ID: 1141142569

View in Genome Browser
Species Human (GRCh38)
Location 16:81506368-81506390
Sequence TGACCTCTGTTCTTAAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 147}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141142565_1141142569 2 Left 1141142565 16:81506343-81506365 CCTTCACAAAGCCCTGCTGAGAT 0: 1
1: 0
2: 1
3: 21
4: 233
Right 1141142569 16:81506368-81506390 TGACCTCTGTTCTTAAGAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 147
1141142563_1141142569 20 Left 1141142563 16:81506325-81506347 CCCAGAGAAGTTTTCTGACCTTC No data
Right 1141142569 16:81506368-81506390 TGACCTCTGTTCTTAAGAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 147
1141142561_1141142569 22 Left 1141142561 16:81506323-81506345 CCCCCAGAGAAGTTTTCTGACCT 0: 1
1: 1
2: 0
3: 14
4: 205
Right 1141142569 16:81506368-81506390 TGACCTCTGTTCTTAAGAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 147
1141142564_1141142569 19 Left 1141142564 16:81506326-81506348 CCAGAGAAGTTTTCTGACCTTCA No data
Right 1141142569 16:81506368-81506390 TGACCTCTGTTCTTAAGAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 147
1141142567_1141142569 -10 Left 1141142567 16:81506355-81506377 CCTGCTGAGATCTTGACCTCTGT 0: 1
1: 0
2: 1
3: 23
4: 235
Right 1141142569 16:81506368-81506390 TGACCTCTGTTCTTAAGAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 147
1141142562_1141142569 21 Left 1141142562 16:81506324-81506346 CCCCAGAGAAGTTTTCTGACCTT 0: 1
1: 0
2: 3
3: 39
4: 417
Right 1141142569 16:81506368-81506390 TGACCTCTGTTCTTAAGAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 147
1141142566_1141142569 -9 Left 1141142566 16:81506354-81506376 CCCTGCTGAGATCTTGACCTCTG 0: 1
1: 0
2: 3
3: 58
4: 499
Right 1141142569 16:81506368-81506390 TGACCTCTGTTCTTAAGAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141142569 Original CRISPR TGACCTCTGTTCTTAAGAGG TGG Intronic
900769856 1:4532096-4532118 TTACCTCTGTCCTACAGAGGAGG - Intergenic
901574377 1:10189127-10189149 GGACCTCTGTTACTTAGAGGTGG - Intergenic
905307549 1:37029973-37029995 TGACCTAGGGTCTTTAGAGGTGG - Intronic
905338704 1:37263590-37263612 TGACCTCAGTTCTTACCAAGTGG - Intergenic
905378387 1:37541049-37541071 TTACCTTTGTTCTGAAAAGGAGG - Intronic
905654219 1:39675656-39675678 TGAGCTCTGAGCTTCAGAGGAGG - Intergenic
907789528 1:57648336-57648358 TGAACTCTATTCATTAGAGGAGG + Intronic
910680212 1:89855330-89855352 TTATCCCTGTTCTTAAAAGGGGG - Intronic
912149603 1:106841241-106841263 AGACCTCTGTTCTAAATAGCAGG + Intergenic
917654364 1:177111830-177111852 TCTCCTCTGATCTTAAGAGTCGG + Intronic
919509595 1:198445418-198445440 TGACATCAGTTCTTAAGATCAGG + Intergenic
919573521 1:199277967-199277989 TGACTGCTGTTCTTATAAGGAGG + Intergenic
920818985 1:209362708-209362730 TTATCTCTGTTCTGAAGAAGAGG - Intergenic
924770991 1:247079103-247079125 TGGCCTCTGGTCTTTTGAGGAGG + Intergenic
1063375618 10:5552627-5552649 TGACCTGTGTTTTTATGAGGGGG - Intergenic
1068106512 10:52623735-52623757 TGAATTATGTTCTTAATAGGAGG + Intergenic
1068784292 10:60953524-60953546 TCACCTCTGTTATTAAAAAGAGG - Intronic
1071250126 10:83809488-83809510 TGTCCTCTTTTCTTAAGAGTAGG + Intergenic
1074389520 10:113045290-113045312 TTACCCCTGTTCTAGAGAGGAGG + Intronic
1076015449 10:127024058-127024080 TGACCTCTGGTCATCAGAGGAGG - Intronic
