ID: 1141132556

View in Genome Browser
Species Human (GRCh38)
Location 16:81445576-81445598
Sequence AGGGCGCATCTCGGGCCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141132556_1141132565 6 Left 1141132556 16:81445576-81445598 CCTCGGGGCCCGAGATGCGCCCT 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1141132565 16:81445605-81445627 CTGCCCCCTGGCGCTGCACCTGG 0: 1
1: 0
2: 4
3: 31
4: 316
1141132556_1141132575 23 Left 1141132556 16:81445576-81445598 CCTCGGGGCCCGAGATGCGCCCT 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1141132575 16:81445622-81445644 ACCTGGAGCCCAGGGCCTGGGGG 0: 1
1: 0
2: 7
3: 59
4: 632
1141132556_1141132573 21 Left 1141132556 16:81445576-81445598 CCTCGGGGCCCGAGATGCGCCCT 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1141132573 16:81445620-81445642 GCACCTGGAGCCCAGGGCCTGGG 0: 1
1: 0
2: 9
3: 62
4: 566
1141132556_1141132560 -6 Left 1141132556 16:81445576-81445598 CCTCGGGGCCCGAGATGCGCCCT 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1141132560 16:81445593-81445615 CGCCCTCCCTGGCTGCCCCCTGG 0: 1
1: 2
2: 8
3: 68
4: 599
1141132556_1141132577 24 Left 1141132556 16:81445576-81445598 CCTCGGGGCCCGAGATGCGCCCT 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1141132577 16:81445623-81445645 CCTGGAGCCCAGGGCCTGGGGGG 0: 1
1: 2
2: 9
3: 105
4: 897
1141132556_1141132574 22 Left 1141132556 16:81445576-81445598 CCTCGGGGCCCGAGATGCGCCCT 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1141132574 16:81445621-81445643 CACCTGGAGCCCAGGGCCTGGGG 0: 1
1: 0
2: 11
3: 74
4: 597
1141132556_1141132571 15 Left 1141132556 16:81445576-81445598 CCTCGGGGCCCGAGATGCGCCCT 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1141132571 16:81445614-81445636 GGCGCTGCACCTGGAGCCCAGGG 0: 1
1: 0
2: 2
3: 31
4: 303
1141132556_1141132578 27 Left 1141132556 16:81445576-81445598 CCTCGGGGCCCGAGATGCGCCCT 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1141132578 16:81445626-81445648 GGAGCCCAGGGCCTGGGGGGCGG 0: 1
1: 0
2: 15
3: 166
4: 1527
1141132556_1141132570 14 Left 1141132556 16:81445576-81445598 CCTCGGGGCCCGAGATGCGCCCT 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1141132570 16:81445613-81445635 TGGCGCTGCACCTGGAGCCCAGG 0: 1
1: 0
2: 5
3: 39
4: 306
1141132556_1141132572 20 Left 1141132556 16:81445576-81445598 CCTCGGGGCCCGAGATGCGCCCT 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1141132572 16:81445619-81445641 TGCACCTGGAGCCCAGGGCCTGG 0: 1
1: 1
2: 7
3: 76
4: 609
1141132556_1141132579 30 Left 1141132556 16:81445576-81445598 CCTCGGGGCCCGAGATGCGCCCT 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1141132579 16:81445629-81445651 GCCCAGGGCCTGGGGGGCGGTGG 0: 1
1: 0
2: 16
3: 137
4: 1312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141132556 Original CRISPR AGGGCGCATCTCGGGCCCCG AGG (reversed) Intronic
902923176 1:19679319-19679341 CGGCCGCAGCTCGGGCTCCGCGG - Exonic
