ID: 1141122629

View in Genome Browser
Species Human (GRCh38)
Location 16:81372670-81372692
Sequence TAGGTTAATACAGTCATTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141122625_1141122629 8 Left 1141122625 16:81372639-81372661 CCTGGTAGATCATCTATGTAGTC No data
Right 1141122629 16:81372670-81372692 TAGGTTAATACAGTCATTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141122629 Original CRISPR TAGGTTAATACAGTCATTCC GGG Intronic
No off target data available for this crispr