ID: 1141137402

View in Genome Browser
Species Human (GRCh38)
Location 16:81475070-81475092
Sequence TGGCTGGCCCTCTGGAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 335}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141137394_1141137402 20 Left 1141137394 16:81475027-81475049 CCGTGGCCTTGTGGCTTCATGAA 0: 1
1: 0
2: 3
3: 29
4: 221
Right 1141137402 16:81475070-81475092 TGGCTGGCCCTCTGGAGAGGAGG 0: 1
1: 0
2: 3
3: 39
4: 335
1141137396_1141137402 14 Left 1141137396 16:81475033-81475055 CCTTGTGGCTTCATGAATGGAGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1141137402 16:81475070-81475092 TGGCTGGCCCTCTGGAGAGGAGG 0: 1
1: 0
2: 3
3: 39
4: 335
1141137393_1141137402 28 Left 1141137393 16:81475019-81475041 CCTCTTCACCGTGGCCTTGTGGC 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1141137402 16:81475070-81475092 TGGCTGGCCCTCTGGAGAGGAGG 0: 1
1: 0
2: 3
3: 39
4: 335
1141137391_1141137402 29 Left 1141137391 16:81475018-81475040 CCCTCTTCACCGTGGCCTTGTGG 0: 1
1: 0
2: 0
3: 17
4: 151
Right 1141137402 16:81475070-81475092 TGGCTGGCCCTCTGGAGAGGAGG 0: 1
1: 0
2: 3
3: 39
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141137402 Original CRISPR TGGCTGGCCCTCTGGAGAGG AGG Intronic
900188446 1:1343523-1343545 TGGCTGGCATGATGGAGAGGAGG - Intronic
900245102 1:1632922-1632944 TGGCTGGGCCCCGGGGGAGGGGG + Intronic
900256333 1:1700081-1700103 TGGCTGGGCCCCGGGGGAGGGGG + Intronic
901137575 1:7007823-7007845 GTGCCGGGCCTCTGGAGAGGTGG - Intronic
902528584 1:17075860-17075882 TTGCAGGCCCTCTGGTGCGGTGG - Intronic
904131834 1:28281159-28281181 TGGCTGGCCCCCGGGGGAGAGGG + Exonic
904204240 1:28842447-28842469 TTCCTGGGCCTCTGGAGAGCTGG - Intronic
904205736 1:28854111-28854133 TGGCTGTCTCTCGGGAGAGAGGG + Intronic
904956033 1:34284693-34284715 TGGCTGGCCCTGTGGACATTTGG - Intergenic
905529258 1:38663731-38663753 TGGCTGGCAATTAGGAGAGGAGG - Intergenic
907259997 1:53210861-53210883 TGGCTGGCTCTGTGGAGTGACGG - Exonic
907721254 1:56974411-56974433 TGGATGGCCACCTGAAGAGGAGG - Intergenic
909677872 1:78257775-78257797 TGGCTGCCCCTTGGTAGAGGAGG - Intergenic
910099604 1:83562032-83562054 TGAGTGGGCCTCTGGAGACGAGG - Intergenic
912393205 1:109319229-109319251 TGGGTGGCACTATGGAGAGATGG - Intronic
913386143 1:118260193-118260215 AGGCTGGCCCTGAGGAGAGCTGG - Intergenic
914317528 1:146528183-146528205 AGGGTGGCACCCTGGAGAGGAGG + Intergenic
914496828 1:148205177-148205199 AGGGTGGCACCCTGGAGAGGAGG - Intergenic
915222570 1:154386812-154386834 TGCCTGGCCCTCTGCACTGGGGG - Intergenic
915696574 1:157748762-157748784 TGGCTGGGCCTCTGGTGTTGGGG + Intronic
915775314 1:158478092-158478114 TGGCTAGCCATCTGCAGAAGAGG + Intergenic
916551676 1:165855797-165855819 AGCCTGGCCCTCTGGAGAGTTGG + Intronic
917048062 1:170885585-170885607 GGGCAGGCCCTCTGGTTAGGTGG - Intergenic
917514059 1:175692330-175692352 TGGCTGGACCTCCAGAGAGGAGG + Intronic
920278158 1:204823978-204824000 TGGCTGGCCCTTGGCAGTGGTGG + Intergenic
920517179 1:206593839-206593861 TGGAAGGCCCTCTGGAGGGAAGG - Intronic
920689425 1:208134636-208134658 TGGCTGAGCCTCTGGGGAGGAGG - Intronic
921010123 1:211133441-211133463 TGGCTCTCCCTGGGGAGAGGCGG + Intronic
923225752 1:231937627-231937649 TGGCTGGGCCTGTGTGGAGGCGG + Intronic
923802289 1:237222011-237222033 TGGCAGGTCCTATGAAGAGGAGG + Intronic
1065280223 10:24129764-24129786 TGGATGGTCCACTGGACAGGAGG - Intronic
1065611221 10:27472469-27472491 TGGCTTGCCCTGGGAAGAGGAGG + Intergenic
