ID: 1141137006

View in Genome Browser
Species Human (GRCh38)
Location 16:81473022-81473044
Sequence CTGAGGGTATGCAGAGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 542
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 486}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141137006_1141137011 -2 Left 1141137006 16:81473022-81473044 CCATCTCCTCTGCATACCCTCAG 0: 1
1: 0
2: 5
3: 50
4: 486
Right 1141137011 16:81473043-81473065 AGCATCCTGATCTATAAAATGGG No data
1141137006_1141137010 -3 Left 1141137006 16:81473022-81473044 CCATCTCCTCTGCATACCCTCAG 0: 1
1: 0
2: 5
3: 50
4: 486
Right 1141137010 16:81473042-81473064 CAGCATCCTGATCTATAAAATGG 0: 1
1: 3
2: 80
3: 852
4: 4292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141137006 Original CRISPR CTGAGGGTATGCAGAGGAGA TGG (reversed) Intronic
900407352 1:2498500-2498522 CTGAGGGGATGCCGGGGAGGTGG - Intronic
900760535 1:4467353-4467375 CAGAGGGGCTGCAGGGGAGAAGG + Intergenic
900903314 1:5532224-5532246 TTAAAGGTTTGCAGAGGAGACGG + Intergenic
900954959 1:5881097-5881119 CTGAGGGTAGGCAGGAGTGAAGG - Intronic
901124450 1:6919238-6919260 CTGAGGGGATAGAGAGGTGAAGG - Intronic
902334827 1:15748767-15748789 CAGAGGGTAGGCAGAGGAGCTGG - Intergenic
902864452 1:19269146-19269168 CTGAAGGAATGCAGGGGAGTAGG + Intergenic
903279914 1:22244577-22244599 CTCAGGGTGTGCAGAGAAGCAGG - Intergenic
903423918 1:23238902-23238924 CTGAGGGCAGGCAGCAGAGACGG - Intergenic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
903763006 1:25712372-25712394 GGGAGGGTCTGGAGAGGAGATGG + Intronic
904354551 1:29930660-29930682 CTGGGGGTGGGCAGAGGAGGGGG - Intergenic
904877818 1:33670151-33670173 CTGAGGGGATGGGGAGGACAAGG - Intronic
905345729 1:37309819-37309841 CAAAGGGTAGGGAGAGGAGAGGG - Intergenic
905798579 1:40829405-40829427 CTGAGGGTATCAAAAGGACAGGG - Intronic
905857272 1:41322313-41322335 CTGACGGTCTGCACAGGTGAAGG + Intergenic
906561560 1:46761755-46761777 CAGAGAGAATGCAGAGGAAAAGG + Intronic
906673926 1:47679579-47679601 GAGAGGGCCTGCAGAGGAGATGG - Intergenic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
907385479 1:54122752-54122774 CAGAGGGTCTGCAGAGGAGAGGG - Intergenic
907468324 1:54654219-54654241 CTTAGGGCAGGGAGAGGAGAAGG + Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908257061 1:62311515-62311537 TGGAGGGTATGCAAAGGAGGAGG - Intronic
909938084 1:81577576-81577598 CTGCTGGTTTGCAGAGGCGAAGG - Intronic
909962649 1:81865701-81865723 CTAAAGGGAAGCAGAGGAGAGGG + Intronic
910176662 1:84438018-84438040 CTGAGGGCCTGTAAAGGAGAAGG + Intergenic
911685194 1:100767713-100767735 CTGTGAGTATGCAGAGAAAAAGG + Intergenic
911716113 1:101134967-101134989 TTGAGGGTAGACAGAGGAAAAGG - Intergenic
912419019 1:109530992-109531014 CTGAGGGTATAAATAGCAGAGGG - Intergenic
912499078 1:110110027-110110049 CAGTGGGGATGCAGAGGAGGAGG + Intergenic
912861347 1:113216583-113216605 GTGAGGATGTTCAGAGGAGAGGG + Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913567780 1:120090486-120090508 CTGAGGCAAGGCAGTGGAGATGG - Intergenic
914288528 1:146251195-146251217 CTGAGGCAAGGCAGTGGAGATGG - Intergenic
914397211 1:147281314-147281336 CAGAGACTATGCAGTGGAGAGGG - Intronic
914549563 1:148701939-148701961 CTGAGGCAAGGCAGTGGAGATGG - Intergenic
914617117 1:149369777-149369799 CTGAGGCAAGGCAGTGGAGATGG + Intergenic
915315894 1:155029127-155029149 CTGAGGATGGGAAGAGGAGAAGG + Intronic
917124733 1:171677073-171677095 CAGAGAGGAGGCAGAGGAGAGGG + Intergenic
919494308 1:198245179-198245201 CATTGGGTAGGCAGAGGAGAAGG + Intronic
920053796 1:203178785-203178807 CTGCGGCTAGGCAGAGGACATGG + Intergenic
920855204 1:209656231-209656253 GTGAGGGTGGGGAGAGGAGAAGG - Intergenic
922206789 1:223455129-223455151 CTGAGGGTATATATAGGTGAGGG + Intergenic
922368693 1:224888908-224888930 AAGAGGGGCTGCAGAGGAGAAGG - Intergenic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
922819280 1:228472841-228472863 CTGAGAGGCTGCAGAGGAGGAGG - Intergenic
923269099 1:232338656-232338678 CTGAGATTCTCCAGAGGAGAGGG + Intergenic
923340825 1:233005670-233005692 CTGAGAGAATGAAGAGGGGAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924027462 1:239850323-239850345 CTGAGTGGCTGAAGAGGAGAAGG + Intronic
924582512 1:245334608-245334630 TGGAGGGTCAGCAGAGGAGAAGG + Intronic
1062928951 10:1339959-1339981 CTGGGGGTGGGCAGTGGAGAGGG + Intronic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1065225450 10:23538920-23538942 GAGAAGGTCTGCAGAGGAGATGG - Intergenic
1067043717 10:42972242-42972264 CTGAGAGTATGCACAAGAAACGG - Intergenic
1067082155 10:43217933-43217955 CTGAGGCCATGCACAGCAGATGG + Intronic
1067278478 10:44854104-44854126 CAGTGGGCATGCAGAGGAGGTGG - Intergenic
1068829982 10:61482894-61482916 ATGAGGGTATTCAAAAGAGAAGG - Intergenic
