ID: 1141138237

View in Genome Browser
Species Human (GRCh38)
Location 16:81480610-81480632
Sequence GTTTTGCAGGTGATTTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 231}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141138231_1141138237 -7 Left 1141138231 16:81480594-81480616 CCAGCCTCCCTCTGTTGTTTTGC 0: 1
1: 1
2: 1
3: 35
4: 398
Right 1141138237 16:81480610-81480632 GTTTTGCAGGTGATTTTGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 231
1141138229_1141138237 7 Left 1141138229 16:81480580-81480602 CCCATTCTGCTGCTCCAGCCTCC No data
Right 1141138237 16:81480610-81480632 GTTTTGCAGGTGATTTTGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 231
1141138227_1141138237 13 Left 1141138227 16:81480574-81480596 CCCTGACCCATTCTGCTGCTCCA 0: 1
1: 0
2: 2
3: 16
4: 281
Right 1141138237 16:81480610-81480632 GTTTTGCAGGTGATTTTGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 231
1141138224_1141138237 29 Left 1141138224 16:81480558-81480580 CCACCTGAGTCCAAAGCCCTGAC 0: 1
1: 0
2: 1
3: 24
4: 263
Right 1141138237 16:81480610-81480632 GTTTTGCAGGTGATTTTGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 231
1141138226_1141138237 19 Left 1141138226 16:81480568-81480590 CCAAAGCCCTGACCCATTCTGCT 0: 1
1: 0
2: 0
3: 28
4: 257
Right 1141138237 16:81480610-81480632 GTTTTGCAGGTGATTTTGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 231
1141138230_1141138237 6 Left 1141138230 16:81480581-81480603 CCATTCTGCTGCTCCAGCCTCCC 0: 1
1: 21
2: 1920
3: 65821
4: 45703
Right 1141138237 16:81480610-81480632 GTTTTGCAGGTGATTTTGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 231
1141138228_1141138237 12 Left 1141138228 16:81480575-81480597 CCTGACCCATTCTGCTGCTCCAG 0: 1
1: 0
2: 0
3: 21
4: 301
Right 1141138237 16:81480610-81480632 GTTTTGCAGGTGATTTTGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 231
1141138225_1141138237 26 Left 1141138225 16:81480561-81480583 CCTGAGTCCAAAGCCCTGACCCA 0: 1
1: 0
2: 1
3: 26
4: 281
Right 1141138237 16:81480610-81480632 GTTTTGCAGGTGATTTTGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141138237 Original CRISPR GTTTTGCAGGTGATTTTGGA AGG Intronic
900468911 1:2841398-2841420 TTTTTGCAGGTGCTTTTGATCGG + Intergenic
903431486 1:23304664-23304686 GTTGTGTTGGTGATTTTGGGTGG - Intronic
905014875 1:34770962-34770984 GTTTTGCTTTTGTTTTTGGATGG - Intronic
905874842 1:41426208-41426230 GGTTTGCATGTGAGTTCGGAGGG + Intergenic
911699968 1:100941335-100941357 GTTGTGGAGGTGGTTTTGGTGGG - Intronic
913167150 1:116198769-116198791 ATTCTGCATGTGATTTTGGGAGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915066089 1:153225269-153225291 GTTTTCCAGGTGCCCTTGGATGG - Intergenic
916115858 1:161484593-161484615 GTGTTGCAGGTGCTTTTACAGGG + Intergenic