1065787399 10:29229493-29229515 CGGCTGACCGCCTGGAGAGGAGG + Intergenic
1065787410 10:29229527-29229549 TGGCTGATCCCCTGGGGAGGAGG + Intergenic
1065801787 10:29358988-29359010 CCGCTGGCCCTCTGGAGATCAGG - Intergenic
1067581455 10:47449196-47449218 TGCCTGGCCTTCCTGAGAGGAGG - Intergenic
1067713116 10:48666126-48666148 TGGCTAGCCATCTGGAGGGGAGG + Intergenic
1068434972 10:56978699-56978721 TTGCTGGACCACTGGAGAGCTGG + Intergenic
1068791440 10:61034999-61035021 TGGCTAGCCCTCCCGAGAGGAGG + Intergenic
1068850131 10:61728877-61728899 TGGCTGGGGCACTGGAGAGAGGG + Intronic
1069708855 10:70476493-70476515 TGGCAGGCCCTCTGGGGGGCTGG + Intergenic
1071472189 10:85991513-85991535 GGACTGCCCCTCTGGGGAGGTGG + Intronic
1071669855 10:87598228-87598250 TAGCTGGCACTTTGGGGAGGTGG + Intergenic
1072616013 10:97049292-97049314 TGGCAGGACCTCTCCAGAGGTGG - Intronic
1072686426 10:97540003-97540025 TGGCAGCCCCTCAGGAGAGGGGG - Intronic
1073178117 10:101568924-101568946 AGGCTGGCACTCCTGAGAGGAGG + Intergenic
1073485448 10:103814973-103814995 TGGCAGGCCAACTGGGGAGGTGG + Intronic
1075348958 10:121706574-121706596 AGGCTGGACTTCTTGAGAGGTGG + Intergenic
1075817905 10:125279961-125279983 TGGCAGGCCCTCTGGGTAGTGGG + Intergenic
1076370564 10:129950094-129950116 TGCCTGCACATCTGGAGAGGAGG - Intronic
1076494036 10:130885236-130885258 TGGGGGGGCCTCTGGGGAGGAGG + Intergenic
1076618178 10:131770719-131770741 TGGCTTCCCCTCCGGGGAGGTGG - Intergenic
1076802621 10:132838206-132838228 TGGCTGGCCCTCAGGGGCTGTGG - Intronic
1077011841 11:382268-382290 TGCCGGGCCCTGTGGGGAGGGGG + Intergenic
1077453831 11:2666193-2666215 TGAGTGTCCCTCTGGAGAGTGGG - Intronic
1077489816 11:2855614-2855636 TGGCTGGCCCTGCGGCGTGGGGG + Intergenic
1078527489 11:12111407-12111429 TGGCTGGCCCCGGGGAGAGGTGG + Intronic
1079361801 11:19776441-19776463 TTCAAGGCCCTCTGGAGAGGAGG - Intronic
1080223501 11:29934244-29934266 TGGCTGGCCATTTGGAGTGCTGG - Intergenic
1080715159 11:34792891-34792913 TGGCTGCCCCTCTGGAGAATTGG - Intergenic
1081772584 11:45659008-45659030 TGGCTGGCCCCGTGGGGACGAGG + Intronic
1081909835 11:46693897-46693919 TAAATGGCTCTCTGGAGAGGGGG - Intronic
1083297259 11:61721660-61721682 AGGCTGGTCCTCTGGGGAGCTGG - Intronic
1084748498 11:71188721-71188743 TGGCAGGCCCTCAGCAGATGAGG - Intronic
1086500393 11:87446855-87446877 TGGCTGGTCGCCTGGAGAGGTGG + Intergenic
1088824826 11:113484583-113484605 TGGATGGCCCTCTGGAGGCTAGG - Intergenic
1088881296 11:113975422-113975444 TGGCTGACCATCTGCTGAGGTGG + Intronic
1089039094 11:115428968-115428990 TCTCTGGCACTCTGGAGAGTTGG - Intronic
1089046193 11:115503830-115503852 GGGGGGGCCCTCTGGAGAGGTGG + Intronic
1089304545 11:117518201-117518223 TGGCTGGATTTCTGGACAGGAGG + Intronic
1089374808 11:117986621-117986643 TGGCTGGCCCTCTGGCAGAGCGG + Intronic
1090522606 11:127495363-127495385 TTGCTGGCTCTCTGGGAAGGTGG + Intergenic
1091016863 11:132059289-132059311 GGGCTGGCCATGAGGAGAGGAGG - Intronic
1091857851 12:3753368-3753390 TCGCTGGCTCACTGGAGAGGTGG + Intronic
1092539714 12:9413364-9413386 GGGCTGGCCCTCTGATCAGGTGG - Intergenic
1092951668 12:13509305-13509327 AGGCTGGCCTTCTGAAGGGGTGG + Intergenic
1093406403 12:18810052-18810074 TGACTGGCTCTGTGGAGACGCGG + Intergenic
1094843369 12:34351148-34351170 TGGCTGGACCTCGCGAGGGGCGG - Intergenic
1096485914 12:51981052-51981074 TGGCGGGGCCGCTGGAGGGGTGG + Exonic
1096978189 12:55712348-55712370 TGGCTGGGCTTCAAGAGAGGGGG - Intronic
1097376869 12:58853130-58853152 TGGCTAGCCATCTTGAGGGGAGG + Intergenic
