031930 CTGGAGTTTCTTCCTTCTGCGGG - Intergenic
1012712713 6:102628870-102628892 CAGGACTGGCTTCTTTCTTCAGG + Intergenic
1013039316 6:106417965-106417987 ATGGAGTGGCTACTCTCTGCCGG + Intergenic
1014134853 6:117876954-117876976 ATGGACTGGATTCCTTTTTCTGG + Intergenic
1014488590 6:122033622-122033644 ATGAACTGGATTCCTTCTCCAGG + Intergenic
1016616226 6:146051664-146051686 AAGGACTGGCTCCCCGCTGCAGG - Intronic
1017300948 6:152856862-152856884 ATGGTGTGGCTTCCTTCCTCAGG - Intergenic
1017756247 6:157531920-157531942 AGGGCCTGGCCTCGTTCTGCGGG + Intronic
1018784687 6:167098837-167098859 ATGGACACGCTTCACTCTGCAGG + Intergenic
1018830945 6:167443151-167443173 ATTCACTGGCTTCCTTTTGGAGG + Intergenic
1023345619 7:39268400-39268422 ATGTACTGCCATCCTTCTGCTGG - Intronic
1023511856 7:40961591-40961613 ATGGAATTGGTTCCTTCTGGTGG + Intergenic
1023661386 7:42474604-42474626 ATGGACTGGCTTCGTTCCTCGGG + Intergenic
1024749059 7:52442382-52442404 TCGGACTGGCTTCCTTCAACTGG + Intergenic
1026996323 7:74619269-74619291 ATTGAGGGGCTTCCTCCTGCAGG + Intergenic
1028502923 7:91538930-91538952 ATGGGATGGATTCCTTATGCAGG - Intergenic
1029382267 7:100221817-100221839 TTGACCTGGCTTCCCTCTGCTGG + Intronic
1030420178 7:109299515-109299537 CTGGAGTTTCTTCCTTCTGCTGG - Intergenic
1030923955 7:115427875-115427897 ATGGATTGGCTTCAATCTGGAGG + Intergenic
1034411147 7:150942807-150942829 ATGGACAGGTTGCCTTCTGCTGG + Intergenic
1035040912 7:155926555-155926577 AAGGACTGTCTTCATTCTGAAGG - Intergenic
1035077424 7:156190119-156190141 CTGCACTGGATTCCTTCTGGAGG - Intergenic
1035643601 8:1201473-1201495 AGGACCTGGCTTCCTTCTGGAGG - Intergenic
1036817188 8:11910910-11910932 ATGTCCAGGCTTCCTTCTGATGG + Intergenic
1038503353 8:28063518-28063540 AGAGACTGCCTTCCTCCTGCAGG + Intronic
1038953457 8:32442267-32442289 AAAGACTGTCTTCCTTCTGCAGG + Intronic
1039027184 8:33270674-33270696 CTGAACTGGCTCCCTTCTGTGGG + Intergenic
1039066551 8:33613525-33613547 ATGGAATGCCTTCCTTCTGGAGG + Intergenic
1040559064 8:48507723-48507745 CTGGAGTTGCTTCCTTCTGGTGG - Intergenic
1040622601 8:49106474-49106496 CAGGACTGGGTTCCTTCTGGAGG + Intergenic
1040885289 8:52256084-52256106 ATGGACTGGCTTTGTTTTGATGG - Intronic
1040999487 8:53436824-53436846 CTGGAGTTTCTTCCTTCTGCTGG + Intergenic
1041000259 8:53442539-53442561 CTGGAGTTTCTTCCTTCTGCTGG + Intergenic
1043166840 8:76913113-76913135 AGGGATTGTCTTCCTTCTGGAGG + Intergenic
1043741017 8:83811460-83811482 CTGGAGTTTCTTCCTTCTGCTGG - Intergenic
1044008774 8:86966470-86966492 CTGGACTTTCTTCCTTCTGGTGG + Intronic
1045340192 8:101246816-101246838 AAGGACTGCATTCCTTCTGGAGG - Intergenic
1046617231 8:116490796-116490818 ATCTACTGGCTTCATTCTGCAGG + Intergenic
1047642400 8:126834405-126834427 ATGGAGTGGCTTCTTTCAGGGGG + Intergenic
1047729163 8:127712255-127712277 ATAGACTGGCTGGCTTTTGCTGG + Intergenic