1069890619 10:71650052-71650074 CTGAGGGTAAAGAGAGGAGCCGG + Intronic
1070438811 10:76422113-76422135 CTGAAGATATGCCAAGGAGAAGG - Intronic
1070678156 10:78429209-78429231 AAGAGGCTATGCAGAGGAGGAGG - Intergenic
1071701217 10:87939214-87939236 CTGGGGGTATGCATGGGACAGGG - Intronic
1072910762 10:99498837-99498859 CGAAGGGAATGGAGAGGAGAAGG - Intergenic
1074232403 10:111550517-111550539 CTTAGGGAAAGCAGAGGAGCAGG - Intergenic
1074327677 10:112468622-112468644 CAAAGGGTAGGCAGAGGAGAAGG - Intronic
1074364093 10:112844382-112844404 CTGAGGTCATGGAAAGGAGAAGG + Intergenic
1075529825 10:123219770-123219792 CTGGGGGATGGCAGAGGAGAGGG + Intergenic
1076398243 10:130157361-130157383 ATGGGGGTGTGCGGAGGAGAGGG + Intronic
1076771860 10:132670271-132670293 CTGGGAGTATGCAGAGGATGTGG - Intronic
1077020258 11:414114-414136 GGGAAGGTAGGCAGAGGAGAGGG - Intronic
1077020286 11:414198-414220 GGGAAGGTAGGCAGAGGAGAGGG - Intronic
1077020314 11:414282-414304 GGGAAGGTAGGCAGAGGAGAGGG - Intronic
1077025821 11:439412-439434 TTGGGGGCAGGCAGAGGAGATGG + Intronic
1077287760 11:1775373-1775395 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287770 11:1775406-1775428 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287776 11:1775428-1775450 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287803 11:1775506-1775528 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287813 11:1775539-1775561 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287831 11:1775595-1775617 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287841 11:1775628-1775650 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287847 11:1775650-1775672 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287862 11:1775695-1775717 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287928 11:1775874-1775896 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287942 11:1775918-1775940 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287969 11:1775996-1776018 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077288002 11:1776096-1776118 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077297710 11:1833915-1833937 CTGGGGGGCTGCAGAGGTGAGGG + Intronic
1077303176 11:1856422-1856444 TTGAAGGTCTGCAGAGGAGCAGG - Intronic
1077343229 11:2035285-2035307 CTGAGGGAATGCAGGCGGGATGG - Intergenic
1078004020 11:7518913-7518935 CTGAGGGTTTGAAGGGGAAAGGG + Intronic
1078067087 11:8085651-8085673 ATGAGGGCAGGAAGAGGAGAAGG + Intronic
1080829369 11:35877087-35877109 CTGAAGGTAGGAAGAGGAGCAGG + Intergenic
1083290171 11:61685561-61685583 GTGAGGGCATGCAGATGAGGTGG + Intronic
1083622418 11:64055750-64055772 CTGAGGCAGTGCAGAGGAGCAGG - Intronic
1083673623 11:64313831-64313853 CTGGGGGTATGGGGAGGAAAGGG - Intronic
1084161970 11:67355023-67355045 CAGAGGGGAGGCAGAGGAGCAGG + Intronic
1084308828 11:68304183-68304205 CTGAGGCTGTGCAGAGCAGCAGG - Intergenic
1084691345 11:70728783-70728805 CAGAGGGCATGCGTAGGAGAAGG - Intronic
1084805460 11:71575889-71575911 CAGAGGGGATGCAGTGCAGACGG + Intergenic
1085229776 11:74956182-74956204 ATGAGGGTAGACAGAGGAGAGGG - Intronic
1085339278 11:75720791-75720813 TTGAAGGCATGCAGAGGAGGAGG - Intronic
1085641800 11:78197362-78197384 GTGAGGGTCTGGAGAGGTGATGG + Intronic
1085767963 11:79300071-79300093 CTGAGGGAAGCCAGAGGAGGGGG - Intronic
1087231649 11:95672761-95672783 CTCAGGTTATGCTGAGGAGGGGG - Intergenic
1087495958 11:98890899-98890921 CTGACATTATGCAGGGGAGAAGG + Intergenic
1088135312 11:106550056-106550078 CTGAGGGTAGGCAAAGAAGAGGG - Intergenic
1088813882 11:113408813-113408835 CTGATGCTTTCCAGAGGAGATGG + Intergenic
1089016743 11:115171614-115171636 CACAGGGTATGCAAATGAGAAGG - Exonic
1089104036 11:115987308-115987330 CTGAGGGGATTCAGCAGAGAAGG + Intergenic
1089364455 11:117912675-117912697 CTAAGGGCATACAGTGGAGAGGG - Intronic
1089723830 11:120455177-120455199 CTGAGGACATGGAGAAGAGATGG + Intronic
1089895530 11:121926867-121926889 ATGAGGGTCTTCAAAGGAGAAGG + Intergenic
1090214650 11:124951115-124951137 CTGAGTGTATGCAGAGGTTGTGG - Intergenic
1091085187 11:132714893-132714915 CTGAGGGCTTGGAGAGGAAATGG + Intronic
1091140031 11:133227104-133227126 CAGAGGGTGTGCAGGGGCGAAGG - Intronic
1202826215 11_KI270721v1_random:90474-90496 CTGAGGGAATGCAGGCGGGATGG - Intergenic
1091412567 12:253763-253785 CTGAGGCTCTGAAGAGGAGTTGG + Intronic
1092073205 12:5650160-5650182 CTGAGGACACGCTGAGGAGAAGG + Intronic
1093485125 12:19643713-19643735 CTGAGGGAGTGCTGAGGAGCTGG - Intronic
1093965483 12:25320346-25320368 CAGAAGGAATACAGAGGAGACGG + Intergenic
1094317693 12:29150090-29150112 CTGGGGGTGTGCAGGGGAGCAGG + Intronic
1095646252 12:44551589-44551611 CTGAGGGTAGGCACTGAAGAAGG - Intronic
1095930435 12:47620081-47620103 CTGAGGGGAAGCAAAGGAAAGGG + Intergenic