1097850323 12:64404753-64404775 TGGCTGACCATCTGGAGTGCAGG + Exonic
1098678218 12:73317560-73317582 TGGCTGGCCTTGTGGAGAACAGG - Intergenic
1100513002 12:95295701-95295723 GGGCTGGCACTTTGGGGAGGTGG - Intronic
1101186853 12:102289531-102289553 TGGCTGCCCCTTGGCAGAGGGGG + Intergenic
1101727977 12:107403778-107403800 TATGTGGCCCTTTGGAGAGGTGG - Intronic
1101837020 12:108302963-108302985 TTCCTGGACCTCAGGAGAGGAGG - Intronic
1102496320 12:113321620-113321642 TGGTGGGACCACTGGAGAGGGGG - Intronic
1102585092 12:113917231-113917253 AGGCTGGCTCTCTGGAGATAGGG + Intronic
1103851439 12:123936149-123936171 TGGCTGGCCACCTGGAGGTGAGG + Exonic
1104614667 12:130257699-130257721 TGGCAGGCCCTCAGCAGACGAGG - Intergenic
1106180060 13:27362574-27362596 TGGACGCCCCTCTGCAGAGGCGG + Intergenic
1107770531 13:43785284-43785306 TGGTGGGCCCGCTCGAGAGGTGG - Intronic
1108687475 13:52833284-52833306 TGGCTGGCATTTTGGAAAGGGGG - Intergenic
1108877081 13:55060420-55060442 TGGCTGGCCATCCTGAGGGGAGG - Intergenic
1113483496 13:110638364-110638386 GGGCTGGACCTGCGGAGAGGGGG - Exonic
1114384700 14:22242867-22242889 TGGCTAGCCATCTGGAGGGGAGG - Intergenic
1114676044 14:24440970-24440992 TGCCTGGCTCTCTGTAGTGGAGG + Exonic
1115510130 14:34130517-34130539 TGGCTGGCCCTTTGCAGGGTTGG - Intronic
1116523870 14:45880839-45880861 TTGCTGGCCTTCTGAAGGGGTGG - Intergenic
1117198198 14:53362151-53362173 TGGCTAGCCATCTGGAGGGGAGG - Intergenic
1117672817 14:58125290-58125312 TGGCTAGCCATCTGGAGAGGAGG - Intronic
1118233309 14:63975045-63975067 TGGCTGCTTCTCTGGATAGGTGG + Intronic
1120979736 14:90279239-90279261 TGCCAGGCCCTCTGCACAGGTGG - Intronic
1121271575 14:92641402-92641424 AGGCTGTCCCTCTGCACAGGCGG - Intronic
1122271966 14:100572359-100572381 TGGCAGGCCCCCTGCAGAGGTGG - Intronic
1122281563 14:100625859-100625881 TGGCTGCATCTCTGGAGGGGAGG - Intergenic
1122299943 14:100725794-100725816 GGGGTCGCCCGCTGGAGAGGTGG - Intronic
1122922556 14:104886026-104886048 CGGGAGGCCCTGTGGAGAGGAGG - Exonic
1123019428 14:105390690-105390712 TGGCTGGCCCTCTGGGAGGGTGG + Intronic
1123885033 15:24718339-24718361 TGGCTGCCCCTCAGCAGAGCTGG + Intergenic
1124695878 15:31863694-31863716 TGGCAGCCCCTCTGGAGAACAGG - Intronic
1125293440 15:38175463-38175485 TGGCTTGCCCTATGGGGAAGAGG + Intergenic
1128326870 15:66729582-66729604 TGGCTGGGCCCCAGGCGAGGGGG + Intronic
1128818052 15:70628919-70628941 AGGCTGCCCCTCTGGAAGGGAGG + Intergenic
1129183917 15:73894269-73894291 TGTCTGGTCCTCTGCAGAGCAGG + Intergenic
1131080633 15:89531704-89531726 TAGCAGGCCCTCTGAAGAGGAGG - Intergenic
1131830857 15:96353904-96353926 TGGCTGGGCCTTTGGGGACGCGG + Intergenic
1131888787 15:96949644-96949666 GCGCTGGCCCTCTGGAGGGTGGG - Intergenic
1132595268 16:746262-746284 TGGCTGGGCAGCAGGAGAGGAGG + Intronic
1132595279 16:746306-746328 TGGCTGGGCAGCAGGAGAGGAGG + Intronic
1132595312 16:746437-746459 TGGCTGGGCAGCAGGAGAGGAGG + Intronic
1132595343 16:746569-746591 TGGCTGGGCAGCAGGAGAGGAGG + Intronic
1132595378 16:746703-746725 TGGCTGGGCAGCAGGAGAGGAGG + Intronic
1132996393 16:2825691-2825713 TTCCTGGCCCCCAGGAGAGGAGG + Intronic
1133132415 16:3685459-3685481 TGTCTGTCTCTGTGGAGAGGTGG - Intronic
1133978451 16:10617007-10617029 GAGCTGCCCCTCTGGGGAGGGGG + Intergenic
1134752279 16:16635534-16635556 TTGGTGGCCCTCCTGAGAGGAGG - Intergenic
1135680743 16:24454667-24454689 TGGAGGGGCCTCTGGAGGGGTGG - Intergenic
1135993656 16:27232509-27232531 TGGCTGGCTCGCGGGGGAGGCGG - Intronic