1047964942 8:130039529-130039551 AAGGACTGTGTTCCTTCTGGAGG - Intergenic
1048335324 8:133498183-133498205 ATGAACTGCCTGCCTTCTGGCGG - Intronic
1048650184 8:136467576-136467598 GTGGACTGCCTTCCTGCTGGAGG + Intergenic
1050237571 9:3597840-3597862 ATGGGGTGGCTTCCCTCTGCTGG - Intergenic
1050872670 9:10593079-10593101 CTGGACTTGGTTCCTTCTGGTGG - Intronic
1051751141 9:20342005-20342027 ATGGACTCTCTGCCTTCAGCTGG + Exonic
1051873773 9:21769060-21769082 CTGGACTGTCTTCCTTCTGGAGG - Intergenic
1055207911 9:73754907-73754929 ATTGCCTGGGTTCCATCTGCAGG - Intergenic
1057403723 9:94747873-94747895 ATCTACTGGCTTCCTCCTTCAGG - Intronic
1059246764 9:112855834-112855856 AGGGGCTGGCTGCCTTCTCCTGG + Intronic
1061589499 9:131589428-131589450 GCGGACTGCCTTCCTCCTGCTGG - Intronic
1062471960 9:136710024-136710046 ATGGCCTGTCCTCCTCCTGCAGG - Intergenic
1185529435 X:805923-805945 CAGGACTGAGTTCCTTCTGCAGG + Intergenic
1185755137 X:2647218-2647240 CAGGGCTGGCTTCCTTCTGGAGG + Intergenic
1186294474 X:8133900-8133922 AAGGACTGCCTTCCTTATCCAGG + Intergenic
1186870170 X:13763774-13763796 ATGGGCGGGCTTTCTCCTGCCGG + Exonic
1187465757 X:19526185-19526207 AAAGACTGTCATCCTTCTGCAGG - Intergenic
1190344686 X:49326806-49326828 ATGGATTGCCTACCTTCTTCAGG - Exonic
1190345779 X:49336363-49336385 ATGGATTGCCTACCTTCTTCAGG - Exonic
1190346883 X:49345913-49345935 ATGGATTGCCTACCTTCTTCAGG - Exonic
1190348132 X:49536940-49536962 ATGGATTGCCTACCTTCTTCAGG - Exonic
1190349233 X:49546496-49546518 ATGGATTGCCTACCTTCTTCAGG - Exonic
1190350337 X:49556052-49556074 ATGGATTGCCTACCTTCTTCAGG - Exonic
1190351439 X:49565611-49565633 ATGGATTGCCTACCTTCTTCAGG - Exonic
1190352539 X:49575164-49575186 ATGGATTGCCTACCTTCTTCAGG - Exonic
1190353640 X:49584712-49584734 ATGGATTGCCTACCTTCTTCAGG - Exonic
1190354742 X:49594234-49594256 ATGGATTGCCTACCTTCTTCAGG - Exonic
1190355847 X:49603784-49603806 ATGGATTGCCTACCTTCTTCAGG - Exonic
1190365591 X:49691236-49691258 ATGGACTACCTACCTTCTGCGGG + Exonic
1191604390 X:63044966-63044988 ATGGAGTGGCTCCCTCCTGGAGG + Intergenic
1191604408 X:63045048-63045070 ATGGAGTGGCTCCATTCTGGAGG + Intergenic
1191936625 X:66434133-66434155 ATGGACTGGCTTGCTAGTGATGG - Intergenic
1193429256 X:81380438-81380460 CTGGACTGTGTTCCTTCTGGAGG + Intergenic
1194295407 X:92120946-92120968 ATGTAGTGGCTTCCTTTTTCTGG + Intronic
1198223204 X:134621923-134621945 GTGGGCTGGCTTCCATCTCCAGG - Intronic
1199787716 X:151119704-151119726 CTGAACTGGTTTCCTTCTGGAGG - Intergenic
1199855492 X:151755906-151755928 ATGAGCTGGCTCCCCTCTGCTGG + Intergenic
1199866683 X:151856784-151856806 AGTGACAGGCTTCCGTCTGCAGG - Intergenic
1200612910 Y:5345454-5345476 ATGTAGTGGCTTCCTTTTTCTGG + Intronic
1200942898 Y:8804158-8804180 ATGCCCAGGCTTCCTTCTGATGG - Intergenic