ID: 1141135441

View in Genome Browser
Species Human (GRCh38)
Location 16:81461887-81461909
Sequence AACATTCAGCAGTATGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 1, 2: 3, 3: 16, 4: 313}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141135433_1141135441 28 Left 1141135433 16:81461836-81461858 CCATCCCTACATCCCAGGATTGT 0: 1
1: 0
2: 2
3: 23
4: 296
Right 1141135441 16:81461887-81461909 AACATTCAGCAGTATGTGCTGGG 0: 1
1: 1
2: 3
3: 16
4: 313
1141135434_1141135441 24 Left 1141135434 16:81461840-81461862 CCCTACATCCCAGGATTGTGAGA 0: 1
1: 0
2: 0
3: 24
4: 279
Right 1141135441 16:81461887-81461909 AACATTCAGCAGTATGTGCTGGG 0: 1
1: 1
2: 3
3: 16
4: 313
1141135432_1141135441 29 Left 1141135432 16:81461835-81461857 CCCATCCCTACATCCCAGGATTG 0: 1
1: 0
2: 1
3: 23
4: 192
Right 1141135441 16:81461887-81461909 AACATTCAGCAGTATGTGCTGGG 0: 1
1: 1
2: 3
3: 16
4: 313
1141135436_1141135441 16 Left 1141135436 16:81461848-81461870 CCCAGGATTGTGAGAGTAAATGA 0: 1
1: 0
2: 0
3: 16
4: 206
Right 1141135441 16:81461887-81461909 AACATTCAGCAGTATGTGCTGGG 0: 1
1: 1
2: 3
3: 16
4: 313
1141135435_1141135441 23 Left 1141135435 16:81461841-81461863 CCTACATCCCAGGATTGTGAGAG No data
Right 1141135441 16:81461887-81461909 AACATTCAGCAGTATGTGCTGGG 0: 1
1: 1
2: 3
3: 16
4: 313
1141135437_1141135441 15 Left 1141135437 16:81461849-81461871 CCAGGATTGTGAGAGTAAATGAC 0: 1
1: 0
2: 3
3: 15
4: 140
Right 1141135441 16:81461887-81461909 AACATTCAGCAGTATGTGCTGGG 0: 1
1: 1
2: 3
3: 16
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141135441 Original CRISPR AACATTCAGCAGTATGTGCT GGG Intronic
900771317 1:4547068-4547090 AACAATTAGCAGTATTAGCTGGG + Intergenic
900832558 1:4975576-4975598 AATATATAGCAGTCTGTGCTGGG + Intergenic
903102251 1:21040872-21040894 AACACTCAGCAGTCTATGATTGG - Intronic
905743026 1:40388669-40388691 ACCAATCAGCAGGATGTGATTGG + Intronic
905807736 1:40888995-40889017 AACATTCAGAAGAATTTACTGGG - Intergenic
908116799 1:60948721-60948743 TACTTTCAACAGTCTGTGCTGGG - Intronic
908444639 1:64189399-64189421 AACATTTGGCAGCATGTGGTTGG + Intergenic
908730255 1:67219069-67219091 AACATAAAGCAGTATGGGCTGGG + Intronic
909210660 1:72818342-72818364 AACATTCAGCAGTCTATGAGTGG + Intergenic
909313194 1:74180376-74180398 TAAATTCAGGAGTATTTGCTTGG - Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
911903740 1:103538603-103538625 AAAATTCAGCATTAGGTTCTTGG - Intronic
913347011 1:117819217-117819239 AACATTTGGCAGCATGTGGTTGG - Intergenic
915218601 1:154356165-154356187 AACATGCAGCAGTTTGGGCCTGG + Intergenic
916545513 1:165800539-165800561 AACATTCAGCAGTGTATGAGTGG - Intronic
917385803 1:174472569-174472591 AAGATTCGGAAGTATGTGCCTGG - Intronic
918465524 1:184817887-184817909 AACATTCAGCAGTCTATGAGTGG - Intronic
918791906 1:188840700-188840722 AACAATCAGCAGGATGTGGGTGG - Intergenic
919108724 1:193189894-193189916 TACATTCAACAATATGTCCTTGG + Intronic
919239776 1:194898364-194898386 AACACTCAGCAGTGTATGATTGG + Intergenic
919377270 1:196809596-196809618 ACCAATCAGCAGGATGTGCGTGG + Intergenic
921094276 1:211873757-211873779 AACAATCAGCAGGATGTGGGTGG - Intergenic