1136276844 16:29183830-29183852 TGCCTGTCCACCTGGAGAGGAGG - Intergenic
1136777292 16:32878770-32878792 AGGCAGGCCCCCTGGAGGGGTGG + Intergenic
1136893333 16:33982743-33982765 AGGCAGGCCCCCTGGAGGGGTGG - Intergenic
1137862087 16:51856743-51856765 TGACAGGTCCTCAGGAGAGGTGG + Intergenic
1138655300 16:58487935-58487957 TGGCTGGCCCTAGGGAGGGTCGG - Intronic
1141137402 16:81475070-81475092 TGGCTGGCCCTCTGGAGAGGAGG + Intronic
1141598261 16:85110452-85110474 TGGCTGTCCCTGTGGAGGCGGGG + Exonic
1141763882 16:86046187-86046209 AGGCTGGCCCCCTGGGGAAGTGG + Intergenic
1141779777 16:86151708-86151730 TGCCTGGCCCTCTGCATGGGTGG + Intergenic
1142081222 16:88149890-88149912 TGCCTGTCCACCTGGAGAGGAGG - Intergenic
1203079706 16_KI270728v1_random:1140879-1140901 AGGCAGGCCCCCTGGAGGGGTGG + Intergenic
1142482748 17:228779-228801 GGACTGGCCGCCTGGAGAGGAGG - Intronic
1142673194 17:1496958-1496980 TGGCTGGCCATCAGGAAAGAGGG + Intronic
1142969824 17:3603861-3603883 TGGTGGGCCCTCAGGAGAGAGGG - Intergenic
1144625364 17:16841717-16841739 TGGCTGTCCCTCAGCAGGGGTGG - Intergenic
1144881063 17:18431004-18431026 TGGCTGTCCCTCAGCAGGGGTGG + Intergenic
1145060618 17:19731031-19731053 GGGCTGGCCCACAGCAGAGGCGG + Intergenic
1145151169 17:20513382-20513404 TGGCTGTCCCTCAGCAGGGGTGG - Intergenic
1145262593 17:21363812-21363834 TGGCTTGCCTTTTGGGGAGGAGG + Intergenic
1146162524 17:30567636-30567658 TGGCTGTCCCTCAGCAGGGGTGG - Intergenic
1146594281 17:34155929-34155951 TGTCTGGTCCTCTGGAGAAGTGG - Intronic
1146945609 17:36871005-36871027 TGGCTGAGCCTATGGAGAAGTGG - Intergenic
1147242847 17:39101869-39101891 CGGCTGGCCCTACCGAGAGGTGG + Intronic
1147338269 17:39739635-39739657 TGGCTGGCCCTAAGGGCAGGTGG - Intronic
1148134435 17:45283228-45283250 CAGCTGTCCCTCTTGAGAGGTGG - Intronic
1148462201 17:47845296-47845318 TGCCTGGCCAGGTGGAGAGGGGG - Exonic
1148690584 17:49524730-49524752 AGGGTGGGCATCTGGAGAGGTGG + Intergenic
1148695945 17:49558329-49558351 TTGCTGCCCCTTTGGAGTGGAGG - Intergenic
1150510950 17:65752550-65752572 TGGTTTGTTCTCTGGAGAGGTGG - Intronic
1151198269 17:72447274-72447296 TGAATGGTGCTCTGGAGAGGGGG - Intergenic
1151468483 17:74302908-74302930 TGCCTTGTCCTCTGGGGAGGGGG - Intronic
1152525950 17:80888503-80888525 TGGGTGGCCCTCAGGGCAGGTGG + Intronic
1152696950 17:81802391-81802413 TGTCTGTGCCTCTGGAGAGGTGG + Intergenic
1152912206 17:83011216-83011238 TGGCTGGCCCTCAGGAACGGGGG + Intronic
1152944234 17:83190463-83190485 TGTCTCGCCCACTGGAGAGATGG - Intergenic
1153972871 18:10242440-10242462 TGGCTGGGCTTCTGGAAGGGAGG - Intergenic
1154343967 18:13527394-13527416 TTGCTGGCCTTCTGGAGACCGGG + Intronic
1156268265 18:35508040-35508062 TGGCTGGGCATCTGGACGGGTGG - Intergenic
1156295379 18:35784644-35784666 TGGCATGACCTCTGGAGAGAGGG + Intergenic
1157575247 18:48739175-48739197 TGGCTGTCCCACTGGTGATGGGG - Intronic
1158496409 18:57959110-57959132 TGGCTGAGGCTCTGGAGAGCTGG - Intergenic
1158765569 18:60446848-60446870 TGGCTGCCCCTTGGCAGAGGAGG + Intergenic
1158786052 18:60712864-60712886 TGGCTAGCCATCTGGAGGGGAGG - Intergenic
1160579315 18:79874738-79874760 GGGCCGGCCTCCTGGAGAGGAGG - Intronic
1160899254 19:1419037-1419059 TGCCTGGCCCTCCTCAGAGGTGG + Intronic
1161082906 19:2320287-2320309 GGGCTGGCCCGCTGGAGTGTGGG + Intronic
1161106122 19:2444923-2444945 TGGCTGGTCCTCCGGGGAAGGGG - Intronic
1161382884 19:3975772-3975794 TGGATGGCCCTGTGGAGCGAGGG - Intergenic
1161390929 19:4019786-4019808 TGGCTGGCCCTCAGGAAGAGGGG - Intronic