916433902 1:164759210-164759232 TTTTTGCAGGTGAGGGTGGAAGG + Intronic
917572667 1:176285219-176285241 GTTTTGCTGATTTTTTTGGATGG + Intergenic
917959789 1:180132982-180133004 TTTGTGTAGGTGATTTGGGAAGG + Intergenic
918413382 1:184283774-184283796 GATTGGCAGGGGCTTTTGGAAGG - Intergenic
918941881 1:191010742-191010764 TTTTTGCATGTTATTTGGGAAGG - Intergenic
918951544 1:191146347-191146369 GTTGTGGAGGTGATTTTGGTGGG - Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924150120 1:241121317-241121339 GTTTTGCAGGAGAATTTCAAGGG + Intronic
924365324 1:243286865-243286887 GTTTAGCAAGTAATTTTAGAAGG + Intronic
1072577214 10:96711246-96711268 GTGGTGCAGGTGAGTTGGGAAGG - Intronic
1073783046 10:106860021-106860043 GTTTTGCATTTCCTTTTGGAGGG + Intronic
1074159024 10:110821885-110821907 GTTTTGGAGGTCAGTTTCGATGG - Exonic
1074284442 10:112084847-112084869 GTTTTGTAGGTAATTAAGGAGGG + Intergenic
1074713975 10:116201563-116201585 GTTTGGGAGGTGGTTTTGAAGGG - Intronic
1074843894 10:117379933-117379955 GTTTTGCAGGTGGAGATGGAAGG - Intergenic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1076001401 10:126915799-126915821 GGTGTGCATGTGTTTTTGGATGG - Intronic
1076074670 10:127523611-127523633 GTTTTGCTGGAGTTTCTGGAAGG + Intergenic
1079253078 11:18801852-18801874 GTTCTGCAGATGGTTTTTGAGGG + Intergenic
1080061883 11:27965129-27965151 GTTGTGCTGGGGATTTCGGATGG - Intergenic
1081334366 11:41846087-41846109 TTTTTCCAGGTGATTTTTGTCGG - Intergenic
1081585863 11:44383138-44383160 ATTTGGTAGGTGATTTTGGGTGG + Intergenic
1082031305 11:47606133-47606155 GATTTGCAGCTCATTTTGAATGG + Intergenic
1083402710 11:62435040-62435062 GGTGAGCAGGTGATTTTGGTTGG - Intronic
1083669941 11:64294068-64294090 CATGTGCAGGTGATTTGGGAGGG + Intronic
1084868500 11:72080052-72080074 ATTTGGCAGGTCATTGTGGACGG + Intronic
1086067416 11:82761157-82761179 GTTTTGATTGTGATTTTTGAGGG - Intergenic
1086260200 11:84930793-84930815 GTTTTGCATTTGTTTTTAGATGG - Intronic
1086319420 11:85628968-85628990 GTTTGGCAGGGGAGTTGGGACGG - Intronic
1088902312 11:114127571-114127593 GCTTTTCAGGTGCTTGTGGATGG + Intronic
1089051050 11:115546287-115546309 GTTCAGCAGTTGATTTTGGTGGG - Intergenic
1090836136 11:130455492-130455514 GTTCAGTAGGTGATTGTGGAAGG + Intronic
1090863271 11:130673110-130673132 GCTTTCCAGGTCATCTTGGAGGG + Exonic
1091540463 12:1456336-1456358 GGTTTGCAGGTATTTTTTGAAGG + Intronic
1092758489 12:11787603-11787625 GTTTTGCAGGTGAGTAAGGTGGG + Intronic
1093382919 12:18517133-18517155 CTTTTGCAGGTGATCTTTGGTGG + Intronic
1095266464 12:40164368-40164390 GTTTTTCAGGTGTTTTGGGGGGG - Intergenic
1097655878 12:62362923-62362945 GTTTGGCAGGTGAAGTTAGAAGG + Intronic
1098974247 12:76886027-76886049 GTTTTTCAGCTGAATTTGGATGG - Intergenic
1099810283 12:87572313-87572335 GTTTCTCAGATGATTTTGTAGGG - Intergenic