1096184266 12:49568004-49568026 CTGAGGGTTCTCAGAGGAGTTGG - Intronic
1096403980 12:51329479-51329501 CTGTGGGTATGTGGAGGGGAGGG + Intronic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1096828059 12:54294520-54294542 CAGAGGGACTGAAGAGGAGAAGG - Intronic
1097037482 12:56133394-56133416 CTGAGGGTTGGCGGGGGAGAGGG - Intronic
1097234875 12:57532531-57532553 CTGAGGGAGTGGAAAGGAGATGG + Intronic
1098917432 12:76272156-76272178 CTGAGGGGAGGGAGAAGAGACGG - Intergenic
1099273944 12:80551300-80551322 CTGATTGTATGTAGAAGAGATGG - Intronic
1099492971 12:83308504-83308526 CTGAGGGAATGCAGTGAAAAGGG - Intergenic
1100190394 12:92184835-92184857 CTGAGGGTTGGCAGAGTGGAGGG - Intergenic
1101156763 12:101935093-101935115 TTGAGGGTATGCAGTCGAGAGGG - Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101708759 12:107245555-107245577 CTGAGAGAAGGTAGAGGAGAAGG - Intergenic
1103324988 12:120114623-120114645 CGTAGGTTGTGCAGAGGAGATGG - Intronic
1103852328 12:123941230-123941252 CTGTGGGAATGCAGAGGAACAGG - Intronic
1106605285 13:31223292-31223314 CTGGGGGAATGCAGAGGGGAAGG + Intronic
1106758525 13:32845719-32845741 CTGTGGGGAATCAGAGGAGATGG - Intergenic
1107800874 13:44107032-44107054 CTGAGGGGTGGCAGAGGAGAGGG - Intergenic
1107944843 13:45408948-45408970 GTGAGGATAGGCAGAGAAGAAGG - Exonic
1107963752 13:45580914-45580936 CTCATGGTAACCAGAGGAGAAGG - Intronic
1108323774 13:49310209-49310231 CTGAGGCCATGCTGAGGAGCTGG + Exonic
1108618974 13:52162423-52162445 GTGAGGGTAGGGAGAGGGGATGG + Intergenic
1108697049 13:52911631-52911653 TAGAGGGTATGCAGAGAAGAAGG + Intergenic
1109852042 13:68077913-68077935 TTGAGTATATGAAGAGGAGAAGG + Intergenic
1111778642 13:92694102-92694124 CTGCAGGTATGCAGAAGACAAGG + Intronic
1111931601 13:94518305-94518327 CTGAGGGTAAGCAGTGTGGAGGG - Intergenic
1112409577 13:99151126-99151148 GTGGGGGAAGGCAGAGGAGAGGG + Intergenic
1116145301 14:41059988-41060010 TTGAGGGCATGCAAAGGAAAAGG + Intergenic
1116305550 14:43250060-43250082 CTGAGAGTATGAAGAGGCCAAGG - Intergenic
1118036163 14:61869795-61869817 GTGAGGTTATGAAGAGAAGATGG + Intergenic
1118338607 14:64876718-64876740 CTGAGGATAAGCAGGAGAGAAGG - Intronic
1119266253 14:73264693-73264715 CTGTGGGTGTGAAGAGGGGATGG - Exonic
1122363471 14:101181026-101181048 CCCAGGGTATGAAGAGGTGAGGG + Intergenic
1122446513 14:101773573-101773595 GTGAGGGTAGGCAGAGCAGGAGG + Intronic
1124103292 15:26715055-26715077 CTGAGGGCATGCAGACAAGAGGG + Intronic
1125477707 15:40058624-40058646 CTCAGGGGAAGGAGAGGAGAGGG + Intergenic
1125588619 15:40840221-40840243 CTGAGGGTCTGAACAGGTGAGGG + Intergenic
1127369826 15:58329403-58329425 CTGAGGGTAGGAAGAGTAGGAGG + Intronic
1127669948 15:61185791-61185813 CTGAGGGTCTCCTCAGGAGAAGG + Intronic
1127736669 15:61846959-61846981 CTGAGGGTGTGCATCTGAGAAGG + Intergenic
1128214000 15:65921950-65921972 CTGTGGGAGTGCAGAGGAGCTGG - Intronic
1128468600 15:67933268-67933290 CTGAGGGTTTTCAGGAGAGAAGG - Intergenic
1129003090 15:72350142-72350164 CTGAGGGTATACAGAAGAAAGGG + Intronic
1129654472 15:77514882-77514904 CTGTGGGGATGCAGAGCAGCAGG + Intergenic
1129748708 15:78044095-78044117 CTGAGGGTTGACAGAGGAGAAGG + Intronic
1129779904 15:78263753-78263775 CTGATGATGTGCAGAGGAGAGGG + Intergenic
1129980554 15:79865643-79865665 CTGAGGGTAAGCAGGGATGAGGG - Intronic
1130015546 15:80183386-80183408 CAGGGGGTAAGCAGAGGAGCGGG + Intronic
1130060834 15:80568858-80568880 CTGATGGAAGGCAGGGGAGATGG - Intronic
1130265055 15:82393896-82393918 GAGACGCTATGCAGAGGAGAAGG - Intergenic
1132060279 15:98687006-98687028 CTGAAGGTTTTGAGAGGAGAGGG + Intronic
1133361738 16:5179470-5179492 GTGAGGGTATGATGAGAAGATGG - Intergenic
1133727961 16:8554936-8554958 CTGGGGGTCTGCAGAGCATAGGG - Intergenic
1134475469 16:14569763-14569785 CTGAGGGGAGGCAGAAGATAGGG + Intronic
1134668713 16:16038704-16038726 CTGAAGGAATCCAGATGAGATGG - Intronic
1134819757 16:17237393-17237415 GTGTGGGAAGGCAGAGGAGAGGG - Intronic
1136377823 16:29876068-29876090 CTGAGGTTGTGAAGAGCAGATGG - Intronic
1136579742 16:31143961-31143983 CGCAGGGAATGCAGAGGACAAGG - Intronic
1137832995 16:51562248-51562270 CAGAGGGTTTGCAGAGGCTATGG + Intergenic
1139269182 16:65666018-65666040 CTGGGGGTATGCAGACTAGATGG + Intergenic
1139421288 16:66850983-66851005 CTCAGTGTATGAAGAGGTGAGGG - Intronic
1139908654 16:70383087-70383109 CTGAGGTTCTGCAGGGGAAATGG + Intronic
1139910444 16:70394345-70394367 CTGAGGGGATGAGGAGGACAGGG + Intronic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141838088 16:86555733-86555755 CTCAGGGTATGCAGAGGTCAGGG - Intergenic
1142066217 16:88064549-88064571 CTGAGGGTTTGCCGAGGAGAGGG + Intronic
1142428225 16:90011894-90011916 CTGAGGGGGTGCCCAGGAGAGGG + Intronic
1142918474 17:3163256-3163278 CTGAGGGGATACAGAGGGCATGG - Intergenic