921664658 1:217854141-217854163 AACACTCAGCAGTATGTGAGTGG + Intronic
923657796 1:235933260-235933282 AACATGCAGAATGATGTGCTGGG + Intergenic
923887473 1:238175289-238175311 AACATTCAGCAGTCTATGAGTGG - Intergenic
923956496 1:239028390-239028412 AACAGTCAGAGGTATGTGCCAGG - Intergenic
1063320906 10:5052431-5052453 AACAATCAGCAGGATGTGGGTGG - Intronic
1063322079 10:5060298-5060320 AACAATCAGCAGGATGTGGGTGG - Intronic
1063478776 10:6351890-6351912 AAAATGCTGCAGTTTGTGCTTGG + Intergenic
1063479909 10:6366292-6366314 AACATTCAGCAGTCTATGAGTGG - Intergenic
1065334517 10:24642575-24642597 AGCATTCTGCACTATGTGATCGG + Intronic
1065389064 10:25163646-25163668 ACCAATCAGCAGGATGTGGTCGG - Intergenic
1067486444 10:46655043-46655065 AACACTCAACATTACGTGCTGGG + Intergenic
1067750333 10:48967508-48967530 AATAATCACCACTATGTGCTGGG - Intronic
1068465427 10:57383924-57383946 AACATTCATCATTATGTATTTGG - Intergenic
1068574251 10:58666267-58666289 AACATTCAGCAGACTGTGAGTGG + Intronic
1068624684 10:59229780-59229802 AACACTCAGCAGTGTGTGAGTGG + Intronic
1068792390 10:61041365-61041387 AACAATCAGCAGGATGTGGGTGG + Intergenic
1069275016 10:66579335-66579357 AAGAATCAGTAGTATTTGCTTGG + Intronic
1071433563 10:85625736-85625758 AACATTTAGCAGAATATGATTGG + Intronic
1071623893 10:87148252-87148274 AACATTCAACATTACGTGCTGGG - Intronic
1072636488 10:97181705-97181727 GACAAGCAGCAGAATGTGCTGGG + Intronic
1072636709 10:97183016-97183038 GACAAGCAGCAGAATGTGCTGGG + Intronic
1074461542 10:113642643-113642665 AGCATTCATCACTATGAGCTGGG + Intronic
1077884409 11:6375634-6375656 AACACTCAGCAGTCTGTGAGTGG + Intergenic
1080107376 11:28525264-28525286 ACCAATCAGCAGGATGTGCGTGG - Intergenic
1080689065 11:34540654-34540676 AATATTCAGAAGCATGTTCTAGG - Intergenic
1080820394 11:35800393-35800415 AACAATCAGCAGGATGTGGGTGG - Intronic
1082143093 11:48632649-48632671 AACTTTGAGGAGTATTTGCTAGG - Intergenic
1082570291 11:54730012-54730034 AACTATGAGCAGTATTTGCTAGG - Intergenic
1082698259 11:56397524-56397546 AACATTCAGCAGTCTATGAGTGG + Intergenic
1086491666 11:87362387-87362409 AACATTTAGCAGCATGTGGTTGG + Intergenic
1087513331 11:99126537-99126559 GACATTCAGCAGTCACTGCTTGG - Intronic
1087525036 11:99298402-99298424 AACATTCTGCAGTCTGTGAGTGG + Intronic
1088453473 11:110008132-110008154 CTCATGCAGCACTATGTGCTAGG + Intergenic
1088728591 11:112660764-112660786 AACTTCCAGCTGTGTGTGCTTGG - Intergenic
1089597420 11:119589686-119589708 AACATGCACCTGTATGTGCAGGG - Intergenic
1090875372 11:130784305-130784327 TACATTCTTCAGTATGTGCAGGG - Intergenic
1090993411 11:131841369-131841391 AATGTTCAGCACTGTGTGCTAGG + Intronic
1091038906 11:132258148-132258170 AACATTCAGCTTAATGAGCTGGG + Intronic
1091258796 11:134217209-134217231 AACATTTAGCAGTAGGAGCCAGG - Intronic
1092336799 12:7640585-7640607 ACCAATCAGCAGGATGTGGTTGG + Intergenic
1092430563 12:8405006-8405028 ACCAATCAGCAGGATGTGCGTGG + Intergenic
1092616997 12:10224973-10224995 ACCAATCAGCAGGATGTGGTTGG - Intergenic
1097664076 12:62460858-62460880 AACAATCAGCAGGATGTGGGTGG - Intergenic
1098922275 12:76313403-76313425 GCCTTTCAGCAGTTTGTGCTGGG - Intergenic
1100073189 12:90746758-90746780 ACCAATCAGCAGAATGTGGTTGG + Intergenic