1101119248 12:101562115-101562137 GTTTTTCAGGTGAGGCTGGAGGG - Intergenic
1107510375 13:41077949-41077971 GTTTTGTAGTTCATTTTGTAGGG - Intronic
1109030138 13:57180043-57180065 GGTTTGCAGCTAAATTTGGATGG + Intergenic
1112256016 13:97831854-97831876 GTTTTGCATGGGATTTTGTATGG - Intergenic
1113017123 13:105840341-105840363 GTTGTGCTGGTGAGTTTGGATGG + Intergenic
1113770660 13:112906361-112906383 GATTTGCAGGTGAATGGGGAAGG + Intronic
1114156709 14:20111848-20111870 GAATTGGAGGTGATTATGGATGG - Intergenic
1115716608 14:36112321-36112343 TTTTTGCAGATATTTTTGGAAGG + Intergenic
1116123497 14:40752068-40752090 GTTTTTGAAGTGAGTTTGGAAGG + Intergenic
1116655435 14:47647238-47647260 CTTTTGAAGTTGATTTTGTAAGG - Intronic
1118253867 14:64187987-64188009 GTTATGCACTGGATTTTGGATGG - Intronic
1118805046 14:69228807-69228829 CTGTTGCAGGTAAATTTGGAAGG + Exonic
1120574124 14:86159649-86159671 GTATTGTATGTGATTTTTGATGG + Intergenic
1121592879 14:95132469-95132491 GTTGTGCAGGGGAAATTGGATGG - Intronic
1121906625 14:97751962-97751984 GTTTTGCAGGTGAAATCTGATGG - Exonic
1122004684 14:98692402-98692424 GTTTTAAAAGTGACTTTGGAAGG + Intergenic
1122506839 14:102236990-102237012 GTGTAGCAGGTGGTGTTGGAGGG - Intronic
1124434009 15:29632898-29632920 GGGGTACAGGTGATTTTGGACGG + Intergenic
1124553586 15:30706196-30706218 GTTTTGCACGTGTTTGGGGAGGG - Intronic
1124677659 15:31699472-31699494 GTTTTGCACGTGTTTGGGGAGGG + Intronic
1124793577 15:32753688-32753710 TTTTAGAAGGTGATTTGGGAGGG + Intergenic
1126102573 15:45128940-45128962 GCGGTCCAGGTGATTTTGGAGGG - Intronic
1127205903 15:56718662-56718684 GATTTGCAGGAGATTTTAGTTGG - Intronic
1127446799 15:59071380-59071402 TTTTTCCAGATGCTTTTGGAAGG + Intronic
1128330575 15:66753067-66753089 ATTTTGCAGGTGAAGTTGAAGGG + Intronic
1128489107 15:68128140-68128162 GTTTTCCAGGTGATTCTAAATGG - Intronic
1128852851 15:70978333-70978355 GTTTTGCAGGTGCTGTAGCAAGG + Intronic
1130150448 15:81307556-81307578 TTTTTGAAGGTCAATTTGGAAGG + Intronic
1131929672 15:97427330-97427352 GTTTTGCAGGGCATTTAGGCAGG - Intergenic
1132381575 15:101370106-101370128 GTTTTCCAGGACCTTTTGGAAGG + Intronic
1134401417 16:13913725-13913747 GCTGTGCAAGTGATTTAGGAAGG - Intergenic
1136523296 16:30811579-30811601 CTTCTGGAAGTGATTTTGGAGGG - Intergenic
1137856368 16:51798255-51798277 GTATTGAAGGTGGTTCTGGAGGG - Intergenic
1138614688 16:58156103-58156125 GTTTTGTGGGTGATTATGGTTGG - Intergenic
1140760778 16:78106729-78106751 TTTTTGCAAGTGATATTGGATGG + Intronic
1140898425 16:79346588-79346610 ATTTTGAAGGTGATGATGGATGG + Intergenic
1141026594 16:80554565-80554587 GCTTTGCTGATGGTTTTGGATGG - Intergenic
1141061690 16:80878730-80878752 CTTATGCAGATGATTTTGGTGGG + Intergenic
1141138237 16:81480610-81480632 GTTTTGCAGGTGATTTTGGAAGG + Intronic