1142993220 17:3745866-3745888 ATGTGGGGAAGCAGAGGAGACGG - Exonic
1143671929 17:8402717-8402739 CTGAAGGGATGCACAGGAAATGG - Intergenic
1143850106 17:9804506-9804528 CTGAGGTTAGGCATAGGAAAGGG - Intronic
1144330037 17:14214710-14214732 CTGAGGGTCTGCAGAGGAGCTGG - Intergenic
1144863949 17:18323105-18323127 CTCAGGGTATGGGGAGGGGAGGG + Exonic
1144956932 17:19023405-19023427 CTTGGGCTCTGCAGAGGAGATGG - Intronic
1145742274 17:27285325-27285347 TTGGGGGTAAGGAGAGGAGAGGG + Intergenic
1145903090 17:28500413-28500435 AAGGGGGTGTGCAGAGGAGAAGG + Intronic
1145956812 17:28860408-28860430 CTGAGGGTATGTGAAAGAGAAGG - Intronic
1145980877 17:29010790-29010812 CTGAGCCTGTGCAGAGGTGACGG + Intronic
1146806011 17:35865449-35865471 GTGAGGGTATGGGGAGGAGGGGG + Intronic
1147137912 17:38444682-38444704 CTGAGGAGGTGCAGTGGAGAAGG + Intronic
1147334768 17:39720574-39720596 AAGGGGGTATGGAGAGGAGAGGG + Intronic
1147396757 17:40149438-40149460 CTGAGGGAAGGCTGAAGAGATGG + Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1148162040 17:45455781-45455803 CTGAGGGACTACAGGGGAGAAGG - Intronic
1148960780 17:51390997-51391019 CCCAGGGGATGCAGAGCAGATGG + Intergenic
1149359958 17:55884784-55884806 GTGATGGTATTCAGAGGTGAGGG + Intergenic
1149623664 17:58064600-58064622 TTCAGGGTGTGCAGAGGTGAGGG - Intergenic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1150297388 17:64020152-64020174 CTGAGCTGATGCAGAGGGGAAGG - Intronic
1151046215 17:70922618-70922640 CTTAGGGAAAGCAGAGGAGTGGG + Intergenic
1151514091 17:74580985-74581007 CTGAGGGTATTTGGGGGAGATGG + Intronic
1151561464 17:74872134-74872156 CTGGGGCCAGGCAGAGGAGAGGG + Intronic
1151902378 17:77025033-77025055 CTGTGGGAGTTCAGAGGAGAGGG - Intergenic
1152652718 17:81503122-81503144 CTGATGGTAGGCAGAGGTGGAGG - Intergenic
1153026640 18:678905-678927 CTGTGTATCTGCAGAGGAGAAGG + Intronic
1153966013 18:10182533-10182555 CGGAGGGTGGGCAGAGGAGCAGG - Intergenic
1154313801 18:13287598-13287620 CTGAGGGCAGACAGTGGAGAAGG - Intronic
1156151624 18:34250076-34250098 CTGAGATTATGCAGGGGAGCAGG + Intergenic
1156483898 18:37452817-37452839 ATGTGGCTATGCAGAGGCGAAGG - Intronic
1157443395 18:47726951-47726973 CTAAGGATCTGCAGAGGGGAAGG - Intergenic
1158202979 18:54960362-54960384 CTGAGAGGATGCAGTGGGGAAGG - Intergenic
1159943429 18:74426176-74426198 CTGAGGGTGGGAAGTGGAGAGGG - Intergenic
1159985407 18:74835419-74835441 CTGAGGGTGTGCAGTTGAGATGG + Intronic
1160153969 18:76418898-76418920 CAGAGGGTCTGCAGGGCAGATGG + Intronic
1160237460 18:77097403-77097425 CTTTTGTTATGCAGAGGAGATGG - Intronic
1162274007 19:9638800-9638822 AAGAGGGGATGCAGAGGAGAAGG + Intronic
1162526720 19:11210559-11210581 GTGAGGGGATGCACAGGTGAGGG - Intronic
1163266673 19:16226279-16226301 CTCAGGGGATGCCCAGGAGAGGG + Intronic
1163288864 19:16365627-16365649 CTGTGGGTTTGCAGGGGATAGGG + Intronic
1163581786 19:18143833-18143855 CTGATGGTATTCAGGAGAGATGG - Exonic
1163741826 19:19019021-19019043 CTGATGGTATTGAGAGCAGAGGG - Intronic
1164236976 19:23345937-23345959 CTGAGGGTTTGAACAGGGGAGGG - Intronic
1164579965 19:29428967-29428989 CTGAGGGTGGGCAGAGCAGTAGG + Intergenic
1164813645 19:31177512-31177534 CCAAAGGCATGCAGAGGAGAAGG - Intergenic
1165331317 19:35142537-35142559 CTGCGGGTATTCTGGGGAGAGGG + Intronic
1165994038 19:39832320-39832342 CAGACAGTATGCAGAGGAGTAGG + Intronic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
1166558741 19:43718478-43718500 CTCAGCGCCTGCAGAGGAGAAGG - Exonic
1167189054 19:47970682-47970704 CTCATGGTAGGAAGAGGAGAAGG - Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167691750 19:50989242-50989264 GGGAGGGTATGAAGAGGATAAGG - Intergenic
1168056573 19:53868067-53868089 TTGGGGTTCTGCAGAGGAGAGGG + Intronic
1168318000 19:55492434-55492456 TTGAGGCTCTGGAGAGGAGAGGG + Intronic
1168318437 19:55494338-55494360 GTGACCTTATGCAGAGGAGAAGG - Intronic
925472774 2:4180718-4180740 CTGAGGGCATCCAGTGAAGAAGG - Intergenic
926404600 2:12538315-12538337 CTGAGGATATATAGAGCAGAAGG - Intergenic
926552422 2:14316375-14316397 CTGACGTTCTTCAGAGGAGATGG - Intergenic
926635388 2:15173611-15173633 CTGATGGTATGCTGAGAAAATGG - Intronic
926725069 2:15991324-15991346 CTGAGAGTAAGCAGATGAAAGGG - Intergenic
926887689 2:17613008-17613030 TTAAGGGAATGAAGAGGAGATGG - Intronic
927686846 2:25177216-25177238 CTGAAGCACTGCAGAGGAGAGGG + Intergenic
927721699 2:25387379-25387401 CTGAGGAGAGGCAGAGCAGATGG + Intronic
927742744 2:25587066-25587088 CTAAGGGTAGGAACAGGAGAGGG + Intronic
927757469 2:25720493-25720515 CTGAGCAAATGCAGAGGAAATGG + Intergenic
928453748 2:31401052-31401074 CTCACGGTACCCAGAGGAGATGG + Intronic
929127219 2:38532945-38532967 CTGAGGGTTGACAAAGGAGAGGG - Intergenic
929818836 2:45257564-45257586 CTGAGCGGAGGCAGAGGGGAAGG - Intergenic
