ID: 1141132502

View in Genome Browser
Species Human (GRCh38)
Location 16:81445304-81445326
Sequence GCTGCTGGGGGGCGACGTGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141132492_1141132502 3 Left 1141132492 16:81445278-81445300 CCCCGGCAGATCGAGGAGACCAA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1141132502 16:81445304-81445326 GCTGCTGGGGGGCGACGTGTCGG 0: 1
1: 0
2: 0
3: 9
4: 130
1141132491_1141132502 4 Left 1141132491 16:81445277-81445299 CCCCCGGCAGATCGAGGAGACCA 0: 1
1: 0
2: 1
3: 5
4: 82
Right 1141132502 16:81445304-81445326 GCTGCTGGGGGGCGACGTGTCGG 0: 1
1: 0
2: 0
3: 9
4: 130
1141132493_1141132502 2 Left 1141132493 16:81445279-81445301 CCCGGCAGATCGAGGAGACCAAG 0: 1
1: 0
2: 1
3: 10
4: 98
Right 1141132502 16:81445304-81445326 GCTGCTGGGGGGCGACGTGTCGG 0: 1
1: 0
2: 0
3: 9
4: 130
1141132488_1141132502 29 Left 1141132488 16:81445252-81445274 CCAGCAGCTCGGGCGGCGGCGGC 0: 1
1: 1
2: 11
3: 163
4: 5978
Right 1141132502 16:81445304-81445326 GCTGCTGGGGGGCGACGTGTCGG 0: 1
1: 0
2: 0
3: 9
4: 130
1141132494_1141132502 1 Left 1141132494 16:81445280-81445302 CCGGCAGATCGAGGAGACCAAGC 0: 1
1: 0
2: 1
3: 13
4: 117
Right 1141132502 16:81445304-81445326 GCTGCTGGGGGGCGACGTGTCGG 0: 1
1: 0
2: 0
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141132502 Original CRISPR GCTGCTGGGGGGCGACGTGT CGG Exonic
900650128 1:3726423-3726445 GGTGTTGGGGGTGGACGTGTGGG + Intronic
902760709 1:18579114-18579136 GCTGCTGCGTGGAGACTTGTAGG + Intergenic
905825618 1:41024011-41024033 GCTGCTGAGGGGAGAAGTGTTGG + Intergenic
908048964 1:60207083-60207105 GCTGCTGGGAGGGGGGGTGTTGG - Intergenic
911527405 1:99004221-99004243 GGTGTGGGGGGGTGACGTGTGGG + Intronic
912404568 1:109426273-109426295 GCAGCTGGGGGACGTCGGGTGGG - Intronic
913117471 1:115710649-115710671 GCTGCTGGGAGGCGAGGGCTTGG - Intronic
913200858 1:116494369-116494391 GCTGCAAGGGGGTGACGTCTGGG + Intergenic
916830435 1:168485394-168485416 GGTGGTGGGGGGCGGCGTGGGGG + Intergenic
922808911 1:228405413-228405435 GCTCCTGGGAGCCTACGTGTGGG - Intronic
924042651 1:239998221-239998243 GCAGCTGCGGGGCGCCGTGCGGG - Intergenic
1062906488 10:1183118-1183140 GTGTCTGGGGGGCGACGTGGCGG - Exonic
1063705918 10:8430691-8430713 GCTGCTGGGAGGAGACCTGGGGG + Intergenic
1069114138 10:64483525-64483547 TCTGCTGGGGGGCGGCGGGGGGG - Intergenic
1070302061 10:75210830-75210852 GCAGCTGGAGGGCGAAGTGAAGG - Exonic
1076341109 10:129745370-129745392 GCTGCCAGGGGGCGGCGTGGGGG - Intronic
1076546194 10:131246950-131246972 GCTGGTGGGGTGAGATGTGTAGG + Intronic
1076546215 10:131247038-131247060 GCTGGTGGGGTGAGATGTGTAGG + Intronic
1079952187 11:26819360-26819382 GCTGTTGGTGGGGGACGTGGTGG - Intergenic
1080713001 11:34769489-34769511 GCTGCTGGGGGGAGGGGGGTGGG - Intergenic