1079853315 11:25566565-25566587 TAACCTCAGTTCTTTAGGGGTGG - Intergenic
1081067452 11:38563224-38563246 AAACCTCAGTTCTTTAGAGGTGG + Intergenic
1084327248 11:68408001-68408023 TGACCTCTGTTCTAAAGTATTGG + Intronic
1085366827 11:75955512-75955534 TTACCTCGGTTTTTAAAAGGTGG - Intronic
1085398245 11:76218582-76218604 TTAGCTCTGTTGTTAAGATGGGG + Intergenic
1086430137 11:86729091-86729113 AGACCAGTGTTCATAAGAGGTGG - Intergenic
1089887694 11:121844151-121844173 TGACCACTGTTCTTTGCAGGAGG - Intergenic
1089980024 11:122764599-122764621 TGACCTCTGTTGATGAAAGGTGG + Intronic
1090435029 11:126679470-126679492 TGACCTCTGTTTTATAAAGGAGG + Intronic
1092935989 12:13365230-13365252 TCACCTCTGATATTAAGAGTGGG - Intergenic
1093518393 12:20018614-20018636 TGACGTCTGTTTATAATAGGAGG + Intergenic
1093594884 12:20948247-20948269 TGACCTCTGTTGTTGACATGTGG + Intergenic
1093885270 12:24452366-24452388 TGACCTCTGTGATGAAGTGGAGG - Intergenic
1095564113 12:43600713-43600735 TTATATCTGTCCTTAAGAGGTGG + Intergenic
1096217195 12:49804249-49804271 TGGTCTCTGTTCTTAAGATGAGG - Intronic
1099208621 12:79757468-79757490 TTACCTCAGTTCTTGAGGGGGGG + Intergenic
1103174253 12:118848240-118848262 TGACCACTGGTTTTCAGAGGGGG + Intergenic
1104379527 12:128294814-128294836 AGACCTCCATTCTGAAGAGGAGG + Intronic
1110109874 13:71732619-71732641 TGACCTCTGCTCTAGAGAAGAGG - Intronic
1111779915 13:92709357-92709379 TGACCTATTATCTTAAGAGGGGG - Intronic
1112584519 13:100706430-100706452 TGAGATCTTTTTTTAAGAGGTGG - Intergenic
1115870556 14:37797099-37797121 GCAGCCCTGTTCTTAAGAGGGGG - Intronic
1118756785 14:68850672-68850694 AGCCCTCTGTTCTTAGAAGGTGG - Intergenic
1121818399 14:96945482-96945504 TGACGTCTATTCTTAGAAGGAGG + Intergenic
1127342092 15:58057753-58057775 TGGCCCCTGCTCTGAAGAGGCGG - Intronic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1128337620 15:66797454-66797476 ATACCACTGTTCTAAAGAGGGGG - Intergenic
1129065169 15:72896861-72896883 TGACCTCTGTTAGTAAGAACTGG + Intergenic
1129223222 15:74147046-74147068 GACCCTCTGTTCTTTAGAGGTGG + Intergenic
1129879361 15:78996772-78996794 TGGCCTCTGTACTGAAGATGTGG + Intronic
1130285182 15:82548846-82548868 TGACCTCTGTGATTAACATGTGG - Intronic
1130484803 15:84392771-84392793 TGCCCTCTGATGTTTAGAGGTGG + Intergenic
1136844909 16:33568593-33568615 TGTCCACTGTTCTTCACAGGTGG - Intergenic
1139511211 16:67429688-67429710 TGTCATCTGTCCTTAGGAGGAGG + Intergenic
1141142569 16:81506368-81506390 TGACCTCTGTTCTTAAGAGGTGG + Intronic
1141373637 16:83509570-83509592 TGACCTCTGATTTAAAGAGTGGG + Intronic
1141398531 16:83726237-83726259 TGACCTCTGTTTTTTAGATGGGG + Intronic
1141507194 16:84485568-84485590 TGTCCTCTGTACTTGAGAGTGGG - Intronic
1142428505 16:90013385-90013407 TGAGCTTTGTACTTGAGAGGAGG + Intronic
1203155077 16_KI270728v1_random:1868891-1868913 TGTCCACTGTTCTTCACAGGTGG - Intergenic
1142603268 17:1067661-1067683 TGACCACTCTTGATAAGAGGTGG - Intronic
1145962560 17:28896156-28896178 TGACTTCTGTTCTGAAGACCAGG + Intronic
1154054353 18:10997714-10997736 TGCTCTCTGTTCTTCAGATGGGG - Intronic
1155073450 18:22335961-22335983 CTCCCTCTGTTCTTTAGAGGGGG + Intergenic
1155241215 18:23865543-23865565 TGACCCCTTTTCTCAAAAGGAGG + Intronic
1155280947 18:24239121-24239143 TGACCTCTGCTCTAAGGTGGTGG + Intronic