929859379 2:45663357-45663379 CTGTGGGAATTCAAAGGAGAGGG + Intronic
931312921 2:61099690-61099712 GTGAGTGTATGAAGAGCAGAGGG + Intronic
932021905 2:68095913-68095935 CTGAGGGTTTGCACAGGAAGAGG + Intronic
932184192 2:69677879-69677901 ATGAGGGTCTTCAGGGGAGAAGG - Intronic
932347476 2:71005096-71005118 CTGTAGCTATGCATAGGAGAAGG - Intergenic
933918364 2:87019242-87019264 CTGAGGGTACACAGAGCACAGGG + Intronic
934004632 2:87750671-87750693 CTGAGGGTACACAGAGCACAGGG - Intronic
935767590 2:106384704-106384726 CTGAGGGTACACAGAGCACAAGG - Intergenic
936053147 2:109240769-109240791 CTCAGGGTCTAGAGAGGAGAAGG - Intronic
937982951 2:127625595-127625617 CTCATGGTATACAGAGGAGATGG + Intronic
938258200 2:129876968-129876990 AAGAGGGAAGGCAGAGGAGAAGG - Intergenic
938284775 2:130102689-130102711 CTGAGTGAATGCTGAGGGGAAGG - Intronic
938335416 2:130491249-130491271 CTGAGTGAATGCTGAGGGGAAGG - Intronic
938354408 2:130629418-130629440 CTGAGTGAATGCTGAGGGGAAGG + Intronic
939496906 2:142935794-142935816 CTGAGGGTATGAAGGGGGAAGGG + Intronic
940223813 2:151381596-151381618 ATGAGGGTCTGCAAGGGAGAAGG - Intergenic
940521089 2:154749112-154749134 CTGAGCCTATGCAGAAGTGAAGG + Intronic
940974365 2:159926860-159926882 CTGAAGCTATGGAGAGGAGCAGG + Intergenic
941180047 2:162248563-162248585 CTGAGGGTAAGAAAGGGAGATGG + Intergenic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
941539247 2:166761654-166761676 CAGAGGGGATGCTGAGGAGGAGG + Intergenic
941877292 2:170447053-170447075 ATGAGGGTCTTCAGGGGAGAAGG + Intronic
944467170 2:200014191-200014213 CTTAGGCTATGCACAGGAGCAGG - Intergenic
944866783 2:203870432-203870454 CTGGGGGTGTGGAGAGGGGAAGG + Intronic
945955904 2:216085533-216085555 CAGAGGGGAAGCAGTGGAGATGG + Intronic
948604887 2:239128806-239128828 CTGACCCTCTGCAGAGGAGAAGG + Intronic
1170335581 20:15267168-15267190 GAGTGGGGATGCAGAGGAGAGGG - Intronic
1173041379 20:39466915-39466937 CTTAGGGTTGGAAGAGGAGAAGG - Intergenic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173759136 20:45544622-45544644 CTGAGGGGATGAAGAAGAGTAGG - Intronic
1175062294 20:56254637-56254659 ATGAGGGGAAGGAGAGGAGAAGG + Intergenic
1175408816 20:58752694-58752716 CCCATGGTATGCTGAGGAGACGG - Intergenic
1175644048 20:60656535-60656557 CTGTGGGCAGGCAGATGAGAGGG + Intergenic
1176425789 21:6547541-6547563 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1176979224 21:15360239-15360261 GAGAGGGAATGCAGAAGAGACGG - Intergenic
1178142241 21:29697726-29697748 CTGAAGCTATGGGGAGGAGAAGG - Intronic
1179229666 21:39489997-39490019 ATGAGGGTATGGAGAAAAGAAGG + Intronic
1179283680 21:39956790-39956812 CTGAGTGTCTGCAGAGGTGCCGG - Intergenic
1179608149 21:42531619-42531641 GTGTGGCTATGCAGAGGTGAGGG + Intronic
1179701280 21:43155858-43155880 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1179885016 21:44310148-44310170 CTAAGGGTGTGGAGAGGAGAAGG - Intronic
1180058593 21:45373522-45373544 CTGAGGGTGTTAAGAGGATAAGG - Intergenic
1180588362 22:16914120-16914142 CTTTGAGTCTGCAGAGGAGAAGG - Intergenic
1180645841 22:17338008-17338030 CCGATGGAATTCAGAGGAGAAGG - Intergenic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1180961024 22:19762375-19762397 GTGAGGGGAGGCAGAGGGGACGG + Intronic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181278697 22:21703444-21703466 CTGCGGCCCTGCAGAGGAGAGGG - Exonic
1182056494 22:27359524-27359546 CTGAGGGCAGTGAGAGGAGATGG + Intergenic
1182684982 22:32115324-32115346 CTGAAGCGAGGCAGAGGAGAGGG - Intergenic
1182689726 22:32150627-32150649 CTGAAGGAAGGCAAAGGAGAAGG + Intronic
1182689845 22:32151701-32151723 CTGAAGGAAGGCAAAGGAGAAGG + Intronic
1182689973 22:32152776-32152798 TTGAGGGAAGGCAAAGGAGAGGG + Intronic
1183104469 22:35606412-35606434 CTGTGGGAACCCAGAGGAGAGGG - Intergenic
1183383106 22:37500339-37500361 GTGAGGCTATGCTGGGGAGACGG + Intronic
1183438631 22:37810004-37810026 CTGAGGTGAAGGAGAGGAGATGG - Exonic
1183514666 22:38257908-38257930 CAGAGAGATTGCAGAGGAGAGGG - Intronic
1183718293 22:39547119-39547141 CTGAGTGTGTGTAGAGGGGAGGG + Intergenic
1184792509 22:46708750-46708772 CAGAGGGAAGGCAGAGGACAGGG + Intronic
949365156 3:3272599-3272621 CTGGGGGAGTGCAGAGGAGGGGG + Intergenic
949371857 3:3343908-3343930 CTTAGGCTAGGCAGAGGAGAGGG - Intergenic
949797051 3:7862820-7862842 CTGGGGGAATGCACAAGAGAAGG + Intergenic
950327204 3:12121953-12121975 CTGAGGTTTTGCAGAGAAGAAGG - Intronic
950694083 3:14684109-14684131 CCTAGGGTATGCAGGGGTGAGGG - Intronic
950876762 3:16282569-16282591 TTGAGAGTATGAAGAGAAGAGGG + Intronic
950948411 3:16974887-16974909 TTGAGTGTATGTAGAGGGGAAGG + Intronic
951381984 3:21995485-21995507 CTGAAGGTATGCACAGGTGTAGG + Intronic
951829922 3:26915048-26915070 CTGAGGGAAGGCTGGGGAGAAGG + Intergenic
