ID: 1141121715

View in Genome Browser
Species Human (GRCh38)
Location 16:81363759-81363781
Sequence TAGCGATCCCTGAACACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141121715_1141121719 24 Left 1141121715 16:81363759-81363781 CCTTGTGTGTTCAGGGATCGCTA 0: 1
1: 0
2: 0
3: 11
4: 67
Right 1141121719 16:81363806-81363828 TTCGGAATTGTGGAGATAGATGG 0: 1
1: 0
2: 0
3: 10
4: 145
1141121715_1141121716 -10 Left 1141121715 16:81363759-81363781 CCTTGTGTGTTCAGGGATCGCTA 0: 1
1: 0
2: 0
3: 11
4: 67
Right 1141121716 16:81363772-81363794 GGGATCGCTAATGTAATTTCAGG 0: 1
1: 0
2: 0
3: 2
4: 61
1141121715_1141121720 25 Left 1141121715 16:81363759-81363781 CCTTGTGTGTTCAGGGATCGCTA 0: 1
1: 0
2: 0
3: 11
4: 67
Right 1141121720 16:81363807-81363829 TCGGAATTGTGGAGATAGATGGG 0: 1
1: 0
2: 1
3: 3
4: 122
1141121715_1141121718 14 Left 1141121715 16:81363759-81363781 CCTTGTGTGTTCAGGGATCGCTA 0: 1
1: 0
2: 0
3: 11
4: 67
Right 1141121718 16:81363796-81363818 AAGACATAACTTCGGAATTGTGG 0: 1
1: 0
2: 0
3: 6
4: 114
1141121715_1141121717 6 Left 1141121715 16:81363759-81363781 CCTTGTGTGTTCAGGGATCGCTA 0: 1
1: 0
2: 0
3: 11
4: 67
Right 1141121717 16:81363788-81363810 TTTCAGGCAAGACATAACTTCGG 0: 1
1: 0
2: 1
3: 13
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141121715 Original CRISPR TAGCGATCCCTGAACACACA AGG (reversed) Intronic
900093887 1:932571-932593 TGGTGGTCCCTGAACCCACACGG + Intronic
905539697 1:38750213-38750235 CAGGGATCCCTGAACACAGAAGG + Intergenic
918121042 1:181540651-181540673 TCGTGATCCCTGAAGACAGAGGG + Intronic
920732424 1:208500213-208500235 TAGTCAACCCTGAATACACATGG - Intergenic
1065233296 10:23621192-23621214 TGGCCATCCCTGCACAAACAAGG + Intergenic
1065511149 10:26479476-26479498 TAGAGATCACTGAACCCAAAAGG + Intronic
1067382493 10:45787716-45787738 TGCCACTCCCTGAACACACATGG + Intronic
1067890191 10:50128264-50128286 TGCCACTCCCTGAACACACATGG + Intronic
1071490345 10:86131960-86131982 TAGCATTCCCAGATCACACAAGG + Intronic
1073955127 10:108861598-108861620 TTGAGATGCCTGAACACACTGGG - Intergenic
1076248183 10:128963996-128964018 TAGCCGTCACTGAGCACACAGGG + Intergenic
1077061818 11:620873-620895 GAGCAAACCCTGAACACACAGGG - Intronic
1077296180 11:1827234-1827256 AAGCCTTCCCTGTACACACAGGG - Intergenic
1077711367 11:4540539-4540561 TAGCCCTTCCTGAAGACACAGGG + Intergenic
1085473971 11:76777593-76777615 AACCTTTCCCTGAACACACATGG + Intergenic
1088392232 11:109327237-109327259 TCTCCAGCCCTGAACACACATGG - Intergenic
1090556616 11:127883283-127883305 TAGCAACCCATGAACTCACATGG + Intergenic
1091554998 12:1566266-1566288 TAGTGATAGCTGGACACACAAGG - Exonic
1104836092 12:131791923-131791945 TACTGATCCGTGAACACACACGG - Intronic
1104836101 12:131792096-131792118 TACTGATCCGTGAACACACATGG - Intronic
1104836104 12:131792166-131792188 TAATGATCTGTGAACACACACGG - Intronic
1104836107 12:131792201-131792223 TAATGATCCGTGAACACACACGG - Intronic
1104836115 12:131792376-131792398 TACTGATCTGTGAACACACACGG - Intronic
1104836122 12:131792548-131792570 TACTGATCTGTGAACACACACGG - Intronic
1105542367 13:21326592-21326614 AAGGGATGCCTGAACACAGATGG + Intergenic
1105943800 13:25172592-25172614 CAGAGATCCCTGGACACACAGGG - Intergenic
1113107657 13:106788919-106788941 AAGCCATCTCTGAACTCACAGGG - Intergenic
1113440304 13:110323288-110323310 TAGAGCTCCCTGACCACAGAGGG - Intronic
1115841327 14:37474076-37474098 TATCGAGCCATGAACATACATGG - Intronic
1116937993 14:50761903-50761925 AACCGAGCCCTGAAAACACATGG + Exonic