1100672634 12:96833966-96833988 AAAATTTAGCAGAATGTGCAAGG + Intronic
1101368528 12:104100940-104100962 AGCATTCAGCAGTGTGATCTTGG + Intronic
1104310442 12:127649968-127649990 AACACTCAGCAGTATATGACTGG - Intergenic
1104792226 12:131490808-131490830 AACATTCCCCAGCATGTGGTAGG + Intergenic
1107335600 13:39351765-39351787 AACACTCAGCAGTATATGAGTGG - Intronic
1108495802 13:51024270-51024292 AACATTCAGAAGTACGTACCAGG - Intergenic
1108572660 13:51766638-51766660 AATATTCAGCAGCATTTGATTGG - Exonic
1108810111 13:54212117-54212139 AACATTCAGCAGTATAAGAGTGG + Intergenic
1108855428 13:54787349-54787371 AACAATCAGCAGGATGTGGGAGG - Intergenic
1109608898 13:64737748-64737770 AACATTCAGCAGTATATGACTGG - Intergenic
1109768552 13:66937709-66937731 AACATTCAGCAGTCTATGAGTGG - Intronic
1109884482 13:68524633-68524655 ACCAATCAGCAGGATGTGCGTGG + Intergenic
1110999721 13:82164580-82164602 AACAATCAGCAGGATGTGGGTGG - Intergenic
1111522815 13:89427788-89427810 AAAAATAAGCAGTATGGGCTGGG + Intergenic
1111612062 13:90617306-90617328 AACATTTGGCAGCATGTGGTTGG - Intergenic
1113304923 13:109067280-109067302 AACATTTATCAGTATTTACTAGG + Intronic
1113336824 13:109384537-109384559 AACACTCAGCAGTCTGTGAGTGG - Intergenic
1113583353 13:111444998-111445020 GACAATCAGCAGTATTTACTTGG - Intergenic
1114846883 14:26333147-26333169 AAAGTTAAGCAGTTTGTGCTGGG - Intergenic
1115268500 14:31526575-31526597 ACCATTCAGCAGGATGTGGGTGG - Intronic
1115741005 14:36388233-36388255 TACATTCAGAAGTAGTTGCTGGG - Intergenic
1116522168 14:45862814-45862836 AACATTTAGCAGTCTGTGAGTGG + Intergenic
1118379049 14:65202965-65202987 AACAATCAGCAGGATGTGGGCGG + Intergenic
1119244315 14:73090422-73090444 TACATGCAGTAGTATGTGCAGGG - Intronic
1121250157 14:92493365-92493387 CACATTCTGCAGAATGTTCTAGG + Intronic
1202840061 14_GL000009v2_random:113551-113573 AACACTCAGCAGTGTGTGAGTGG - Intergenic
1202909445 14_GL000194v1_random:103748-103770 AACACTCAGCAGTGTGTGAGTGG - Intergenic
1123970441 15:25503511-25503533 AACAATCAGCAGGATGTGGGTGG - Intergenic
1124031812 15:26018856-26018878 AACACTCAGCAGTCTGTGAGTGG + Intergenic
1125851144 15:42904036-42904058 AACAATCATCAGAATGAGCTTGG + Intronic
1128592286 15:68911044-68911066 CACATTCAGCAGTTTGTTCTAGG - Intronic
1131797989 15:96039713-96039735 AACATTCACCAATACTTGCTTGG + Intergenic
1131949287 15:97663382-97663404 ACCAATCAGCAGTATGTGGGTGG + Intergenic
1132029287 15:98427272-98427294 AACATCCAACAGAACGTGCTGGG - Intergenic
1137865309 16:51889058-51889080 AACATTCAGTATGATGTGCTGGG - Intergenic
1140852693 16:78949556-78949578 GACATACAGCATTATGTGTTGGG - Intronic
1141135441 16:81461887-81461909 AACATTCAGCAGTATGTGCTGGG + Intronic
1143127863 17:4656103-4656125 ACCAATCAGCAGTATGTGGGTGG - Intergenic
1144992059 17:19239766-19239788 AACTTCCAGCAGTGTGTGTTGGG + Intronic
1146413335 17:32608750-32608772 AATATCCAGCAGCATGTGCACGG + Intronic
1148735907 17:49864763-49864785 TTGATTCAGCACTATGTGCTGGG + Intergenic
1149107020 17:52981713-52981735 AACATTCAACATCATGAGCTAGG + Intergenic
1149181704 17:53946210-53946232 AACATTCAGCAGAGTGTTGTTGG - Intergenic
1150767896 17:68016741-68016763 AACATTCAGCACTAAGTGCTCGG + Intergenic