1156346468 18:36261150-36261172 TGTGCTCTGTTCTTTAGTGGGGG + Intronic
1157471665 18:47993572-47993594 TGACCAATGTTCTGGAGAGGAGG - Intergenic
1161395245 19:4042065-4042087 TAACCTCTGTGCTTCAGAGAGGG - Intergenic
1164952269 19:32346317-32346339 TGCCCCCAGGTCTTAAGAGGTGG - Intronic
1165076517 19:33282587-33282609 TGATCTCTCTTCTTGAGATGGGG + Intergenic
1167906026 19:52661459-52661481 TGACCTCAGTTCTCAATATGGGG + Intronic
926485238 2:13446554-13446576 TGTCATCAGTTCTTAAAAGGGGG + Intergenic
927560316 2:24067165-24067187 AGACCTCTGTTCTAAAGACAAGG + Intergenic
930645890 2:53906512-53906534 TAAACTCTCTTCTTAAAAGGGGG + Intronic
932134896 2:69219738-69219760 TGTCCTCTGTTTTTAACAAGTGG + Intronic
934755461 2:96821295-96821317 TGCCCTTTGTTCCTAAGTGGAGG - Intronic
935258206 2:101331290-101331312 TTTCCTCTGTGCTTAAGATGTGG + Intergenic
935646444 2:105339380-105339402 TGACCATTGTTTTTAAGATGAGG + Intronic
940991747 2:160104259-160104281 TGACCTCTGATCTTCAGCTGAGG - Intronic
943115832 2:183668797-183668819 TGACCTCTGATAGGAAGAGGAGG + Intergenic
945312502 2:208331052-208331074 TGACTTCTGTTCTCTAGGGGAGG + Intronic
1171244710 20:23602108-23602130 TGGCCTCTGTTCTCAAGGGGTGG - Intergenic
1171812876 20:29759618-29759640 GGACCTCTGTTCTTGAAAGCGGG - Intergenic
1172432979 20:34907918-34907940 TGACCTCTGTTAGTAAGAAAAGG + Intronic
1173817460 20:45998918-45998940 TAACCACAGTTCTCAAGAGGAGG + Intergenic
1173929314 20:46805525-46805547 TGACCGGTGTCCTTAAGAAGAGG - Intergenic
1174459440 20:50672356-50672378 TGAGCTCAGTACTGAAGAGGAGG + Intronic
1178327307 21:31656424-31656446 GGACCTCTGTGGTTAAAAGGTGG - Intergenic
1180942534 22:19668669-19668691 TCACCCCCGTTCTAAAGAGGAGG - Intergenic
1183965781 22:41441416-41441438 AGACCTCTGTTCCTGAGAGAAGG - Intronic
1183975697 22:41510841-41510863 GGACCACTGTTCTGAAAAGGAGG - Intronic
949919267 3:8988459-8988481 TGACCTCTGTTAGTGAAAGGGGG + Intronic
955553032 3:60104857-60104879 TGCCCTCCTTTCTGAAGAGGAGG - Intronic
956498988 3:69861349-69861371 TGTCCTGTGTTCTTAAGGGCAGG - Intronic
957611869 3:82477741-82477763 TGTCCTCTGTTCTTCTGATGGGG - Intergenic
958983345 3:100751515-100751537 AAAACTCTGTTCTTATGAGGAGG + Intronic
961975176 3:131016771-131016793 TGACCTCTGTGTTTTATAGGAGG + Intronic
962339020 3:134565703-134565725 TTACCTCTGAGCTTCAGAGGGGG + Intronic
970852467 4:20617511-20617533 TGTCCTCTGTGATGAAGAGGAGG + Exonic
979201057 4:117978601-117978623 TGACCTATGTACTCAAGTGGTGG - Intergenic
979936012 4:126697133-126697155 TGACATCTGTTCTTAACATCTGG + Intergenic
981302752 4:143207736-143207758 TGACCTCTGGTGGTAAGATGGGG - Intronic
986404628 5:7413216-7413238 TGATCTCTATTCTTTACAGGTGG - Intronic
989139257 5:38186734-38186756 TGTCCTCTGTTCTTTTGATGTGG - Intergenic
989329746 5:40242942-40242964 CGACATGTGTTCTTCAGAGGAGG - Intergenic
990342864 5:54841289-54841311 TGACCTCTGTGCAGAAGATGGGG - Intergenic
991219032 5:64190705-64190727 GGACTCCTGTTCCTAAGAGGAGG + Intronic
991749526 5:69786187-69786209 TGACCTCTGTGTTTTAGATGAGG + Intergenic
991763583 5:69948453-69948475 TGACCTCTGTGTTTTAGATGAGG - Intergenic
991783742 5:70169676-70169698 TGACCTCTGTGTTTTAGATGAGG + Intergenic
991801106 5:70366005-70366027 TGACCTCTGTGTTTTAGATGAGG + Intergenic
991827494 5:70644041-70644063 TGACCTCTGTGTTTTAGATGAGG - Intergenic