1081716110 11:45251762-45251784 GCTGTTGGGGGGCCACAAGTGGG - Intronic
1083332402 11:61904994-61905016 GCTGCTGGGGATCGACCTGCTGG - Intronic
1083399364 11:62413403-62413425 GCTGCTGGGGGAGGACTAGTCGG - Intronic
1090669570 11:128936994-128937016 GCTTCTGGGGAGAGAAGTGTGGG + Intronic
1093662936 12:21777859-21777881 GCAGCTCGCGGGCCACGTGTTGG - Intergenic
1096895879 12:54820237-54820259 GCTGCTGCTGGCCCACGTGTGGG - Intergenic
1105705773 13:22966616-22966638 TCTGCTGGGGGCCCAGGTGTGGG + Intergenic
1105858677 13:24391601-24391623 TCTGCTGGGGGCCCAGGTGTGGG + Intergenic
1118071332 14:62249616-62249638 GCTGCTGCTGGGGGAGGTGTGGG - Intergenic
1118276076 14:64387519-64387541 GCTGCGGGGCGGGGACGTGGGGG + Intergenic
1118294510 14:64556945-64556967 TTTGCTGGGGGGCGGCGGGTGGG - Intronic
1119320912 14:73729755-73729777 GAGGATGGGGGGCGGCGTGTAGG + Exonic
1120935472 14:89891865-89891887 GCTGCTGCGGAGCTACGTGGCGG + Intronic
1121674207 14:95739360-95739382 GGTGCTGGGGGGCCAGGGGTAGG - Intergenic
1122658573 14:103279225-103279247 GCTGCTGGGGAGCGTGGAGTGGG + Intergenic
1122694514 14:103546274-103546296 GCAGCTGGCGGGCGGGGTGTGGG - Intergenic
1123004205 14:105313873-105313895 GCCGCTGGGGCCCGACGTGTAGG - Exonic
1123987659 15:25659352-25659374 GCTCCTGGGGCGCAACGGGTGGG - Intergenic
1126578450 15:50220491-50220513 GCTGCTGGCGGGCTGCATGTGGG + Intronic
1129416040 15:75381148-75381170 GATGTTGGGGGGGGTCGTGTGGG - Intronic
1131458505 15:92602086-92602108 GCTGGTGGAGGGTGACGGGTGGG - Intergenic
1132842964 16:1987186-1987208 ACTGCTGGGAGCCGCCGTGTGGG + Exonic
1134542294 16:15077322-15077344 GTTGCTGGGGGGGGACTGGTGGG + Intronic
1141132502 16:81445304-81445326 GCTGCTGGGGGGCGACGTGTCGG + Exonic
1141598361 16:85111026-85111048 GCTGCAGGGGGGCGCCGGATTGG - Intronic
1141815405 16:86406036-86406058 GGTGCTGGGGGGCATTGTGTGGG + Intergenic
1141904247 16:87013189-87013211 GCAGCTGGAGGGCAGCGTGTGGG - Intergenic
1142081010 16:88148761-88148783 GCTGTTGGGAGGCGTCGTGCTGG + Intergenic
1142113037 16:88342151-88342173 GGTGCTGGGGGGCGAAGGGCTGG - Intergenic
1142130973 16:88431324-88431346 GCTTCCGTGGGGCGCCGTGTTGG - Exonic
1142187000 16:88699352-88699374 CCTGCTGGGAGGCGATGTGTGGG + Intronic
1146301284 17:31691680-31691702 GCGGCTGGGGGTCCAAGTGTAGG - Intergenic
1148806510 17:50266669-50266691 GCTACTGGGGAGAGACCTGTGGG - Intergenic
1150833029 17:68540819-68540841 TCTGCTGGGGGCCTGCGTGTGGG + Intronic
1152161117 17:78669345-78669367 GCTGCTGGAGGGAGAATTGTTGG - Intergenic
1153522985 18:5969361-5969383 GCTGCTGGGGGGCCAGGGCTGGG - Intronic
1157613541 18:48974283-48974305 GCTGCTGGGGGGCGGTGGGAGGG + Intergenic
1158389649 18:57034624-57034646 GCTGATGGAGGGCGATGTGCTGG + Exonic
1159644814 18:70905382-70905404 GCTGCTGGAGGACGACGAGGTGG + Intergenic