1152130678 17:78474414-78474436 AACCCTCAGCAGTGTGTGTTGGG + Intronic
1153112644 18:1610591-1610613 AACATTCAGCAGTCTATGAGTGG + Intergenic
1155425287 18:25700612-25700634 AACATTCAGCAGGTCGGGCTTGG - Intergenic
1155806170 18:30174582-30174604 ACCAGTCAGCAGGATGTGGTGGG - Intergenic
1156608416 18:38696794-38696816 AACATACAGCAGTATGAACAGGG + Intergenic
1158597291 18:58827626-58827648 ACCAATCAGCAGTATGTGGGTGG - Intergenic
1160176471 18:76599486-76599508 ACCAATCAGCAGGATGTGCGTGG - Intergenic
1160198701 18:76778248-76778270 ACCAATCAGCAGGATGTGCGTGG + Intergenic
1162443604 19:10708586-10708608 GACTTTCAGTAGTTTGTGCTGGG - Intronic
1163398839 19:17079592-17079614 AAAATTCAGCAGTATGTGCTTGG - Intronic
1168567528 19:57437428-57437450 AACATTAAGAAGTGTGGGCTGGG + Intronic
1202632983 1_KI270706v1_random:17008-17030 AACACTCAGCAGTGTGTGAGTGG + Intergenic
1202652892 1_KI270707v1_random:23042-23064 AACACTCAGCAGTGTGTGAGTGG - Intergenic
926522175 2:13928909-13928931 AACATTCAGCAGTGTATGAATGG - Intergenic
927289287 2:21388854-21388876 AACATGCAGGAGTCTGTGATGGG + Intergenic
927420499 2:22925824-22925846 AACATCCAGCAGCAGGTGCAAGG - Intergenic
927777934 2:25916396-25916418 ACCAATCAGCAGGATGTGGTGGG + Intergenic
928607684 2:32958780-32958802 CACAATCAGCAGTGTCTGCTGGG - Intronic
929078815 2:38101554-38101576 AATATTCAGCAATATGGGATTGG + Intronic
929379810 2:41336316-41336338 ACCATTCAGCAGGATGTGGGTGG + Intergenic
930389965 2:50748167-50748189 AACATTCAGCAGTCTTGGTTGGG - Intronic
931444903 2:62318442-62318464 AACATTCAGCAGTCTATGAGTGG + Intergenic
933875623 2:86618528-86618550 AATAGTTAGCAGTATGTTCTTGG - Intronic
935062638 2:99621791-99621813 AACACTGAGCAGGATTTGCTAGG + Intronic
935652768 2:105396519-105396541 AACATTCAGTCATATGTTCTGGG - Intronic
935680295 2:105630245-105630267 AACACTCAGCAGTGTGTGAATGG + Intergenic
936540756 2:113349015-113349037 AACATGAAGCAGTATGTGAGAGG + Intergenic
937533072 2:122853623-122853645 CACATCCATCTGTATGTGCTTGG + Intergenic
939912084 2:147995398-147995420 ACCAATCAGCAGGATGTGCGTGG + Intronic
940176379 2:150881725-150881747 AACATTCAGCAGTCTATGAGAGG - Intergenic
940777398 2:157899216-157899238 AACATAGAGCAGTGTGTGGTTGG - Intronic
942649613 2:178153371-178153393 AAGATACAGCACTCTGTGCTTGG - Intergenic
943024341 2:182609306-182609328 ACCAATCAGCAGGATGTGCGTGG + Intergenic
943319992 2:186434190-186434212 AACATTTGGCAGCATGTGGTTGG + Intergenic
943547879 2:189303706-189303728 AACATTCAGCAGTCTATGAGTGG - Intergenic
943869313 2:192973892-192973914 AACATTCAGCAGTCTATGAGTGG - Intergenic
944864437 2:203846923-203846945 AACATTTAGCAATTTGTGCCAGG - Intergenic
945738421 2:213630505-213630527 AACATTTATCAGTGTGGGCTGGG + Intronic
946163417 2:217849319-217849341 AACACTGAGCAGGAAGTGCTGGG + Intronic
947150190 2:227107693-227107715 AACATCCAGCAGTAGGTGAGTGG - Intronic
947591523 2:231388710-231388732 AATATGTGGCAGTATGTGCTGGG + Intergenic
947842988 2:233220568-233220590 CACATTCCACAGGATGTGCTGGG - Intronic
1170520059 20:17175755-17175777 AACATTTAGGAGGATATGCTTGG - Intergenic
1170935996 20:20810206-20810228 AACACTCAGCAGTGTGTGACTGG - Intergenic