1142910129 17:3082354-3082376 GTCTAGCCTGTGATTTTGGATGG + Intergenic
1142915379 17:3132268-3132290 ATATTGCATGTTATTTTGGAAGG - Intergenic
1143091595 17:4452354-4452376 TTTGTGGAGGTTATTTTGGAGGG + Intronic
1143796885 17:9344165-9344187 GTTTTTCAATTGATTTGGGAAGG + Intronic
1148359585 17:47000758-47000780 GTTCTCAAGGTGACTTTGGAAGG - Intronic
1149041120 17:52189509-52189531 GTTTTCCAGGTGCTGGTGGAAGG - Intergenic
1151179441 17:72315944-72315966 GTTGTGCAGGGGATTTTTTAAGG - Intergenic
1153387907 18:4520073-4520095 TTTTTGCTGTTGATTCTGGAGGG - Intergenic
1155288423 18:24315955-24315977 GTATGTCAGGTAATTTTGGATGG - Intronic
1155326810 18:24672691-24672713 GTATTGGTGGTGCTTTTGGAAGG - Intergenic
1158078094 18:53554903-53554925 GTTACACAGGTGATTTAGGAAGG - Intergenic
1158510139 18:58083293-58083315 TTGTTGCATGGGATTTTGGAAGG + Intronic
1158709418 18:59824214-59824236 GTTTTCCAGGTGCCCTTGGATGG - Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159544233 18:69818887-69818909 GTTTTGCTGGTGATGGTGGGAGG - Intronic
1161122113 19:2534411-2534433 TTTTTGCACTTGATTTTGTAAGG - Intronic
1166332978 19:42089420-42089442 CTTTTTCAGTTGATTTGGGAGGG + Intronic
1166427270 19:42689853-42689875 GTTTTGCATGTGTTGTTGGCTGG + Intronic
926057452 2:9782607-9782629 GGTTAGCAGGTGCTGTTGGAAGG - Intergenic
927214036 2:20656321-20656343 GTTTTGGAGGTCATTTTACATGG - Intergenic
928503363 2:31922043-31922065 GTTTTGTATGTGATGTGGGAAGG - Intronic
928674501 2:33637111-33637133 GTTGTGGAGGTGGTTTTGGTGGG + Intergenic
932292900 2:70597351-70597373 TTTTTGAAGGTGACTTTGCAAGG + Intergenic
933994105 2:87655276-87655298 TTCCTGCAGGTGCTTTTGGAGGG - Intergenic
936299760 2:111295634-111295656 TTCCTGCAGGTGCTTTTGGAGGG + Intergenic
936451102 2:112634649-112634671 TTTGTGCGGGTGATTTTGGCTGG - Intergenic
937493293 2:122392387-122392409 GCTTTGAAGGGGATTATGGAGGG + Intergenic
939861124 2:147421801-147421823 GTTTTACAGGTGCCTCTGGATGG - Intergenic
940153548 2:150629136-150629158 GTTTTATAGGTCATTTTGGGGGG + Intergenic
941670217 2:168284851-168284873 GTTTTGAAAATGATATTGGAAGG + Intergenic
941860148 2:170270865-170270887 CTTTTGTAGTTGAATTTGGATGG + Intronic
943056976 2:182994219-182994241 GTTTTGAAGGTTATGTTGAAAGG + Intronic
943439913 2:187915901-187915923 GTTTAGCTAGTGATTATGGATGG + Intergenic
944989637 2:205220919-205220941 GCTGTGCAGATGATATTGGAGGG + Intronic
945092303 2:206186733-206186755 GTTTTGCAGTTGACTATGGTGGG + Intronic
945846235 2:214948473-214948495 GTTTTCCAGGTGGTTTTGAGGGG + Intronic
947915571 2:233829963-233829985 GCTTTGCAGGTCATCTCGGATGG - Intronic
1169076935 20:2766790-2766812 GTTTTGCTCCTGATTCTGGAGGG + Intergenic
1170123252 20:12934775-12934797 GATTAGCAGGTGATTGTAGAAGG - Intergenic
1172269067 20:33642962-33642984 CTTTTGAAAGTGATTTTGCAGGG - Intronic