1160230824 18:77047460-77047482 GGGGCTGGGGTGAGACGTGTCGG + Intronic
1161117306 19:2505005-2505027 GCCGCTGGGGGGTGAGGTGAGGG - Intergenic
1161683929 19:5693964-5693986 GCTGCTGGGGGCTGCCCTGTGGG - Intronic
1162386044 19:10361285-10361307 GCAGGTGAGGGTCGACGTGTTGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163034209 19:14562134-14562156 GCTCCTGGGGGGCGCAGTCTGGG + Intronic
1163584365 19:18155951-18155973 GCTGCTGCCCGGCGACGTGCTGG + Exonic
1166083276 19:40458326-40458348 GGCGCTGGGGGCCGAGGTGTAGG + Intronic
1167125521 19:47545770-47545792 GCTGCTGGGGGGCGGCTGGCCGG + Exonic
925389133 2:3483647-3483669 ACTGCCGGGGGGGGACGTGCTGG - Intronic
925609926 2:5693858-5693880 GCAGCTGGGGGGCGGCGCGGCGG + Exonic
926205541 2:10832539-10832561 GCTGCTGCGGGGATGCGTGTGGG + Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
931736998 2:65204975-65204997 GCAGCTGGAGGGCGAAGTGAAGG - Intergenic
932330644 2:70896677-70896699 GCTGCTGCGGGTCGTGGTGTTGG + Intergenic
932737060 2:74261642-74261664 GCTGGTAGGGGGCGGGGTGTGGG - Intronic
942460041 2:176162380-176162402 GCTGCTGAGGGATGAGGTGTAGG + Intronic
942461559 2:176171916-176171938 GCTGCTGAGTGGCGCCGTGTAGG - Exonic
946417540 2:219547924-219547946 ACTGCTGGGGCGCTACGTGGTGG + Exonic
947549731 2:231037664-231037686 GCTGCTGGTGGGCGAGCTGTGGG + Exonic
948232271 2:236358835-236358857 CCAGCTGGGGGGCCACGTGACGG - Intronic
948461339 2:238131306-238131328 GCTGCTGGAGTGCGACCTGCCGG + Exonic
1171336232 20:24388265-24388287 GGTGCAGTGGGGCGAGGTGTGGG + Intergenic
1174184000 20:48692818-48692840 GCATCTGGGAGGTGACGTGTAGG - Intronic
1174447134 20:50597825-50597847 TCTGCTGGGGGACGGTGTGTGGG - Intronic
1175429749 20:58892387-58892409 GACGCTGGGGGGCGCCGTGGTGG + Intronic
1179961795 21:44771774-44771796 GCTGCTGTGGGAGGCCGTGTGGG - Intronic
1183671683 22:39276557-39276579 GCGCCTGGGGGGCGGGGTGTGGG - Intergenic
1183780337 22:39995153-39995175 GCTGCTGGGCGGCGGCGAGCAGG + Exonic
1184248650 22:43248253-43248275 GAAGCTGGGGGGCGAGGGGTAGG + Intronic
950940189 3:16884428-16884450 GCGGGCGGGGGGCGACGCGTGGG - Intronic
956892256 3:73624444-73624466 GCTGCTGCGGCGCGACGTGGAGG - Exonic
957215735 3:77317675-77317697 GCTGCTGGGGGGCTACTAGGGGG + Intronic
961143114 3:124572210-124572232 GCTGCTGGGGGTGGAGGTGGGGG + Intronic
968810809 4:2798948-2798970 GCTGCTGGGGCGGGGTGTGTGGG + Intronic
969071381 4:4542057-4542079 GTTGCCGGGGGGAGGCGTGTGGG - Intronic
969585295 4:8088035-8088057 GGTGCTGGGGGGCGCTGAGTGGG - Intronic
975983483 4:80183876-80183898 GCTGCTGCCGGGCGGCGTCTGGG - Intronic
986747261 5:10755505-10755527 GCTGCTGAGGGGACAAGTGTAGG - Intronic
992769382 5:80033260-80033282 GCTGCTGGAGGTAGATGTGTTGG - Intronic
993872375 5:93267861-93267883 GCTGCTGGTGGGCGTGGTGACGG + Intergenic
995492467 5:112707579-112707601 GCTGCTCGGGGGGGACCTGCGGG + Intronic