1172190065 20:33056568-33056590 CCCATTCTGCAGAATGTGCTGGG + Exonic
1173381414 20:42546358-42546380 AACACTCAGCAGTGTATGATTGG + Intronic
1174111204 20:48199081-48199103 TAAATTCAGCAACATGTGCTGGG + Intergenic
1175285179 20:57833123-57833145 AAGATTCAGCTGGATGTGCGGGG + Intergenic
1176105863 20:63386279-63386301 AGCATCCAGCAGTGTGTGCCAGG - Intergenic
1176599260 21:8776609-8776631 AACACTCAGCAGTGTGTGAGTGG + Intergenic
1176628796 21:9118456-9118478 AACACTCAGCAGTGTGTGAGTGG - Intergenic
1177706518 21:24713351-24713373 AAATTTCAGCAGTATCTGTTGGG + Intergenic
1178624646 21:34204624-34204646 AACACTGAGCAGCATGTGCGCGG - Intergenic
1178834099 21:36081531-36081553 AAAATTCAGCAATTTGGGCTGGG + Intergenic
1179039411 21:37788830-37788852 AATAGTCAGCAGTTTGAGCTGGG - Intronic
1179319735 21:40278808-40278830 AACATTTATCACTATATGCTAGG - Intronic
1180367748 22:11956346-11956368 AACACTCAGCAGTGTGTGAGTGG - Intergenic
1180378343 22:12114988-12115010 AACACTCAGCAGTGTGTGAGTGG + Intergenic
1180419168 22:12798291-12798313 AACACTCAGCAGTGTGTGAGTGG - Intergenic
1180613559 22:17113118-17113140 TCCATTCAGCAGTTTGAGCTGGG + Exonic
1182319343 22:29468216-29468238 AGCAATCAGCAGTAACTGCTTGG - Intergenic
1182479504 22:30597777-30597799 ACCAATCAGCAGTATGTGGGTGG + Intronic
1184803980 22:46780525-46780547 AACATTCTGCAGGATCTGCCAGG + Intronic
949962449 3:9324104-9324126 AACATTCAGCAGTCTATGAGTGG + Intronic
951250487 3:20388488-20388510 AACATTCAGCAGTCTATGAGTGG - Intergenic
953449332 3:42992970-42992992 AACATTCAGCAGTCTATGAGTGG + Intronic
955612221 3:60769709-60769731 AACATTCAGCAGTCTATGTGTGG + Intronic
957095115 3:75771156-75771178 AACACTCAGCAGTGTGTGAGTGG - Intronic
957715284 3:83921094-83921116 AACAATCAGCAAAAAGTGCTTGG + Intergenic
957829913 3:85504479-85504501 ACCAATCAGCAGGATGTGGTGGG - Intronic
959102900 3:102033752-102033774 AATATTCAGCAGCATATTCTGGG + Intergenic
959157188 3:102681098-102681120 TTCATGTAGCAGTATGTGCTAGG + Intergenic
959503928 3:107137271-107137293 AACACTCAGCAGTGTGTGCGTGG - Intergenic
960053059 3:113255689-113255711 ACCATTCAGGAGTATATGCCTGG - Intronic
960184882 3:114626145-114626167 AACATTTAGGAATATGTGGTGGG - Intronic
961780598 3:129318100-129318122 AACAGCCAGCTGTGTGTGCTGGG + Intergenic
961956903 3:130814158-130814180 ACCAATCAGCAGTATGTGGGTGG - Intergenic
963034908 3:141017568-141017590 AGCAATCAGCAGGATGTGGTCGG + Intergenic
965677888 3:171218149-171218171 AACATTAAGCAATATGTCCAGGG + Intronic
965922623 3:173936799-173936821 AGCATTCATCATTATGTGTTAGG + Intronic
965945085 3:174231418-174231440 AACATTCAGCAGTCTATGAGTGG + Intronic
966536104 3:181035967-181035989 AACACTCAGCAGTGTATGCATGG + Intergenic
966745794 3:183275763-183275785 AACATTTAGCGGGATGTGGTGGG - Intronic
967191211 3:186986339-186986361 AATATTCAACACTATGTGCCAGG - Intronic
967529380 3:190531553-190531575 AACATTCAGGAGTATGTGCCGGG - Intronic
967685481 3:192411041-192411063 AACATACACCTGTCTGTGCTTGG - Intronic
967718479 3:192789794-192789816 ACCAATCAGCAGGATGTGCGTGG + Intergenic
1202741687 3_GL000221v1_random:62180-62202 AACACTCAGCAGTGTGTGAGTGG - Intergenic
969673230 4:8601231-8601253 AACGCTCAGCAGGATGTACTCGG - Exonic