991842813 5:70823513-70823535 TGACCTCTGTGTTTTAGATGAGG - Intergenic
991876188 5:71170051-71170073 TGACCTCTGTGTTTTAGATGAGG + Intergenic
995668791 5:114575884-114575906 TGACCTCTATTCTTAAAAGTTGG + Intergenic
995744767 5:115392222-115392244 TGACCTCTCTTCTTATCAGAGGG + Intergenic
998473261 5:142399846-142399868 TGCCCTGTGTCCTTAAGAGTAGG + Intergenic
998930766 5:147179005-147179027 TGACATTTGTTCTTAAATGGTGG + Intergenic
999285217 5:150390636-150390658 TGACCTCTCTTCCTGAGGGGTGG + Intronic
1002545432 5:179940134-179940156 TGACCGCTGTGCTTAACAGACGG + Intronic
1002862154 6:1089075-1089097 TGAACTATGATTTTAAGAGGAGG - Intergenic
1007598309 6:43065658-43065680 TGACCTCTTTCCTAATGAGGAGG + Exonic
1009035259 6:58110226-58110248 GGACTGCTGTTGTTAAGAGGTGG - Intergenic
1009210772 6:60860934-60860956 GGACTGCTGTTGTTAAGAGGTGG - Intergenic
1010673507 6:78715026-78715048 TGACCTGTGTTAAGAAGAGGTGG - Intergenic
1015978174 6:138812456-138812478 TGACCTCTGTCCTGAAAAGATGG + Intronic
1016573430 6:145540145-145540167 TGCTCACTGTTCTCAAGAGGAGG - Intronic
1017973068 6:159329699-159329721 TGTCCTCTGTTCTGCAGATGAGG - Intergenic
1018617695 6:165703602-165703624 TTACCTGTGTTCTTAAAAGGGGG - Intronic
1018766579 6:166938383-166938405 TCACCTCTATTCTTGAGAAGTGG - Intronic
1021409806 7:20317471-20317493 TTATCACTGTTCTTTAGAGGAGG - Intergenic
1024788366 7:52934140-52934162 TGACCTCTTTTTTTGAGATGGGG - Intergenic
1030698560 7:112613892-112613914 TTAACTCTGTTCTTTAGAGTAGG + Intergenic
1033098820 7:138453558-138453580 TTACTTCTGTTCTTCAGAGAGGG + Intergenic
1033509928 7:142050174-142050196 TGAAATCTGTTCTTCTGAGGTGG + Intronic
1035037906 7:155907339-155907361 TTACCTCTGTTCTACAGAGGGGG + Intergenic
1037517426 8:19646835-19646857 TGACCTGCATTCTAAAGAGGGGG + Intronic
1040489141 8:47903546-47903568 TGACCTCTGCTCTGAAAAGCAGG - Intronic
1044899201 8:96926107-96926129 TTACAACTGTCCTTAAGAGGTGG - Intronic
1045822899 8:106362052-106362074 TGACCTCTGTGTTTAGCAGGTGG - Intronic
1046606454 8:116376411-116376433 TGACCCCTGGTCTTAAGGGAAGG + Intergenic
1046790755 8:118319273-118319295 TGACCCTTGTTCTTGAGGGGTGG - Intronic
1047726851 8:127691294-127691316 TGACATCTATTCTCAAGGGGTGG - Intergenic
1049876784 8:145028494-145028516 GGACCTCTGTTCTTGAAAGCTGG - Intergenic
1050152897 9:2634780-2634802 AGACCTCAGTTTCTAAGAGGAGG + Intronic
1050371619 9:4927638-4927660 TGACCTCAGATATTAAGTGGTGG - Intergenic
1050594946 9:7195676-7195698 TGAACTCTGTTCCCAGGAGGGGG + Intergenic
1051462029 9:17330049-17330071 TGACTTCTGTTGTTAAAATGTGG + Intronic
1052743831 9:32420042-32420064 TGTGCACTGTTCTTAAGATGTGG + Intronic
1054903511 9:70393684-70393706 TGAGCTCTGTTCTGAAAAGGAGG - Intronic
1057341645 9:94207369-94207391 TGTCCTCAGTTCTAAAGATGAGG - Intergenic
1059514862 9:114883489-114883511 TAGCCTCTGTTTTGAAGAGGTGG + Intergenic
1060279015 9:122203619-122203641 TGACCTCTGTTCTCAGGGGTGGG + Exonic
1061219025 9:129238132-129238154 TGACCCCTGCCCTTAAGAGCTGG + Intergenic
1186782753 X:12929822-12929844 TGACTTCTGTTCTTAAGAAGAGG - Intergenic
1189319855 X:40081279-40081301 TGACCCCTGTTCTTCAGTAGAGG - Intronic
1196358540 X:114824280-114824302 TGCCCTATGTTTTTAAGAGCTGG - Intronic
1199973009 X:152874337-152874359 TGACCTCTGCTCTTAAAGGAAGG - Intergenic
1200136679 X:153878635-153878657 TGAGCACTGGTCTTAGGAGGGGG + Intronic