904696482 1:32334627-32334649 AGGGCCACTCTCCGGCCCCGAGG + Exonic
904738159 1:32651059-32651081 AGCGCGCGCCTCGGTCCCCGCGG + Intergenic
907240391 1:53077834-53077856 AAGGAGCTTCCCGGGCCCCGTGG - Intronic
917920093 1:179743701-179743723 CGGGGGCATCTCCGGCCTCGTGG + Intronic
1063088044 10:2837114-2837136 GGCGCGCCTCTCGGGCCACGTGG + Intergenic
1064354425 10:14604390-14604412 AGGGCGGCTCTCGCTCCCCGCGG + Intronic
1071963065 10:90824889-90824911 TGGGCCCATCTGGGGCCCTGGGG + Intronic
1073336655 10:102714812-102714834 AGGGCGCACTTCGCGCCACGTGG - Intronic
1075737633 10:124673771-124673793 AGGGAGCTTCTGGGACCCCGAGG + Intronic
1076374333 10:129973156-129973178 TGGGCGCAGCTGCGGCCCCGGGG - Intergenic
1076750047 10:132537954-132537976 GGGGCGCATCGCGGGCTCGGCGG - Exonic
1076985918 11:236148-236170 AGGGCTCACCGCGGGCCCCATGG + Exonic
1077196603 11:1284095-1284117 AGGGCGCATCAGGGCCCCCAGGG + Intronic
1084682959 11:70677744-70677766 AGTGGGCATCTCGGGCTCAGGGG - Intronic
1086699791 11:89887968-89887990 AGGGCGCATCACAGGACCGGTGG + Intergenic
1086706379 11:89956548-89956570 AGGGCGCATCACAGGACCGGTGG - Intergenic
1091583612 12:1803411-1803433 TGGGCGCATCTGGGGACCTGTGG - Intronic
1094871766 12:34602802-34602824 ACGGAGCATCTCGGGCCCACAGG + Intergenic
1097021635 12:56025085-56025107 AGGGCCCCACTGGGGCCCCGAGG - Exonic
1097106749 12:56630283-56630305 TTGGCTCCTCTCGGGCCCCGCGG - Intronic
1104921935 12:132295133-132295155 AGGCCCCATCTCTGGCCCCTGGG - Intronic
1104977781 12:132559984-132560006 CGGGCGCGGCGCGGGCCCCGAGG - Intronic
1104995163 12:132649605-132649627 AGGACGCATCTCGGGCTCCCTGG + Intronic
1117776556 14:59189502-59189524 AGGGCGCATCTCAGTCTCCACGG + Intronic
1122543204 14:102509191-102509213 AGGGCATATCTGGGGCCCGGAGG - Intronic
1122577322 14:102750658-102750680 AGGGCGCAGGATGGGCCCCGCGG - Intergenic
1122881405 14:104692065-104692087 AGGGCTCATGTCAGTCCCCGAGG + Intronic
1125602049 15:40920787-40920809 AGAGAGCAACTGGGGCCCCGAGG - Intergenic
1128559306 15:68654277-68654299 AGGCTGCATCTCTGGCCCCCTGG - Intronic
1129387190 15:75202484-75202506 AGGGCGCGTCCAGGGCCCCGCGG - Intronic
1131108581 15:89750589-89750611 CGGGTGCAGCTCGGGCTCCGGGG + Exonic
1132240037 15:100250585-100250607 AGGGGGCATCTCAGCCGCCGTGG + Intronic
1133121622 16:3611979-3612001 AGGAAGCTTCTCGGGCCCCCAGG - Intronic
1136576923 16:31130610-31130632 AGGGGGCCTCCCGGGCCCTGGGG + Intronic
1141132556 16:81445576-81445598 AGGGCGCATCTCGGGCCCCGAGG - Intronic
1145750723 17:27353640-27353662 GGGGCGCAGGGCGGGCCCCGAGG - Intergenic
1147651372 17:42063923-42063945 AGGGGGCATCTGGAGCCACGTGG - Intronic
1150219695 17:63489136-63489158 AGGGCACATGTCGGGCCTTGAGG + Intronic
1161072487 19:2269830-2269852 GGGGCGGATCTCGCGCGCCGGGG - Intronic
1161420284 19:4172953-4172975 AGGGCGCACCCGGGGCTCCGGGG - Exonic
1162035107 19:7934327-7934349 AGGGCGGATCTGGTTCCCCGAGG + Intronic
1163466002 19:17469065-17469087 GGGGAGCATCTAGGACCCCGGGG + Intronic
