ID: 1141131673

View in Genome Browser
Species Human (GRCh38)
Location 16:81441692-81441714
Sequence CTGGGATAGTGGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141131666_1141131673 -5 Left 1141131666 16:81441674-81441696 CCTTTCTAGGTTGGGAGCCTGGG No data
Right 1141131673 16:81441692-81441714 CTGGGATAGTGGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141131673 Original CRISPR CTGGGATAGTGGAAGGTGGA GGG Intergenic
No off target data available for this crispr