ID: 1141133755

View in Genome Browser
Species Human (GRCh38)
Location 16:81452414-81452436
Sequence CTAGGCACTCGGAAGAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141133750_1141133755 6 Left 1141133750 16:81452385-81452407 CCTCCATTCAGCAGTTAAGTGTC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 1141133755 16:81452414-81452436 CTAGGCACTCGGAAGAAAACAGG 0: 1
1: 0
2: 0
3: 10
4: 104
1141133751_1141133755 3 Left 1141133751 16:81452388-81452410 CCATTCAGCAGTTAAGTGTCACC No data
Right 1141133755 16:81452414-81452436 CTAGGCACTCGGAAGAAAACAGG 0: 1
1: 0
2: 0
3: 10
4: 104
1141133749_1141133755 24 Left 1141133749 16:81452367-81452389 CCTGGCGGTGCTTTCATGCCTCC 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1141133755 16:81452414-81452436 CTAGGCACTCGGAAGAAAACAGG 0: 1
1: 0
2: 0
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141133755 Original CRISPR CTAGGCACTCGGAAGAAAAC AGG Intronic