952211446 3:31232443-31232465 CCGAGGGCATGCAGGGGAGCTGG - Intergenic
952364392 3:32662066-32662088 CTGAGGGGAGGGAGTGGAGAGGG + Intergenic
952901890 3:38116371-38116393 CTGGGGGTATGAGGAGGAGGGGG + Intronic
953972699 3:47359518-47359540 CTGAGGGTGTGCAGGGCAGCAGG - Intergenic
954415268 3:50390394-50390416 CTGAGGGTATGAAGAGAACAGGG + Intronic
957336739 3:78839829-78839851 CTGAGAGGCAGCAGAGGAGATGG - Intronic
958800011 3:98744348-98744370 CTCAGGGGATGCAGAGAAGAGGG - Intronic
959324331 3:104917694-104917716 CTGAGAATATGCAGAAGAGTGGG - Intergenic
959925984 3:111922454-111922476 CAGAGGCTATGCACTGGAGAGGG + Intronic
959946704 3:112133054-112133076 CTGTGGGAGAGCAGAGGAGATGG - Intronic
960428941 3:117545201-117545223 CTGAAGGTGTGCAGAGGAAACGG - Intergenic
961463795 3:127069257-127069279 GAAAGGGTATGCAGACGAGAGGG + Intergenic
962280557 3:134048816-134048838 CTGACGGTATGGGCAGGAGATGG - Intronic
963306165 3:143655552-143655574 AAGAGGGTATGTAGAGGAGAAGG - Intronic
964563853 3:158027853-158027875 CTGAGGGTAGGGGGAGGAAATGG - Intergenic
966883163 3:184361204-184361226 CTGAGGGCCTGCAGAGGACAAGG - Intronic
968751670 4:2393121-2393143 CTGGGGCTCTGCAGATGAGATGG - Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969337356 4:6519489-6519511 CTGTGTGGCTGCAGAGGAGAGGG - Intronic
970469656 4:16364336-16364358 GCGAGGGTATGCTGAGAAGAAGG - Intergenic
970922911 4:21415869-21415891 CAGAGTGAATGAAGAGGAGATGG + Intronic
972255532 4:37351257-37351279 CTGAGGGTACAAAGAGGAGCTGG - Intronic
972559960 4:40218244-40218266 CTGAGAGTCTGCAGATGAGCTGG + Intronic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
974958614 4:68673230-68673252 CTGAGGGTTTGAAGAGGGAAGGG - Intergenic
977822210 4:101486269-101486291 CAGGGGCTATGGAGAGGAGAGGG - Intronic
978256723 4:106701289-106701311 GTGAGGGCAGGCAGAGGGGATGG - Intergenic
978415138 4:108467036-108467058 CAGAGAGTATGCAGAGGCTATGG + Intergenic
979610189 4:122681787-122681809 CTGAGGCTGTGCAGAGCAGTGGG - Intergenic
979841241 4:125443393-125443415 CTGAGGGAATGTAGTGAAGACGG - Intronic
980124353 4:128759636-128759658 CAGAGGGAAGCCAGAGGAGAAGG + Intergenic
980251336 4:130319648-130319670 CTGTGGTTATGAAGAAGAGAGGG + Intergenic
981601706 4:146496505-146496527 ATGAGGGTCTTCAGGGGAGAAGG - Intronic
982805224 4:159755014-159755036 CTGAGGCTGTGCAGAGCAGTGGG - Intergenic
983534480 4:168842756-168842778 ATGAGGGCATGGAGAGAAGACGG - Intronic
984061059 4:174989549-174989571 ATGAGGGTGTGCAGAGGAGTAGG + Intergenic
985353934 4:189096780-189096802 CTCAGGGTGAGCTGAGGAGACGG + Intergenic
985377537 4:189356477-189356499 CTGGGGGGACGCACAGGAGATGG + Intergenic
985484507 5:140863-140885 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985484554 5:140990-141012 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985805008 5:2037161-2037183 CTGAGGCTAAGCAGAAGAGAGGG + Intergenic
986223668 5:5793293-5793315 CTGACGGTATGCGAAGGGGAGGG - Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
989663126 5:43821352-43821374 CTGAGGATAGCCAGAGGAAAAGG + Intergenic
990199823 5:53358902-53358924 TTGAGTGGATGCAGAGTAGAAGG + Intergenic
991042788 5:62193170-62193192 CTGAGGCTATGCAGAGTAGTAGG - Intergenic
991973641 5:72164716-72164738 CTGAGGATATGCAGAGGAGCTGG - Intronic
992295525 5:75323079-75323101 CAGAGGAGATGCAGAGGACAAGG + Intergenic
993488683 5:88518708-88518730 CTGAGGGTATGCATTGGATAGGG - Intergenic
993861868 5:93145987-93146009 CTGAGTGTATGCAGGGGAGCTGG - Intergenic
994994233 5:107039191-107039213 ATGAGGGTCTTCAGGGGAGAAGG + Intergenic
995964938 5:117894041-117894063 TTGAGAGTATGCAAATGAGATGG - Intergenic
996790094 5:127283047-127283069 CTGAGGGATTCCAGAAGAGAGGG - Intergenic
997157494 5:131575327-131575349 AAGAGGGGCTGCAGAGGAGAAGG - Intronic
997953928 5:138263953-138263975 CAGCGGGTATGGACAGGAGATGG - Intronic
998380951 5:141724945-141724967 CTGAGGCTGTGCAGGGGAGTGGG + Intergenic
998523931 5:142825427-142825449 CTGAGGTTATGGAGATGAGAAGG + Intronic
999213904 5:149915535-149915557 CTGAGGGTCAGCAGAGGACAGGG - Intronic
999477611 5:151915274-151915296 CTGAGGGAAGGCAGAAGAGAAGG + Intronic
999552343 5:152703040-152703062 ACCAGGGCATGCAGAGGAGAAGG + Intergenic
1000351346 5:160355082-160355104 CAGAGGGGATGCACAGGAGGAGG + Intronic
1000452894 5:161412406-161412428 CAGAGGGGAGGCAGTGGAGATGG - Intronic
1001678695 5:173539768-173539790 ATGAGGCTATCCAGAGGAGAGGG - Intergenic
1001984167 5:176060330-176060352 CAAAGGGGATGCAGAGGTGAAGG - Exonic
1002233310 5:177783735-177783757 CAAAGGGGATGCAGAGGTGAAGG + Exonic
1002262670 5:178006043-178006065 CAAAGGGGATGCAGAGGTGAAGG - Intergenic
1002690745 5:181048286-181048308 CTAAGGCCCTGCAGAGGAGAGGG + Intronic
1002837450 6:876895-876917 CTGAAGTTCTGCAGAGCAGACGG + Intergenic