1176992213 21:15510686-15510708 CATTTACAGGTGATTGTGGATGG - Intergenic
1177441137 21:21125948-21125970 GTTTTGCAGATAATTTTGGTTGG - Intronic
1177661525 21:24089832-24089854 GTTTTGCAGCTAATTGTGAAAGG - Intergenic
1178900069 21:36591566-36591588 GGTGTGCAGGTGGATTTGGAGGG - Intergenic
1179459809 21:41526643-41526665 GGGTTGCAGGTGATTTTTGAAGG - Intronic
1182456096 22:30451352-30451374 GTCTTGCAGGTGCTTTGGGGAGG + Intronic
1182917710 22:34050476-34050498 GTTTTGGAATTGAATTTGGAGGG + Intergenic
1184749881 22:46479222-46479244 GTCCAGCAGGTCATTTTGGAGGG - Intronic
949604936 3:5642483-5642505 GTTATTCAGGTGGTTTTGGAAGG - Intergenic
950027297 3:9828983-9829005 GTTCTCCAGGTGCTTCTGGATGG - Exonic
950425454 3:12922726-12922748 GTTTTGCAGATGCTTTTCCAGGG + Intronic
950631647 3:14285934-14285956 ATTTTGCATGTAATTTTGGAGGG + Intergenic
951726073 3:25761358-25761380 GTTTTGAATCTGCTTTTGGAAGG + Intronic
953827466 3:46266287-46266309 GTTTTAGAGGTGAGTGTGGAAGG - Exonic
954164741 3:48747733-48747755 GCTTTGCTGTTGATTTTGGATGG - Exonic
956386648 3:68726230-68726252 GATTTGCATGGGTTTTTGGAGGG - Intergenic
956807232 3:72827540-72827562 ATTTTGGAGGTGTTTTTGGTGGG - Intronic
957140018 3:76342193-76342215 GTTTTGGAGATGAGTTGGGATGG - Intronic
957692476 3:83590052-83590074 TTTTTGCAGGTGTTTTATGATGG + Intergenic
958588659 3:96124302-96124324 GATTTGCAAATGACTTTGGAAGG - Intergenic
960099234 3:113721489-113721511 GTTTTGCAGTTGAAGTTAGATGG - Exonic
962028139 3:131570722-131570744 GTTTTGCATGCAATTTTGGGAGG - Intronic
962366934 3:134793150-134793172 GTTTGGCAGCAGAGTTTGGAGGG + Intronic
965333236 3:167403312-167403334 GTTTTGAAGGCGATTTTTGCTGG - Intergenic
965507352 3:169531124-169531146 GGTTTGCAGGTGATGATGGTGGG - Intronic
965744979 3:171915648-171915670 ATTTTCCAGGTCATTTTGGATGG - Intronic
968483207 4:846051-846073 GTTTGGCAGGAGATTTGGGTGGG - Intergenic
968600674 4:1507823-1507845 GGTTTTCAGTTGATTTTGCAGGG + Intergenic
970608677 4:17706112-17706134 GATTTGGAGGTTATTTAGGAAGG - Intronic
972922781 4:43964916-43964938 GTGTTGGAGATGACTTTGGATGG + Intergenic
972958696 4:44424672-44424694 GTTTTGGAGTTGATTTTTTAGGG - Intronic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
975299998 4:72779032-72779054 TTTTTGCAGGTGTTCTTTGATGG - Intergenic
978062348 4:104353499-104353521 GTCTTTCAGTTGACTTTGGATGG - Intergenic
979588996 4:122456301-122456323 GATTTACAGATGATTTTGAATGG - Exonic
979875843 4:125890115-125890137 GTTTTGCAAGTGACTTTATAAGG + Intergenic
982408884 4:155050263-155050285 ATTTTTTAGTTGATTTTGGATGG - Intergenic
982776450 4:159446521-159446543 GTTATGTACGTGATGTTGGACGG + Intergenic
983541949 4:168920546-168920568 GTTTTGCCCTTGATTTTGAATGG - Intronic
983573139 4:169231721-169231743 GTTGTCCAGGTGATTTGGAAGGG - Intronic