970542319 4:17092546-17092568 TTCAATCAGCACTATGTGCTGGG + Intergenic
971250148 4:24967782-24967804 AACATTTGGCAGCATGTGGTTGG + Intronic
971288868 4:25317074-25317096 GACATTGTACAGTATGTGCTGGG + Intronic
972232974 4:37096840-37096862 TCCATTCAGGAGTTTGTGCTTGG + Intergenic
972505679 4:39718124-39718146 ACCAATCAGCAGGATGTGCGTGG - Intronic
973362623 4:49178982-49179004 AACACTCAGCAGTGTGTGAGTGG + Intergenic
973398480 4:49617871-49617893 AACACTCAGCAGTGTGTGAGTGG - Intergenic
973814389 4:54605417-54605439 AACATTCAGCAGTCTATGAGTGG + Intergenic
974536777 4:63184751-63184773 ATCAATCAGCAGGATGTGATTGG + Intergenic
976560277 4:86493060-86493082 AACATTCAGCAGTCTATGAATGG - Intronic
976862309 4:89680059-89680081 ACCAATCAGCAGGATGTGATTGG - Intergenic
977220353 4:94331076-94331098 AACACTCAGCAGTATATGAGTGG + Intronic
978207067 4:106091847-106091869 ACCAATCAGCAGGATGTGGTTGG - Intronic
978255138 4:106684002-106684024 AACACTCAGCAGTATATGAGTGG - Intergenic
978971945 4:114819134-114819156 AAGATAGAGCAGTATGTGGTGGG - Intergenic
979678479 4:123434855-123434877 ACCAATCAGCAGGATGTGCGTGG - Intergenic
980746345 4:137021970-137021992 AAGATCCAGGAATATGTGCTAGG - Intergenic
981234048 4:142393736-142393758 AACACTCAGCAGTGTATGATTGG - Intronic
981368796 4:143934193-143934215 AACATTTAGAAGTATAGGCTGGG + Intergenic
983063990 4:163189517-163189539 ACCAATCAGCAGGATGTGCCTGG - Intergenic
984316716 4:178139236-178139258 AACATTTGGCAGTATGCGGTTGG + Intergenic
1202759963 4_GL000008v2_random:100454-100476 AACACTCAGCAGTGTGTGAGTGG + Intergenic
986335732 5:6754040-6754062 AGCATGCAGCAGCCTGTGCTTGG - Intronic
987673495 5:21044937-21044959 ACCAATCAGCAGTATGTGGGCGG - Intergenic
988279404 5:29126898-29126920 AACAATCAGCAGGATGTGGGTGG - Intergenic
988359806 5:30221385-30221407 AATATTCACCTGTATCTGCTCGG - Intergenic
988398216 5:30725072-30725094 TACATTCTGCATTCTGTGCTGGG + Intergenic
988500302 5:31778244-31778266 ACCATTCAGCAGGATGTGGGTGG + Intronic
989336688 5:40325880-40325902 AACATTCAGCAGTCTGTGAGTGG + Intergenic
989337255 5:40332234-40332256 AACATTCAGCAGTCTATGAGTGG + Intergenic
990024727 5:51172685-51172707 AACAATTTACAGTATGTGCTGGG - Intergenic
990388662 5:55295150-55295172 ATGATTCTGCAGTCTGTGCTGGG - Intronic
990847585 5:60160976-60160998 AAAATTCATCATGATGTGCTGGG + Intronic
991140432 5:63234604-63234626 ATCACTCAGCAGTATTTACTGGG - Intergenic
993037749 5:82775652-82775674 AACACTCAGCAGGCTGTGTTGGG + Intergenic
994661125 5:102655733-102655755 AACATTCAGCAGTCTATGAGTGG + Intergenic
994669845 5:102752841-102752863 ACCAATCAGCAGGATGTGCGTGG + Intergenic
994796427 5:104306595-104306617 AACCTTCAGCACAATGTGGTAGG + Intergenic
995278030 5:110300100-110300122 ACAATTCTGCAATATGTGCTGGG + Intronic
996680023 5:126221499-126221521 ACCAATCAGCAGGATGTGCGTGG + Intergenic
998988284 5:147786527-147786549 AACATCCAGAAAAATGTGCTAGG - Intergenic
1000084858 5:157880057-157880079 ACCATTCAGCAGGATGTGGGTGG + Intergenic
1000547762 5:162622917-162622939 ACCAATCAGCAGGATGTGCGTGG + Intergenic
1003714891 6:8635326-8635348 AACATTCAGCAACATGTGAAAGG + Intergenic
1004122355 6:12836647-12836669 CACATTCAGCATTAATTGCTAGG + Intronic