1122492857 14:102131544-102131566 TACTGTTCCCTGAACACACTAGG + Intronic
1123937052 15:25199099-25199121 CAGCAAACCCTGAAAACACAGGG - Intergenic
1126622080 15:50650328-50650350 TAGAGATCTCATAACACACAAGG + Intronic
1128588631 15:68874806-68874828 TTCAGATCCCTGAACACAGAAGG - Intronic
1138720131 16:59070168-59070190 TAGCACTTCCTGATCACACAGGG + Intergenic
1139105139 16:63819138-63819160 TAGCTAACCATGAACACAAATGG - Intergenic
1141121715 16:81363759-81363781 TAGCGATCCCTGAACACACAAGG - Intronic
1147699263 17:42382032-42382054 TATAGCTCCCTGAACACACAAGG + Intronic
1151795985 17:76346056-76346078 TGGAGATGCCTGAACACACCAGG + Intronic
1153347281 18:4040980-4041002 TAGCAATGCCTGAACAGACATGG + Intronic
1163602179 19:18255705-18255727 CTCCGATCCCTGAACCCACAGGG + Intergenic
935664997 2:105503446-105503468 CATCAATCCCTGAAAACACATGG - Intergenic
948407611 2:237734049-237734071 TAACGATCCCAGCAAACACAAGG - Intronic
1173701241 20:45073716-45073738 TTGGAATCACTGAACACACATGG + Intronic
1184770541 22:46594433-46594455 CAAGGATCCCTGAACACACCTGG - Intronic
954387005 3:50249359-50249381 CAGCGATGCCTGAACACTTAAGG - Intronic
955148281 3:56341789-56341811 TGGTGATCCCTGAAAACACAGGG + Intronic
956450505 3:69370332-69370354 TAGCGATCGCTTGACACTCAGGG + Intronic
956621111 3:71222250-71222272 TGGCGGTCCCTGGACACACCTGG + Intronic
956846846 3:73191635-73191657 TAGTCATCTCTGAACACACAGGG - Intergenic
960463395 3:117965200-117965222 TAGCCGTCCCTGAACAATCACGG + Intergenic
962209957 3:133469330-133469352 GAGCGATCTGTGCACACACAAGG + Intronic
968793528 4:2686600-2686622 AAGAGCTCTCTGAACACACATGG + Intronic
970221928 4:13820664-13820686 TATCCAGCCCTGAGCACACATGG - Intergenic
972840147 4:42921235-42921257 TAACGGTCCCTCACCACACATGG + Intronic
978302969 4:107292082-107292104 TATCGATCCCTCACCACTCAAGG - Intergenic
981703872 4:147639159-147639181 AAGCAATCCCTGACCACAAAAGG - Intronic
982788826 4:159566749-159566771 AAGATATCCCTGAAGACACATGG - Intergenic
984908025 4:184648517-184648539 TAGCGAGCCCTGCTCACACTCGG - Exonic
984956968 4:185054413-185054435 CATCGTTCCCTGAACACATATGG - Intergenic
985225233 4:187752966-187752988 TAGCGAGCCATGAAAAGACATGG - Intergenic
993704722 5:91156664-91156686 TAGAGTTCCCTGAACTCACTAGG + Intronic
998136796 5:139678327-139678349 CAGCTATCCTTGGACACACATGG + Intronic
1000098826 5:157995006-157995028 CAGCGGTCCCTGAAAACACCAGG - Intergenic
1003372930 6:5546150-5546172 TAGAGGTCCATAAACACACAAGG + Intronic
1003631974 6:7795443-7795465 TGGGGATCCCTGAACTAACAGGG - Intronic
1003729376 6:8804072-8804094 GAGCCATCCCTGAACCCTCATGG + Intergenic
1004765327 6:18720513-18720535 AAGAGATCACTGAACACAAAAGG - Intergenic
1016481908 6:144491177-144491199 TAGTGATCACTGGACACACTAGG - Intronic
1030496689 7:110309285-110309307 CAGAGATTCTTGAACACACAAGG - Intergenic
1034417639 7:150973688-150973710 CAGCCAACCCTGAGCACACAGGG + Intronic
1036996817 8:13667552-13667574 GAGCTGTCCCTGATCACACACGG + Intergenic
1037387231 8:18356431-18356453 TAGAGAAACCTGAAAACACAAGG - Intergenic
1048257896 8:132919302-132919324 TTACAATCCCAGAACACACAGGG - Intronic
1048353995 8:133638642-133638664 TTGTGTTCCCTGAACAAACATGG - Intergenic
1056760008 9:89407761-89407783 TGGCTACACCTGAACACACAGGG + Intronic
1058599692 9:106655959-106655981 TAGAGATTCTTGAAGACACAGGG + Intergenic
1061854255 9:133433060-133433082 CAGGGACCCCTCAACACACAGGG - Intronic
1061854297 9:133433199-133433221 TAGGGATCCCCCAACACACAGGG - Intronic