1161707449 19:5828854-5828876 TGTGTGGACTTCTGGAGAGGGGG + Intergenic
1161712513 19:5857226-5857248 ATACTGGCCCTCTGGAGCGGGGG - Intergenic
1161827071 19:6575158-6575180 ATACTGGCCCTCTGGAGCGGGGG - Intergenic
1161992208 19:7690381-7690403 GGGCTGGGGCTCTGCAGAGGTGG - Intronic
1161995197 19:7707521-7707543 TGGGGGGCCCTCTGGAGGGAAGG - Intergenic
1162079327 19:8209230-8209252 GGGCTGGGGCCCTGGAGAGGCGG - Intronic
1162770936 19:12948970-12948992 TGGGTGGGCCTCTGGAGGGCAGG + Intronic
1162910733 19:13846827-13846849 TGGCTGGTGCCCTGGTGAGGGGG - Intergenic
1163243434 19:16077525-16077547 TGGCTGTCCCTCGGGACAGATGG + Intronic
1165080893 19:33305448-33305470 TGGTTGGCCGGCTGGAGAGTGGG + Intergenic
1166116268 19:40656886-40656908 TGGCTGGAGCTCTGAGGAGGGGG - Intergenic
1167108959 19:47447675-47447697 TGGTTGGGCCTCGGGAGGGGAGG - Intronic
1167268973 19:48497731-48497753 AGGCTGGACCTCGGGAGTGGGGG - Exonic
1167299700 19:48671626-48671648 TGGCAGGCCCTGGGGAGGGGAGG + Intronic
1167338475 19:48900870-48900892 TGGCTGTCCCCCTGGAGCGAGGG + Exonic
1167469409 19:49667007-49667029 GGGCAGGGCTTCTGGAGAGGAGG - Exonic
925883402 2:8371178-8371200 TGGCTGGTCTTCTGCAGAGGTGG - Intergenic
926017752 2:9469528-9469550 TGGCTGGTCCTCAGGAGCCGTGG + Intronic
928341477 2:30447053-30447075 CGTCTGGCCTCCTGGAGAGGAGG - Intergenic
929787718 2:45004256-45004278 GGGCTGGCACTCCAGAGAGGAGG + Intergenic
930278501 2:49341487-49341509 TTACTGGCCTCCTGGAGAGGTGG - Intergenic
932283185 2:70512366-70512388 TGGCTGCCAGTCTGCAGAGGAGG - Intronic
932918052 2:75878204-75878226 TGGCTAGCCATCTGGAGGGGAGG - Intergenic
934616431 2:95774221-95774243 AGACTGGCCCACTGAAGAGGAGG + Intergenic
934644462 2:96050339-96050361 AGACTGGCCCACTGAAGAGGAGG - Intergenic
934747830 2:96771038-96771060 CGGCTGGCCCTCGGCTGAGGGGG + Intronic
934837878 2:97606429-97606451 AGACTGGCCCACTGAAGAGGAGG - Intergenic
935336506 2:102021792-102021814 TGGCAGGCACTTTGGAGAGGTGG + Intronic
936682187 2:114786820-114786842 TGGCTGGGCCTCTGGAAAATTGG + Intronic
936922408 2:117702374-117702396 TGGCTGGGCAAATGGAGAGGTGG - Intergenic
937500375 2:122472009-122472031 TTGCTGGATCACTGGAGAGGAGG - Intergenic
939521170 2:143232387-143232409 TGGCTGGTCCTCCAGTGAGGAGG + Intronic
942180919 2:173379808-173379830 GGGCTGGGGTTCTGGAGAGGTGG - Intergenic
942484381 2:176423878-176423900 TAGCTGGGTCTCTGGAGAAGGGG + Intergenic
942694162 2:178620263-178620285 TGGCTTTCTCTCTGGAGAGCTGG + Exonic
943352270 2:186809535-186809557 TGATGTGCCCTCTGGAGAGGGGG + Intergenic
944680041 2:202069051-202069073 TGAATGCCACTCTGGAGAGGCGG - Intergenic
948196269 2:236099032-236099054 TGGCTCCCCCGCTGGGGAGGTGG - Intronic
948659189 2:239496734-239496756 TGGCTGGCTTTCAGGAGAGTGGG - Intergenic
948829996 2:240594025-240594047 TGGCAGGGGCTCTGGAGAGAGGG + Exonic
948916343 2:241036568-241036590 TGGCGTGGCCTCTGGGGAGGTGG - Intronic
1170381673 20:15766913-15766935 GGGCTCGCCCTCTGGCTAGGTGG - Intronic
1171149547 20:22815125-22815147 TGGCTGGGCCTCGTGAGAGCTGG + Intergenic
1171815678 20:29784019-29784041 TGGCTGGCACGATGGAGAGGAGG - Intergenic
1172592374 20:36126959-36126981 TGGCACTGCCTCTGGAGAGGAGG + Intronic
1174388455 20:50200991-50201013 TGGCTGACCCTCTTGTGGGGTGG + Intergenic
1175167543 20:57055423-57055445 CAGCAGGCCCTCTGCAGAGGGGG + Intergenic
1175591882 20:60200105-60200127 TGGCTGCCCCTTGGCAGAGGAGG + Intergenic
1176048723 20:63105568-63105590 AGGCTGGCCCAGTGCAGAGGAGG - Intergenic
1177109418 21:17006655-17006677 TGGCTAGCCATATGCAGAGGAGG + Intergenic