1003385752 6:5665945-5665967 ATGAGGGTTTGGAGAGGAGGTGG + Intronic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003712896 6:8613560-8613582 CTAAGGGGAGGGAGAGGAGACGG - Intergenic
1004271248 6:14197685-14197707 ATGAGTGAAAGCAGAGGAGATGG + Intergenic
1005183171 6:23130580-23130602 CTTTGGGAATGCAGAAGAGAAGG + Intergenic
1005763689 6:28989930-28989952 GGGAGGGTATGGAGAGGATAAGG + Intergenic
1006083709 6:31581772-31581794 CTGAGGGTCTGAAGCGGGGAAGG + Intronic
1006108647 6:31731004-31731026 CTGAGGATGGGGAGAGGAGAGGG + Intronic
1006308416 6:33239519-33239541 CTGGAGGAATGCAGAGGAAACGG + Intergenic
1006376513 6:33674370-33674392 GTGAGGGTCTGCAGAGGGAATGG - Intronic
1006792653 6:36714083-36714105 CAGAGGGGATGCACAGGGGAGGG - Intronic
1006833813 6:36985238-36985260 CTGGGGGTGGACAGAGGAGACGG - Intronic
1006866379 6:37212127-37212149 CTAAGGAAGTGCAGAGGAGAGGG + Intergenic
1007567120 6:42860078-42860100 GTGAGGGAATGCAGTGTAGAAGG + Intronic
1007705802 6:43790472-43790494 CTCAGGCTAGACAGAGGAGAAGG - Intergenic
1007872285 6:45053955-45053977 CTGATGGTCTTCAGGGGAGAAGG - Intronic
1008202859 6:48614068-48614090 CTGAGGGAATGGAGAGGTTATGG - Intergenic
1008483235 6:52008091-52008113 CTGAGGGGGTAAAGAGGAGATGG - Intronic
1008890287 6:56480599-56480621 ATGAAGGGAAGCAGAGGAGATGG + Intronic
1010024246 6:71197287-71197309 TTGAGGGTTGGCAGAGGAGACGG + Intergenic
1010033274 6:71291074-71291096 TAGAGGGTATGAAGAGGAGGAGG + Intronic
1012186628 6:96224955-96224977 CTGAGGGTTTTCAGAGGGCAAGG + Intergenic
1012620069 6:101333117-101333139 CTAAAGGAATGCAGAGAAGAAGG - Intergenic
1012625833 6:101402451-101402473 CTGAGCGGCTGCAGAGGAGCAGG - Intronic
1014743002 6:125168380-125168402 GTGAGGGTACTCAGAGAAGAGGG - Intronic
1015551939 6:134420695-134420717 CAGATTGTATGCAGAGCAGAGGG - Intergenic
1015570611 6:134617773-134617795 AGGAGGGTATGCAGTGGAGAAGG + Intergenic
1017070338 6:150570418-150570440 TGAAGGGTCTGCAGAGGAGATGG - Intergenic
1018128426 6:160704832-160704854 CTGAGGGTACACAGAGCACAAGG - Intronic
1018276326 6:162135670-162135692 CTGTGGATCTGCAGATGAGAGGG + Intronic
1018663640 6:166113474-166113496 CTGAGGCTGTGCAGAAAAGAGGG - Intergenic
1018847106 6:167563449-167563471 ATGAGGGAATGCATAGGTGAGGG - Intergenic
1019106489 6:169671749-169671771 TTGTGAGTGTGCAGAGGAGAAGG - Intronic
1019143935 6:169964824-169964846 CTGAGGGTGAGCAGGGGTGAGGG + Intergenic
1019501094 7:1365094-1365116 CAGAGGGGATGCAGTGGGGAGGG - Intergenic
1019572560 7:1719811-1719833 GGGAGGGTTTGCAGAGGTGATGG - Intronic
1019572586 7:1719895-1719917 GGGAGGGTTTGCAGAGGTGATGG - Intronic
1019572612 7:1719979-1720001 GGGAGGGTTTGCAGAGGTGATGG - Intronic
1020439483 7:8201988-8202010 CTGGGGGTAGGCAGGGGACATGG - Intronic
1020462111 7:8437449-8437471 GTAAAGGTATGCAGAGGAAAAGG - Intronic
1020967302 7:14887454-14887476 CTGAGTGTACACAGAGAAGAAGG - Intronic
1022617299 7:31944427-31944449 CTGAGGGTGGGCAGGTGAGAGGG + Intronic
1023582993 7:41701362-41701384 CTGATGGGATCCAGGGGAGATGG + Intronic
1023864864 7:44233813-44233835 CTGAGGGAACACAGAGGTGACGG + Intronic
1023956600 7:44891650-44891672 CTGAGGCTGAGGAGAGGAGAGGG + Intergenic
1024373344 7:48610852-48610874 CTGAGGTTATGCAGGGCAGTGGG + Intronic
1025159861 7:56647108-56647130 TTTTGGGTATGCAGTGGAGAGGG - Intergenic
1025726858 7:64072228-64072250 TTTTGGGTATGCAGTGGAGAGGG + Intronic
1027395307 7:77747432-77747454 CTGAGGCTGTGCAGAGCAGCAGG - Intronic
1028475097 7:91244633-91244655 CAGAGAGAATGCTGAGGAGAAGG - Intergenic
1029580233 7:101432353-101432375 CTGAGGACATGAAGAGGAGTGGG + Intronic
1029853069 7:103484762-103484784 CTGAGGACATGGAGAGGACATGG + Intronic
1030261148 7:107565208-107565230 ATGAGAGCATGCAGAGTAGAGGG - Intronic
1030333934 7:108303379-108303401 CAGAGGGGCTGAAGAGGAGACGG - Intronic
1031350888 7:120729563-120729585 GTGAGAGAAAGCAGAGGAGATGG - Intronic
1031484449 7:122310754-122310776 CTGCGGGAATGCAGAGGAGAAGG - Intergenic
1032174319 7:129611584-129611606 CTGCGGGCAGGCAGCGGAGAGGG - Intergenic
1032263042 7:130351803-130351825 CTGAGGGGATCCAGAGGACAGGG - Intronic
1032703818 7:134405182-134405204 CGGAGGGCTTGCAGAGGAGGAGG - Intergenic
1032805249 7:135347853-135347875 CAGAGGGGATGGAGAGGATATGG - Intergenic
1034427357 7:151021128-151021150 GAGAGGGTGGGCAGAGGAGAGGG - Intronic
1034840903 7:154395257-154395279 CTGATGGTATTAAGAGGTGAGGG - Intronic
1035218605 7:157390693-157390715 CTGTGGGAAGGCAGAGGAAAAGG - Intronic
1035448865 7:158961648-158961670 CTGAGGGCATACGGATGAGATGG + Intergenic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1036091423 8:5669750-5669772 GTCAGGGAATGCAAAGGAGAAGG - Intergenic
1036207491 8:6815768-6815790 GGGAGGGGATGCAGAGAAGAAGG + Intronic
1037886574 8:22599180-22599202 GAGAGGGTGGGCAGAGGAGAGGG - Intronic
1042487344 8:69361181-69361203 ATGAGGGTATTCAAGGGAGAAGG - Intergenic