1166099021 19:40560104-40560126 AGGGCACAGCCTGGGCCCCGTGG + Intronic
1167563093 19:50238248-50238270 AGGGCGCATCTGATGCCCTGAGG - Intronic
1167752005 19:51387202-51387224 AGGGCGGACCTCGGGGCCCAAGG - Exonic
928420964 2:31137764-31137786 CGGGGGCATCTCCGGACCCGCGG - Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
932320617 2:70819696-70819718 AGTGTGCATCTGGGGCCCCTGGG + Intronic
932413025 2:71558446-71558468 AGGTGGGATCTGGGGCCCCGGGG - Intronic
946333593 2:219023665-219023687 TGGGCCCATGTCTGGCCCCGTGG - Intronic
947748976 2:232523129-232523151 GGGGCGCAGCCCGGGCCCCAGGG - Exonic
947832514 2:233151571-233151593 AGGCCCCAGCTCGGGCCCTGGGG + Intronic
948287325 2:236795906-236795928 AGGGCCCATCCCTGGCCCAGAGG - Intergenic
1172185265 20:33027517-33027539 AGGGCGATTCTGGGGCCCGGAGG + Intergenic
1173845085 20:46183046-46183068 AGGCAGAATCTCGGGCCCCTTGG + Intronic
1184594022 22:45503344-45503366 GGGCCGCATCCCGGGCCCTGGGG + Intronic
1184828646 22:46970194-46970216 GGGGCGGCTCTCAGGCCCCGGGG - Intronic
1185107310 22:48881339-48881361 AGGGCGCAGGCCGGGCCCGGTGG - Intergenic
950533789 3:13568149-13568171 AGGGAGCCTCTGGGGCCTCGAGG - Intronic
954402862 3:50328110-50328132 CCGGCGCATGGCGGGCCCCGTGG + Exonic
954590788 3:51779605-51779627 AGGGCGCCTGTCAGGGCCCGAGG + Intergenic
961013348 3:123449642-123449664 GGAGCGCCTCTCGGGCGCCGCGG - Exonic
961688233 3:128650370-128650392 AGGACTCCTCGCGGGCCCCGAGG + Intronic
962793980 3:138834989-138835011 CGGGCCAATCCCGGGCCCCGCGG + Intergenic
968659390 4:1792984-1793006 AGCGCGCAGCTCGGGTCCCCTGG - Intergenic
968756063 4:2417274-2417296 AGGGCGCATCTGGGCGTCCGAGG - Intronic
983935684 4:173501195-173501217 AGCGCGGAGCTCGGGCCGCGTGG - Intergenic
1002071364 5:176680487-176680509 AAGGCGGAGCTCAGGCCCCGTGG - Intergenic
1018419655 6:163630816-163630838 AGGGCTCATGTCGAGCCCCTCGG + Intergenic
1019047937 6:169162481-169162503 AGGGCGCCTCGCGGATCCCGAGG - Intergenic
1019276474 7:178513-178535 AGGCCGCATCTGGGGCCGTGAGG - Intergenic
1021411307 7:20331720-20331742 CGGGCGCACCTCGGGGCCCGCGG - Exonic
1025615727 7:63114475-63114497 AGGGCGCATGTGGGGTCCCAGGG + Intergenic
1029380340 7:100210151-100210173 AGGACACATCTGGGGCCCCAAGG + Intronic
1037880779 8:22572465-22572487 AGGGGGCATCTCAGGGCCCCAGG + Intronic
1038883800 8:31640770-31640792 AGGGCGCATCCCGGGCGCGCGGG + Intronic
1047213420 8:122858076-122858098 AGGGCCGAGCTCGGGCCCCACGG + Intronic
1049873838 8:145002714-145002736 AGGCCGCAGGTCGGGCCCCGCGG - Intergenic
1061170013 9:128947271-128947293 AGTGCCCATCTCCGGCCCCGGGG - Exonic
1061570907 9:131476919-131476941 AGGGGGCATCGCTGGCCTCGTGG + Intronic
1062031433 9:134363777-134363799 AGGTCGCACCTCCGGCCCTGGGG - Intronic
1062556051 9:137113884-137113906 CGGGGGCATCCTGGGCCCCGAGG + Exonic
1189069314 X:37847327-37847349 GGGGCGGATCCCGGGCCCAGGGG + Intronic
1196707358 X:118727738-118727760 CGGCCGCCCCTCGGGCCCCGAGG - Intronic