1177263142 21:18754021-18754043 TGGCTAGCCATCTGGAGGGGAGG + Intergenic
1179454005 21:41485980-41486002 AGGATGGCCCTTAGGAGAGGGGG + Intronic
1180138472 21:45876419-45876441 TGGCTGGGCCGCTGGAGCAGGGG + Intronic
1180963481 22:19773521-19773543 TGGCTGGCCGCCTGGAGGGAGGG - Intronic
1182145498 22:27994577-27994599 TGGCTGTCCCTCAGGAGCGGGGG + Intronic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1183307314 22:37089589-37089611 TGGCCGGGCCCCTGGAGAAGAGG - Exonic
1183311974 22:37115083-37115105 TGGCTAGCCCACAGGACAGGAGG - Intergenic
1183358176 22:37370420-37370442 TGGCTGGCCAGCTGGGGTGGAGG - Exonic
1183726006 22:39590069-39590091 TGGCTCGGCTCCTGGAGAGGAGG + Intronic
1184189726 22:42886732-42886754 TGCCTAGAGCTCTGGAGAGGAGG - Intronic
1184671336 22:46013647-46013669 TGGCGGGGCCTCTGGGAAGGCGG - Intergenic
1184793015 22:46712776-46712798 TGGCGGGGCCCCTGGAGAGATGG - Intronic
1185032783 22:48453485-48453507 TGGCTGGCTCTCTTGAGGGTGGG + Intergenic
1185116184 22:48939655-48939677 TGGCTGGGCCTCTGGAGGCCCGG - Intergenic
1185272815 22:49936469-49936491 TGGCTGGGCTTAGGGAGAGGTGG + Intergenic
949329176 3:2902172-2902194 TGGCAGGTCTCCTGGAGAGGAGG + Intronic
949583154 3:5411411-5411433 TGGCTGAACCTCTTGAAAGGAGG - Intergenic
949930435 3:9074184-9074206 TGGCTGGCCCAGTGGAGATGGGG + Intronic
952921835 3:38290685-38290707 TGGCTAGCCATCCTGAGAGGAGG + Intronic
952927310 3:38329451-38329473 TCCCTGGCTCTGTGGAGAGGGGG + Intergenic
953391217 3:42534963-42534985 TGGCTAGCCTTCTGGAGACAGGG - Exonic
953521171 3:43644723-43644745 TGGCTGACCCATTGAAGAGGTGG - Intronic
953569252 3:44058223-44058245 TGGCTGTCCTTCTGAGGAGGAGG + Intergenic
953588393 3:44226973-44226995 AGGCTTTCCCTCTGGAGAGCTGG - Intergenic
953603181 3:44387662-44387684 TGGCTGGCCCTTGGCAGATGTGG + Intronic
953885709 3:46713354-46713376 TGGCAGGCCCTCAGGAGGGAAGG - Intronic
954104089 3:48399767-48399789 TGACTGGGCCTCTGGAGAGAAGG - Intronic
954292293 3:49656011-49656033 TGGGTGGCCCTCTGGAAAGGTGG - Exonic
954529199 3:51303927-51303949 TGGCTGCCCCTTGGCAGAGGGGG + Intronic
954846939 3:53567547-53567569 AGGCTCACCCTCTGGTGAGGTGG - Intronic
956735666 3:72236110-72236132 TGGCTGGTTGTGTGGAGAGGAGG - Intergenic
959258758 3:104048546-104048568 TGGCTGTCCCTTGGTAGAGGTGG - Intergenic
960045427 3:113192835-113192857 TTGCTACCCCTTTGGAGAGGAGG - Intergenic
960251566 3:115461265-115461287 TGGCTGGCCATAGGGAAAGGGGG - Intergenic
961991588 3:131197702-131197724 TGGCTAGCCATCTGGAGGGGAGG + Intronic
963620459 3:147599457-147599479 AGGCTGGCCTTCTTGAGATGTGG + Intergenic
964953812 3:162327511-162327533 TGGCTAGCCATCTGGAGGGGAGG - Intergenic
965267286 3:166560489-166560511 TGGCTGGCCTTCTGCAGTGGTGG + Intergenic
967623936 3:191664735-191664757 TGGCTAGCCATCTGGAGGGGAGG - Intergenic
968009632 3:195265564-195265586 TGGCCAGCTCTCTGCAGAGGCGG - Intronic
968588505 4:1446082-1446104 TGGTGGGCCCTGTGCAGAGGTGG + Intergenic
968633871 4:1667738-1667760 TGGCTGTGGCTCTGGAGACGTGG - Intronic
968661927 4:1802224-1802246 AGGCTGGCCCTCTGCAGACACGG - Intronic
969558342 4:7929047-7929069 TGGTTTGCTCTCAGGAGAGGAGG + Intronic
969606594 4:8205153-8205175 TGCCTGGCCCTGTGGACAGAGGG - Exonic
972391736 4:38619964-38619986 TGGCTTGCCCTGTGGGGAGTGGG - Intergenic
973712641 4:53644720-53644742 TGCCTGGCCATCTGGCAAGGAGG - Intronic
974913197 4:68148379-68148401 TGGCTGCCCCTTGGCAGAGGGGG + Intergenic
974949410 4:68569999-68570021 TGGCTTGCTCTCTGGGGTGGAGG - Intronic