1042653518 8:71069432-71069454 CTGCGGGTATTCAGACCAGAAGG - Intergenic
1042656554 8:71104561-71104583 CTGAAGGTATACAGAGGAAGAGG - Intergenic
1042723614 8:71849188-71849210 CTGGGGGTAGGCTGGGGAGAGGG + Intronic
1044028888 8:87210535-87210557 CTGAGGCTATGCAGGGCAGCAGG - Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045432214 8:102124394-102124416 CTGCGGGGCTGCAGTGGAGAGGG - Intronic
1047279546 8:123433216-123433238 CTGAGGGACTGCAAAGGAAAAGG - Intronic
1047415821 8:124663672-124663694 TGGAGGGTCTGCAGAGGAGGTGG - Intronic
1047802184 8:128321485-128321507 GTGAGGGTGTGCAGGGGTGAGGG + Intergenic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1049169503 8:141150259-141150281 CGGAGGAAATCCAGAGGAGAAGG - Intronic
1049501639 8:142970696-142970718 CTGGGGGTTGCCAGAGGAGACGG + Intergenic
1049701093 8:144013009-144013031 CTGATGGTGGACAGAGGAGAGGG - Intronic
1050690803 9:8224290-8224312 CTGAAGGTATGCAAAGAAGGAGG + Intergenic
1052608914 9:30743870-30743892 GTGAGGGTTTGCTGAGGAGAGGG + Intergenic
1053019230 9:34683482-34683504 CTGTGGATAGGAAGAGGAGAGGG - Intergenic
1056129520 9:83570087-83570109 ATGAAGGTAAGCGGAGGAGATGG - Intergenic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057141092 9:92727255-92727277 CTGAGGGTATGCAGTGATTAGGG - Intronic
1057397527 9:94693028-94693050 CTGCTGGAATGCAGAGGGGAGGG + Intergenic
1058698893 9:107584852-107584874 GTGAAGGTTTGGAGAGGAGAGGG - Intergenic
1060006426 9:120004100-120004122 CTGATGGTGGACAGAGGAGAGGG + Intergenic
1060025605 9:120168228-120168250 GGGTGGGTATGCAGAGAAGAGGG - Intergenic
1060447166 9:123700586-123700608 CTGAGGTTTTCCAGAGAAGAAGG - Intronic
1060975068 9:127760261-127760283 CTGAGAGTAGGCAGAGGGCAAGG - Intronic
1061025187 9:128043805-128043827 CTGGGGGTGTGCTGAGGGGAGGG - Intergenic
1061079327 9:128360771-128360793 GTGAGGGTAGGGAGAGGACAAGG + Exonic
1061433045 9:130543307-130543329 CTGGGGACATGCAGAGGAGGGGG - Intergenic
1062035262 9:134380061-134380083 CAGAGGGGCTGCAGGGGAGAGGG - Intronic
1062073004 9:134568445-134568467 CTGGGGGTGGACAGAGGAGAAGG - Intergenic
1062389154 9:136327308-136327330 CCCAGGGAATGCAGGGGAGAGGG - Intergenic
1186192165 X:7076616-7076638 TGCAGGGTATGCAGTGGAGACGG - Intronic
1186219526 X:7334590-7334612 TTGAGGACATGCAGAGGAGGTGG - Intronic
1186868654 X:13747561-13747583 GTGAAGGGAAGCAGAGGAGAGGG + Intronic
1187600602 X:20825139-20825161 CTGGGGGTAGGGAGTGGAGAAGG - Intergenic
1190036867 X:47033598-47033620 CTGGAGGTATGAGGAGGAGAGGG - Intronic
1190245085 X:48685663-48685685 CTTGGGGTGTGGAGAGGAGATGG + Intronic
1190458701 X:50649382-50649404 GTGAATGTATGCAAAGGAGACGG + Intronic
1190790992 X:53699923-53699945 CTGAGGCCATGCAGAGGTGGTGG - Intergenic
1192231998 X:69271845-69271867 CTGAGAGTCTTGAGAGGAGAAGG - Intergenic
1192307130 X:69973232-69973254 CTTAGGGAATGCAGAGGAAAGGG + Intronic
1194462808 X:94193994-94194016 GTGAGAGTGTGCTGAGGAGAAGG - Intergenic
1195775815 X:108405104-108405126 CTGAGGAGGTGCAGAGGATAAGG - Intronic
1195815305 X:108878441-108878463 CTGAGGGTGTACAGAGCAGCTGG + Intergenic
1196970042 X:121098687-121098709 CTGAGAGTTTGCAGAGGATATGG + Intergenic
1197272130 X:124436420-124436442 CTCAGGGTAGGGAGAGGAGCTGG - Intronic
1197907585 X:131442842-131442864 CTGGGGCTAAGCAGGGGAGAAGG + Intergenic
1197911838 X:131491388-131491410 CTGGGGCTAAGCAGGGGAGAAGG + Intergenic
1198566667 X:137912258-137912280 CTGAGCAGAGGCAGAGGAGAGGG - Intergenic
1199196088 X:145032633-145032655 CTGAGGTTGTGCAGAGCAGTAGG - Intergenic
1199265484 X:145821842-145821864 CTGGTGGACTGCAGAGGAGAGGG + Exonic
1199577046 X:149322363-149322385 CTGAGGGCCCACAGAGGAGAAGG + Intergenic
1200145684 X:153925639-153925661 CTGAGGGGGAGCAGAGGCGAGGG - Intronic
1200176044 X:154116974-154116996 CTGAGGGCGTTCAGAGGACATGG + Intergenic
1200965440 Y:9031859-9031881 GTGAAGGGAAGCAGAGGAGAGGG + Intergenic
1201788916 Y:17816446-17816468 GTGATGGTAAGCAGAGGAGAGGG + Intergenic
1201812637 Y:18089541-18089563 GTGATGGTAAGCAGAGGAGAGGG - Intergenic
1201849535 Y:18462748-18462770 GTGAAGGTAAGCAGAGAAGATGG - Intergenic
1201862238 Y:18611582-18611604 GTGAAGGGAAGCAGAGGAGAGGG - Intergenic
1201863127 Y:18621406-18621428 GTGAAGGGAAGCAGAGGAGAGGG - Intergenic
1201870196 Y:18698972-18698994 GTGAAGGGAAGCAGAGGAGAGGG + Intergenic
1201871085 Y:18708798-18708820 GTGAAGGGAAGCAGAGGAGAGGG + Intergenic
1201883783 Y:18857627-18857649 GTGAAGGTAAGCAGAGAAGATGG + Intergenic
1202147664 Y:21816929-21816951 GTGAAGGGAAGCAGAGGAGACGG - Intergenic
1202334205 Y:23789805-23789827 GTGAAGGTAAGCAGAGGAGAGGG + Intergenic
1202350522 Y:23985521-23985543 GCAAGGGTAAGCAGAGGAGAGGG + Intergenic
1202520257 Y:25684600-25684622 GCAAGGGTAAGCAGAGGAGAGGG - Intergenic
1202536563 Y:25880254-25880276 GTGAAGGTAAGCAGAGGAGAGGG - Intergenic