ID: 1141134880

View in Genome Browser
Species Human (GRCh38)
Location 16:81458591-81458613
Sequence ACAGTGTGCGGGTTTCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141134880_1141134883 -2 Left 1141134880 16:81458591-81458613 CCACTTTGAAACCCGCACACTGT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1141134883 16:81458612-81458634 GTTTCCCCATTACGTCTTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 56
1141134880_1141134890 8 Left 1141134880 16:81458591-81458613 CCACTTTGAAACCCGCACACTGT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1141134890 16:81458622-81458644 TACGTCTTGCAGGGAGGTGGAGG 0: 1
1: 0
2: 1
3: 23
4: 696
1141134880_1141134886 2 Left 1141134880 16:81458591-81458613 CCACTTTGAAACCCGCACACTGT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1141134886 16:81458616-81458638 CCCCATTACGTCTTGCAGGGAGG 0: 1
1: 0
2: 1
3: 2
4: 46
1141134880_1141134889 5 Left 1141134880 16:81458591-81458613 CCACTTTGAAACCCGCACACTGT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1141134889 16:81458619-81458641 CATTACGTCTTGCAGGGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 92
1141134880_1141134884 -1 Left 1141134880 16:81458591-81458613 CCACTTTGAAACCCGCACACTGT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1141134884 16:81458613-81458635 TTTCCCCATTACGTCTTGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141134880 Original CRISPR ACAGTGTGCGGGTTTCAAAG TGG (reversed) Intronic