977060712 4:92254548-92254570 TGGCTGTCCCTTTGTGGAGGGGG + Intergenic
977780699 4:100977557-100977579 AGCCTGGCCCTCTGGTGTGGTGG - Intergenic
978327956 4:107579838-107579860 TGGCTGCCCCTTGGTAGAGGGGG - Intergenic
982118401 4:152116532-152116554 TGGCGGGCTCTTGGGAGAGGAGG - Intergenic
982372337 4:154647492-154647514 TGGCTGCCCCTTGGCAGAGGGGG - Intronic
985019189 4:185669552-185669574 TGGCCAGGCCTCAGGAGAGGAGG + Intronic
985500231 5:239112-239134 AGCCTGGTCCTGTGGAGAGGTGG + Intronic
985737165 5:1590578-1590600 AGCCTGGTCCTGTGGAGAGGTGG - Intergenic
986098669 5:4585252-4585274 GGGCTGGCCATCTGTGGAGGTGG + Intergenic
989638063 5:43557032-43557054 GGGCGGGCGCTCTGGAGCGGCGG - Exonic
990091626 5:52058257-52058279 TGGCTAGCCATATGCAGAGGAGG - Intronic
990451199 5:55933211-55933233 CTGCTGGGCCTCTGGAGAGAGGG - Intergenic
991037167 5:62138897-62138919 TGTCTGCCCCTCTGGGGAGCCGG + Intergenic
991602650 5:68368916-68368938 GGGCTGGCACCCTAGAGAGGAGG + Intergenic
994450116 5:99930210-99930232 TGGTGGGCCTTCTGGAGTGGTGG - Intergenic
994525519 5:100901258-100901280 TGGCTGGGACCCTGGAGAGCAGG - Intronic
998529103 5:142868698-142868720 CGGCTGGCTCTCTGGGGAGAGGG + Intronic
998612645 5:143705626-143705648 TGGCTGGCTCTGGGGAGAGTTGG + Intergenic
999192744 5:149760741-149760763 TGGCTGCCCCTTGAGAGAGGAGG + Intronic
999329360 5:150662193-150662215 TAACTTGCCCTCTGGAGAAGAGG - Intronic
1000623741 5:163514976-163514998 TTTCTGGTCCTCTGGAGGGGAGG + Intronic
1001130067 5:169056435-169056457 TGCCTGGGCCTCTGCAAAGGTGG - Intronic
1001545905 5:172570416-172570438 TGGCTGGGAATCTGGAGAGGGGG + Intergenic
1002445716 5:179288652-179288674 TGGTTGGCCCACTGGAGAGCCGG + Intronic
1002691619 5:181054026-181054048 TGGCTGCCCTTCTGCATAGGAGG - Intronic
1003739135 6:8914866-8914888 TGGCTGGAACCATGGAGAGGAGG + Intergenic
1004924494 6:20403762-20403784 TGGGGGGCCGGCTGGAGAGGGGG - Intronic
1005224976 6:23632188-23632210 TGGCTGTCCCTCTGTGGGGGTGG + Intergenic
1005897706 6:30192065-30192087 GGGCTGGCCCTGAGGAGAAGAGG + Intronic
1006401681 6:33821446-33821468 TGGCTGGCACTCTGGAAGGAGGG + Intergenic
1006448561 6:34092938-34092960 TGGGTGGCGCCCTGGAGGGGAGG - Intronic
1006612253 6:35301164-35301186 TGGTTGTCCCTCTCCAGAGGAGG - Intronic
1007375993 6:41457051-41457073 TGCCTGACCCTCTGGGGAGCTGG - Intergenic
1007401763 6:41606707-41606729 TGGCTGTCACTCTGGGGAGGGGG + Intergenic
1007636018 6:43300321-43300343 AGGCTGGCCCCTTGGAGAGTTGG + Intronic
1010893844 6:81343330-81343352 TGGCTAGCCATCTGGAGAGGAGG - Intergenic
1013231562 6:108165694-108165716 TATCTGGCACTCTGGAGAGAGGG + Intronic
1013268614 6:108524749-108524771 TGGCTGGATCTCTGGAGGGGAGG + Exonic
1014287096 6:119512819-119512841 TGGCTGGGCCCCTGGAGGTGTGG - Intergenic
1014491070 6:122062451-122062473 TGGTGTGCCCTCTGGAAAGGAGG + Intergenic
1016286075 6:142474543-142474565 CGGCTGGGCCTATGGCGAGGTGG - Intergenic
1019102294 6:169641228-169641250 GGGCTGGAGCTCGGGAGAGGAGG - Intronic
1019153162 6:170022587-170022609 TGGCCGTCCCTCTGGCGGGGTGG + Intergenic
1019296681 7:280635-280657 TGGCTGGGGCTCAGGAGGGGAGG + Intergenic
1020138492 7:5599359-5599381 TGGCTGGCTCTCTGGACCGGAGG - Intronic
1022989233 7:35691964-35691986 TGGGTGGAGCTCTGGAGCGGTGG - Intronic
1023207241 7:37763888-37763910 TGGCTGTCCCTTGGTAGAGGGGG - Intronic
1023864476 7:44232318-44232340 GGGCTGGCTCTCTGGGGTGGTGG - Intronic
1024034335 7:45494965-45494987 TGGCTGCCCCTTTGTGGAGGGGG + Intergenic
1024590029 7:50872976-50872998 TGGCTGCCCCTTAGCAGAGGGGG - Intergenic