985112493 4:186560340-186560362 GTGTTGGAGGTGGTCTTGGAGGG - Intergenic
986496787 5:8350415-8350437 GTATTGGAGGTGGCTTTGGAAGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
991449872 5:66740597-66740619 GTTTTGGAGGTGATCTTAGGAGG + Intronic
992887841 5:81176691-81176713 GTTTTGCATGTGCTTTTGTTGGG + Intronic
993086953 5:83374908-83374930 GTTTTGGAGGTCATCGTGGATGG - Intergenic
994751415 5:103742036-103742058 GTTTTGCATCTGATTTTTAATGG + Intergenic
996813620 5:127548113-127548135 GTTTTCCAGGTGTCTTTGAAAGG + Intronic
996929121 5:128865110-128865132 GTATAGCAGGTGCATTTGGAGGG - Intronic
997510038 5:134447838-134447860 GGTTTCCAAGTGATTCTGGATGG + Intergenic
1001869564 5:175139278-175139300 GTATTTCAGCTGGTTTTGGAAGG + Intergenic
1001912992 5:175536418-175536440 GCTTGGCAGGTGATTTTGGAAGG - Intergenic
1002458087 5:179357364-179357386 CTTGTGCAGGTGACTTTGGCAGG - Intergenic
1002687135 5:181021518-181021540 GTTTAGCCTGTGATTCTGGATGG - Intergenic
1003213121 6:4085672-4085694 ATTTTACAGGTGTTTTTGGTGGG - Intronic
1004562510 6:16762715-16762737 TTGTTGCAGATGATTCTGGAAGG + Intergenic
1007795027 6:44340157-44340179 GTTGGTCAGGTGATTTTGCAAGG - Intronic
1011753178 6:90473593-90473615 GGTTTGCTGGTGCATTTGGATGG - Intergenic
1012201247 6:96408860-96408882 CTTTTACAGGTGTTTTTGAATGG + Intergenic
1012608260 6:101185094-101185116 GTTTTGTAGGTTTTTTTGGGTGG + Intergenic
1012795555 6:103755915-103755937 ATTATACAGGTGTTTTTGGAGGG + Intergenic
1014241978 6:119027927-119027949 GATTTGCAGTTGATTAAGGAAGG - Intronic
1015072058 6:129106384-129106406 ATTTTGCATGTGAGTTTGTATGG + Intronic
1015738505 6:136427312-136427334 TTTTTGAAGGTCATTTTGCAGGG + Intronic
1017685095 6:156905541-156905563 ATTTTACATGTGATCTTGGAAGG - Intronic
1018181750 6:161229243-161229265 GATTTGCAGCTGATTTTCTAAGG - Intronic
1018689758 6:166335186-166335208 GTTGTGGAGGTGGTTTTGGTGGG + Intronic
1021112617 7:16712958-16712980 GTTTTGCAGATTACTTTGGGTGG - Intergenic
1021767644 7:23965711-23965733 TTTGAGAAGGTGATTTTGGAAGG + Intergenic
1021889227 7:25171439-25171461 CATTTGCAGGTGTTTTTGTAAGG - Intronic
1022388505 7:29923894-29923916 GTTTTGCTGGTAATTTAGTAAGG + Exonic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027643367 7:80766103-80766125 TTTTTGAAGATGATTTTGAATGG - Intronic
1030487837 7:110193239-110193261 GCTAGGCAGGTGATTTTAGAGGG - Intergenic
1031081555 7:117263137-117263159 GTTGTGGAGGTTATTTTAGAGGG - Intergenic
1031849826 7:126850409-126850431 GTGTTCCAGGTGTGTTTGGATGG - Intronic
1032494003 7:132347443-132347465 GTGTTGCAGCTGATGTGGGATGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034260420 7:149751824-149751846 GATTTGCACGTAATTTTAGAGGG - Intergenic
1035966110 8:4193738-4193760 GTTTAACAAGTGATTTTGGCTGG + Intronic