1004235400 6:13871255-13871277 ACCAATCAGCAGTATGTGGATGG - Intergenic
1004618293 6:17311179-17311201 AGTATTCATCATTATGTGCTGGG + Intergenic
1005935606 6:30518586-30518608 AACAATCAGCAGGATGTGGGTGG + Intergenic
1006819947 6:36885235-36885257 AACATTCAGCAGGCTGTGAGTGG - Intronic
1008856995 6:56100496-56100518 ACATTTCAGCAGTATGAGCTTGG - Intronic
1011863089 6:91785319-91785341 ACCAATCAGCAGTATGTGGGTGG - Intergenic
1012628011 6:101427969-101427991 AACCTTCAGATGTATGTACTCGG + Intronic
1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG + Intronic
1014389170 6:120839685-120839707 AACATTGATCAGTATGAGATTGG + Intergenic
1014551272 6:122791485-122791507 AACACTCAGCAGTATATGAATGG - Intronic
1016383632 6:143511074-143511096 GACATTCATCAGTTTGTGCAGGG - Intronic
1017100920 6:150849272-150849294 ACCAATCAGCAGGATGTGGTGGG + Intergenic
1019127841 6:169852695-169852717 ATCAGTCAGCAGAATATGCTAGG - Intergenic
1019295882 7:274368-274390 AACACTCAGCAGTGTGTGAGTGG - Intergenic
1020399608 7:7760580-7760602 TACATTCAGTAGTATATTCTGGG - Intronic
1020646776 7:10824238-10824260 AACACTCAGCAGTATATGAGTGG - Intergenic
1020924201 7:14303816-14303838 AAAACTCAGCAGCAAGTGCTGGG - Intronic
1021308528 7:19062358-19062380 AAAGTTCTGCAGAATGTGCTGGG + Intronic
1021378048 7:19932976-19932998 AACATTTAGCAGTATTTACCAGG - Intergenic
1021786031 7:24153544-24153566 AACACTCAGCAGTATATGAATGG - Intergenic
1024222345 7:47298648-47298670 AACATGAACCAGTAAGTGCTGGG + Intronic
1024408334 7:49008771-49008793 AGCATTTAGAAATATGTGCTAGG - Intergenic
1024536825 7:50442028-50442050 AACACTAAGCAGAATGAGCTAGG + Intergenic
1024825670 7:53386897-53386919 AACATTCAGCAGTCTATGAGTGG + Intergenic
1027960611 7:84940948-84940970 AACATTCAGCAGTCTATGAGTGG - Intergenic
1029352304 7:100022823-100022845 AACATTCAGCTCTCTGGGCTGGG + Intronic
1030013467 7:105194994-105195016 AAATGTCAGCAGTATGTGGTAGG - Intronic
1030118470 7:106082636-106082658 AACACTCAGCAGTATGTGAGTGG + Intergenic
1030731968 7:113000852-113000874 AACTCTAAGCAGTATGTGCAAGG - Intergenic
1030855317 7:114548734-114548756 AACATTCAGCAGTAACTTCCTGG - Intronic
1031198409 7:118646251-118646273 AACACTCAGCAGTGTGTGAGTGG + Intergenic
1033880104 7:145870733-145870755 AACATTTAGAAATATGTTCTTGG + Intergenic
1034216857 7:149414356-149414378 AAGATTCAGCAGGATGTCGTTGG + Intergenic
1034592052 7:152149274-152149296 GAGAGTCAGCAGTAAGTGCTGGG + Intronic
1034967001 7:155397947-155397969 ACCAATCAGCAGTATGTGGGTGG - Intergenic
1035246664 7:157566774-157566796 AACATGGAGAAGTATGTCCTGGG - Intronic
1035915920 8:3622083-3622105 CACAGTCTGCACTATGTGCTGGG + Intronic
1036203549 8:6788791-6788813 AACACTCAGCAGTGTATGGTTGG - Intergenic
1036378372 8:8219625-8219647 AACAATCAGCAGGATGTGGGTGG + Intergenic
1037142401 8:15534885-15534907 AACATTCAGCAGTCTGTGAGTGG + Intronic
1041551384 8:59105448-59105470 AAAATTCAGCTCTATGTGCGGGG - Intronic
1041848800 8:62362902-62362924 AACACTCAGCAGTGTGTGACTGG + Intronic
1042804136 8:72753877-72753899 CACATTAAGCAATATGTTCTTGG + Intronic
1043421534 8:80103460-80103482 AGCATTCAGCAGTTTGTGAATGG - Intronic
1043512394 8:80962396-80962418 AACATTCAGCAGTCTATGAGTGG + Intergenic