1027270166 7:76514549-76514571 AGGGTGGCCACCTGGAGAGGTGG + Intronic
1028476953 7:91264282-91264304 TGGCTTTCGCTCTGGCGAGGAGG + Intergenic
1029611300 7:101627906-101627928 TGGCCGGACCTCTGGAGCTGTGG + Intronic
1030843105 7:114379921-114379943 TGGCTAGCCATCTGAAGGGGAGG + Intronic
1031988320 7:128178374-128178396 TGGCTGGGCCTCTGCGGAGTGGG + Intergenic
1032706735 7:134426537-134426559 AGGCTGCCCCTGTGGAGGGGAGG + Intergenic
1035536236 8:393415-393437 TGTCTGTCCCTCTGCAGAGATGG + Intergenic
1036631605 8:10519765-10519787 TGGCTGGCCCTGAGAAGAGAAGG + Intergenic
1036678070 8:10851488-10851510 TGGCTGCCCCTGTGGAGTTGTGG + Intergenic
1036830107 8:12014577-12014599 TGGCTGGCCAAAAGGAGAGGGGG - Intronic
1037389028 8:18373535-18373557 TTGGTGGCCCTCTGAAGAGTAGG + Intergenic
1038358462 8:26854065-26854087 TGGATGCCACTCTGGAAAGGAGG + Intronic
1038900639 8:31839885-31839907 ATTGTGGCCCTCTGGAGAGGGGG + Intronic
1040527362 8:48236772-48236794 TGGCTAGCCATCTGGAGGGGAGG + Intergenic
1045324041 8:101103609-101103631 GGGCAGGCACTCTGGAGGGGTGG - Intergenic
1046964979 8:120153979-120154001 TGGTTGGCCCTATGCAGTGGGGG + Intronic
1048842604 8:138578825-138578847 TGGCTGGGCCTCTGCAGCTGAGG + Intergenic
1049352252 8:142170559-142170581 TGGCGGCCCCCCTAGAGAGGGGG + Intergenic
1049765661 8:144354184-144354206 GGGCCGGCCCTCAGGGGAGGAGG + Intronic
1050140840 9:2514262-2514284 ATACTGGCCCTCTGGAGTGGGGG - Intergenic
1050405931 9:5308774-5308796 TGTCTGGCTCTCTTGAGTGGAGG - Intergenic
1052781389 9:32784306-32784328 TGGCTGGCCCGATGGCCAGGAGG - Exonic
1052991479 9:34521493-34521515 TGGCTGGGCTTCTGGGGTGGTGG + Exonic
1053290186 9:36874550-36874572 TGCTTGGCTATCTGGAGAGGAGG - Intronic
1057750576 9:97789385-97789407 TGGCAGGCCCTGGGGGGAGGTGG + Intergenic
1057905278 9:98977965-98977987 TGGTTGGTCAGCTGGAGAGGGGG - Intronic
1057930114 9:99185714-99185736 TGGTGGCCTCTCTGGAGAGGGGG - Intergenic
1059895192 9:118856219-118856241 TGGCTGTCCCTTAGTAGAGGTGG - Intergenic
1060557682 9:124517507-124517529 TGGCCGGCCCTTTGGAGACAAGG + Exonic
1061244552 9:129394719-129394741 GGTCAGGCTCTCTGGAGAGGAGG + Intergenic
1062543194 9:137050573-137050595 AGGCTGGTCCTCTGGAGCGGTGG - Intronic
1203367352 Un_KI270442v1:270335-270357 TGGCTGGCACGATGGGGAGGAGG - Intergenic
1185689270 X:2139731-2139753 TGGCTGGCTGTCTGGATAGATGG - Intergenic
1185871558 X:3668951-3668973 TGGCTGTCACGCTGGAGTGGGGG + Intronic
1186740956 X:12517718-12517740 TGGCTGCCCCTTGGCAGAGGGGG + Intronic
1187232021 X:17432592-17432614 GGGCTGACCTTCTGGAGAAGGGG - Intronic
1190113934 X:47613431-47613453 TGGTTGGCCTTCTGGAGGGATGG - Intronic
1191866296 X:65706455-65706477 GGGGTGGCCCCCTGGGGAGGTGG + Intronic
1192207700 X:69107180-69107202 TGGCTGGCCGGCTGGCCAGGGGG - Intergenic
1193307075 X:79962242-79962264 TGGCTGGCCATCCTGAGGGGAGG - Intergenic
1194133100 X:90106265-90106287 TGGCTGTCCCTTGGTAGAGGGGG + Intergenic
1194339507 X:92691899-92691921 TGGCTTTGACTCTGGAGAGGCGG + Intergenic
1195672013 X:107477744-107477766 GGGGTTGCCCCCTGGAGAGGGGG + Intergenic
1196857959 X:120001071-120001093 TTGCAGGCCCTCTGCAGAAGCGG + Intergenic
1198103931 X:133444996-133445018 TGGTTGGCCCTGTGGAGTAGTGG + Intergenic
1198270369 X:135051390-135051412 TGGCTGGCAGTCTGGAGGAGTGG + Exonic
1200268163 X:154657727-154657749 GGACCGGCCCTCTGGAGGGGAGG - Intergenic
1200478887 Y:3676340-3676362 TGGCTGTCCCTTGGTAGAGGGGG + Intergenic
1200647891 Y:5808680-5808702 TGGCTTTGACTCTGGAGAGGCGG + Intergenic