1037136802 8:15472433-15472455 ATTTTGCAGGTGACTTTTGAAGG + Intronic
1037443553 8:18942064-18942086 GGTTTTCAGTTGATTTGGGAAGG + Intronic
1038067962 8:23983300-23983322 TTTTTGCTGAAGATTTTGGACGG - Intergenic
1038174693 8:25169810-25169832 GTTCTGCAGGTTATTTGGGGTGG - Intergenic
1038331985 8:26616369-26616391 ATTTTGCAGGGCATTTTGCAGGG + Intronic
1040702439 8:50083264-50083286 ATTTTGCAGTTGATTTTTGAGGG + Intronic
1041205778 8:55496646-55496668 TTTTTGCAGGGGAGTTGGGAGGG - Intronic
1041280662 8:56209244-56209266 CTTTGGAAGCTGATTTTGGAAGG - Intronic
1042060486 8:64811584-64811606 GTATTGCAGATGCTTTTGGATGG + Intergenic
1043937606 8:86159739-86159761 GTTTTCCATGTGGCTTTGGAGGG - Intergenic
1045378154 8:101596262-101596284 GTTTTGCATATCAATTTGGAAGG + Intronic
1045506897 8:102785169-102785191 GTTTTGCAGGAGACTTAGGGGGG - Intergenic
1045782351 8:105881957-105881979 GTTTTACAGTTGTTTTTGGTTGG + Intergenic
1046207692 8:111023002-111023024 GTTTTTCAGGTGGTTTGAGAGGG + Intergenic
1046605502 8:116367236-116367258 GTTTTCCAGAAGATTTTGAATGG - Intergenic
1047507424 8:125490950-125490972 GTTTTTCTGCTGATTTTGGCTGG - Intergenic
1048265933 8:132985938-132985960 ATTTTGCAGGGGGTTGTGGAGGG + Intronic
1048851628 8:138650956-138650978 TTTTTGCAGGTGCCTTTGGTGGG - Intronic
1049227090 8:141459691-141459713 GTGGTGGAGGTGATTTTGGTTGG + Intergenic
1050695186 9:8271267-8271289 GTTTTACTGTTGATTTTTGAAGG + Intergenic
1052436931 9:28442075-28442097 GTTTTGCCTGTGATCTCGGAGGG + Intronic
1054727621 9:68667867-68667889 GTTCTGCACGTTGTTTTGGAGGG + Intergenic
1056250073 9:84738955-84738977 GTTTTGCTGGTGAACTTGGTAGG + Intronic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1058675328 9:107395321-107395343 GTTTTACAGGGGTTTTTGGATGG - Intergenic
1059143089 9:111872954-111872976 GGAGTGCAGGTGATTATGGAAGG - Intergenic
1062037243 9:134387943-134387965 GTTTTGGAGGTGACATTGGGGGG + Intronic
1186083295 X:5957188-5957210 GTAATGCAGGTTATTCTGGAGGG - Intronic
1187432996 X:19241762-19241784 GTTATGCAGATGATTTAGGAAGG + Intergenic
1188330660 X:28867094-28867116 ATTTTGCAGGTCATTTTCCATGG - Intronic
1188347832 X:29089092-29089114 GTTTTGCTGGTGATTTTTTCAGG + Intronic
1188875656 X:35427116-35427138 GTTTTGCAGCTGCTTGGGGATGG - Intergenic
1189641430 X:43076064-43076086 TTTTTGCAGGTGTTTTTTGGTGG - Intergenic
1193599960 X:83499611-83499633 CTTTTGTAGGTGATTGTTGAAGG - Intergenic
1195365007 X:104116790-104116812 GAGTTGGAGGTGATTCTGGAAGG - Intronic
1195689302 X:107610744-107610766 GTCTTGCAGGTCCTTTTTGAGGG - Intergenic
1197842970 X:130769699-130769721 GTGTGTCAGGTGATGTTGGATGG - Intronic
1200169394 X:154061290-154061312 GTTTCGCATGTGATGTTGGAAGG - Intronic
1201274373 Y:12284603-12284625 GTGTAGTAGGTGATGTTGGAGGG + Intergenic
1201351199 Y:13043045-13043067 GTTTGGCAGGAAATTTTGGTTGG - Intergenic