1044853672 8:96453006-96453028 ACCAATCAGCAGTATGTGGGTGG + Intergenic
1044993628 8:97818332-97818354 ACCATTCAACACTATGTGTTTGG - Intronic
1045933599 8:107654595-107654617 AACATTCAGCAGTGTATGACTGG + Intergenic
1046035187 8:108832290-108832312 AACATTCAGCAGTCTATGAGTGG - Intergenic
1046579469 8:116073807-116073829 AACACTCAGCAGTCTGTGAGTGG - Intergenic
1047273937 8:123390674-123390696 AACATTCTGCAGTATGTAGAAGG - Intronic
1047545180 8:125809638-125809660 AACATTCAGCAGTCTATGAGTGG - Intergenic
1047546969 8:125827598-125827620 AACATTCAGCAATATTCACTAGG + Intergenic
1047901657 8:129429762-129429784 AACATTCAGCAGTCTATGAGTGG - Intergenic
1049254784 8:141607985-141608007 AACATTCAGCCGTTAGTGCCCGG - Intergenic
1050783188 9:9365094-9365116 AACACTGAGTAATATGTGCTGGG + Intronic
1051050479 9:12926880-12926902 AACATTCAGCAGTGTATGACTGG + Intergenic
1051817522 9:21127142-21127164 AACAATCAACAGTATATGCGTGG - Intergenic
1055885986 9:81063596-81063618 GACAGATAGCAGTATGTGCTGGG + Intergenic
1055979247 9:81985717-81985739 AACATTCAGCAGTCTGTGAGTGG + Intergenic
1059437409 9:114284961-114284983 CACATTCAGCACTATGTGCTGGG + Intronic
1059571086 9:115436599-115436621 AACACTCAGCAGTGTATGCGTGG - Intergenic
1203691751 Un_GL000214v1:48669-48691 AACACTCAGCAGTGTGTGAGTGG + Intergenic
1203540736 Un_KI270743v1:85348-85370 AACACTCAGCAGTGTGTGAGTGG + Intergenic
1203644544 Un_KI270751v1:55522-55544 AACACTCAGCAGTGTGTGAGTGG - Intergenic
1185892532 X:3834204-3834226 CACATACAGCAGGGTGTGCTGGG + Intronic
1185897640 X:3872624-3872646 CACATACAGCAGGGTGTGCTGGG + Intergenic
1185902759 X:3911055-3911077 CACATACAGCAGGGTGTGCTGGG + Intergenic
1187664889 X:21595924-21595946 AACATGAAGCAGAATGTGGTAGG - Intronic
1188220184 X:27531824-27531846 TACATTCAGGGATATGTGCTAGG + Intergenic
1188782210 X:34299503-34299525 GAAATTCAGCAGTATGGGTTTGG + Intergenic
1192763481 X:74120082-74120104 AACACTCAGCAGTATATGAATGG + Intergenic
1193602038 X:83519138-83519160 AAGACTCAGCAGCAGGTGCTAGG + Intergenic
1193979554 X:88165064-88165086 AACATTCAGCAGTCTGTGAGTGG - Intergenic
1194056159 X:89134897-89134919 AACATTCAGCAGTCTATGAGTGG - Intergenic
1194066632 X:89269527-89269549 AACAATCAGCAGGATGTGGGTGG - Intergenic
1195643026 X:107198330-107198352 AACAATCAGCAGGATGTGGGTGG + Intronic
1195993160 X:110703326-110703348 AACATACAGAATTAAGTGCTTGG + Intronic
1196186775 X:112752515-112752537 AACATTCAGCAGTCTTTGAGTGG + Intergenic
1197432292 X:126381356-126381378 AACATTCCTCAGTATTTTCTAGG - Intergenic
1198717928 X:139581720-139581742 GACATGAAGCAGTATGTGATGGG + Intergenic
1199454428 X:148011784-148011806 AAAATTAAGCTGTATCTGCTAGG - Intronic
1199552730 X:149076339-149076361 AACATTTAGCAGCATGTGGTTGG + Intergenic
1199718752 X:150526787-150526809 AACACTCACCATTATGTGTTGGG + Intergenic
1201165298 Y:11203757-11203779 AACATTCAGCAGTGTGTGAGTGG - Intergenic
1201269231 Y:12238429-12238451 AACACTCAGCAGTCTGTGAGTGG + Intergenic
1201485873 Y:14494044-14494066 ACCAATCAGCAGGATGTGGTTGG - Intergenic
1201595788 Y:15667355-15667377 ACCAATCAGCAGTATGTGGGTGG + Intergenic
1201616678 Y:15908290-15908312 AATATTCAACACTATGGGCTTGG - Intergenic