995650388 5:114362289-114362311 GCTGCTGGTGCGCGAGGTGCGGG - Exonic
1000302563 5:159969297-159969319 GCTGCTGGGGGGCAATGGCTGGG - Intronic
1002774136 6:314405-314427 GCTGCTGTGAAGCGACGTATTGG + Intronic
1006459105 6:34148044-34148066 GCTGGTGGGGGGCGGGGGGTGGG - Intronic
1012582062 6:100881344-100881366 GCAGCGGGGCGGTGACGTGTAGG - Exonic
1019047628 6:169160884-169160906 GAAGCTGGGGGTCGAGGTGTGGG + Intergenic
1020144067 7:5629340-5629362 GCTACTGGGGGGCTATTTGTGGG + Intronic
1026108424 7:67439035-67439057 GTTGTTGGGGGGCGGCGGGTAGG + Intergenic
1029531307 7:101127147-101127169 GCTGCTGGAGGGGGGCGTGTGGG - Exonic
1034902178 7:154914561-154914583 GCTGCTGGGAGGAGACGGCTGGG - Intergenic
1036208765 8:6825261-6825283 GCTGCAGGAGGCCGACCTGTCGG - Exonic
1049282955 8:141759796-141759818 GCTGCTGGAGGCCCACGTGTGGG - Intergenic
1049714943 8:144085372-144085394 AGTGCTGGGTGGCAACGTGTTGG - Exonic
1053000198 9:34573731-34573753 GCTGCTGTGGGGAGAGGTGAAGG - Intronic
1055439568 9:76324838-76324860 TTTGCTTGGGGGCGACATGTGGG - Intronic
1058140944 9:101356561-101356583 GCTGCTGGAGGTGGATGTGTTGG - Intergenic
1059391602 9:114002687-114002709 GCTGCTGAGGGGCGAGGGCTTGG + Intronic
1062030276 9:134359031-134359053 GCTGCTGGGGGCTGCCGTGTGGG + Intronic
1062036658 9:134385525-134385547 GATCCTGGGGGGCGTCCTGTGGG - Intronic
1062065137 9:134522615-134522637 GCTCCTGGGAGGCCCCGTGTGGG + Intergenic
1062317925 9:135977643-135977665 GCTGCTGGGGGTGGAGGTCTGGG - Intergenic
1062317941 9:135977679-135977701 GCTGCTGGGGGTGGAGGTCTAGG - Intergenic
1062317956 9:135977715-135977737 GCTGCTGGGGGTGGAGGTCTTGG - Intergenic
1062317969 9:135977751-135977773 GCTGCTGGGGGCGGAGGTCTAGG - Intergenic
1062317984 9:135977787-135977809 GCTGCTGGGGGTGGAGGTCTTGG - Intergenic
1062317999 9:135977823-135977845 GCTGCTGGGGGTGGAGGTCTAGG - Intergenic
1062318013 9:135977859-135977881 GCTGCTGGGGGTGGAGGTCTAGG - Intergenic
1062318027 9:135977895-135977917 GCTGCTGGGGGTGGAGGTCTAGG - Intergenic
1062318040 9:135977931-135977953 GCTGCTGGGGGTGGAGGTCTAGG - Intergenic
1062318053 9:135977967-135977989 GCTGCTGGGGGTGGAGGTCTAGG - Intergenic
1062499409 9:136845827-136845849 CCTGCTGGGGCGCGAGGTGCGGG + Exonic
1062533488 9:137011666-137011688 GAAGTTGGTGGGCGACGTGTAGG + Exonic
1062631237 9:137464078-137464100 GCCGCTTGGGTGCGAGGTGTGGG - Intronic
1062631574 9:137465403-137465425 GGGGCTGGGGGGCCAGGTGTGGG - Intronic
1186771183 X:12819591-12819613 GGTCCTGGTGGGCGACGTGAAGG + Exonic
1187419720 X:19123152-19123174 CCTGCTGGGGGTCGAGGTGGAGG + Intergenic
1188334674 X:28916208-28916230 GATGCTGGGGGCCAAGGTGTAGG - Intronic
1193120887 X:77821991-77822013 CCTGCTGGGGGGTGAGGGGTTGG - Intergenic
1200077371 X:153557791-153557813 GCTGCTTGGTGGCCACGTGGTGG + Intronic