ID: 1141143649

View in Genome Browser
Species Human (GRCh38)
Location 16:81514196-81514218
Sequence ATCTGGTTTTGTGGTGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141143645_1141143649 3 Left 1141143645 16:81514170-81514192 CCAGTCTATTTGAGGAATGGATT 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1141143649 16:81514196-81514218 ATCTGGTTTTGTGGTGAAGAGGG 0: 1
1: 0
2: 2
3: 21
4: 230
1141143642_1141143649 15 Left 1141143642 16:81514158-81514180 CCGGTGACACTTCCAGTCTATTT No data
Right 1141143649 16:81514196-81514218 ATCTGGTTTTGTGGTGAAGAGGG 0: 1
1: 0
2: 2
3: 21
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141143649 Original CRISPR ATCTGGTTTTGTGGTGAAGA GGG Intronic
900725783 1:4215683-4215705 AGCTGGTTTTGGGCTGGAGATGG + Intergenic
901563361 1:10091211-10091233 ATCTGGCTTTGTGAAGATGAAGG + Intronic
902104425 1:14022094-14022116 ATCTTGTTGAGTGGTGATGAGGG + Intergenic
904199630 1:28811613-28811635 ATCTGGTTTTGTGTACTAGAGGG + Intergenic
906028070 1:42692306-42692328 ATCTGTTTTTGTGGTGCCTATGG + Intronic
906676731 1:47698560-47698582 ATATGGTTCTGTGGTTGAGATGG - Intergenic
907041817 1:51267733-51267755 ATCTTTTTTTGTTGTTAAGATGG + Intronic
907665161 1:56428066-56428088 ATCTGGTCTTGTGGTGGGTAGGG - Intergenic
908145652 1:61239003-61239025 ATTTGCTTTTGCTGTGAAGAAGG - Intronic
908344047 1:63213302-63213324 ATCTGTTTTTGTGGAGAGGTAGG - Intergenic
910369800 1:86503596-86503618 TTCTGGGTTTGTGGTGATGGAGG + Intergenic
911550129 1:99268483-99268505 ATCAGGTATCGTGGTGAACAAGG - Intronic
912218617 1:107646011-107646033 ATCTGGAATTATGCTGAAGATGG + Intronic
912348195 1:108985536-108985558 TTCTTGTTTAGTGGGGAAGATGG - Intronic
913391942 1:118323702-118323724 ATCTGGACTTGTGGTGTACAAGG - Intergenic
915693029 1:157709608-157709630 ACCTGGCTTTTTGGTGAAGCTGG - Intergenic
916655249 1:166869653-166869675 TTTTGGTTTTGTGGTGTATAAGG - Intronic
920857786 1:209676934-209676956 ATCTGGATTCGTGGGGAGGAAGG - Intergenic
924414330 1:243843572-243843594 ATGTGTATTTGAGGTGAAGAGGG + Intronic
1064847766 10:19674761-19674783 GTCTTGTTTTAAGGTGAAGAAGG - Intronic
1065162481 10:22937466-22937488 ATGTGGGTTGGTGGAGAAGATGG + Intronic
1066335083 10:34468134-34468156 CTCTGCTTTCGTGGTGAAGGAGG - Intronic
1068297481 10:55092588-55092610 ATTTTGTTTTATGGTGAAAAAGG - Intronic
1074453648 10:113579305-113579327 ATGTGGGTTGGTGGTGATGATGG + Intronic
1074876822 10:117620172-117620194 ACCTGCTTGTGTGGGGAAGAGGG + Intergenic
1076169592 10:128308264-128308286 ATCAGGCTGTGTGGTGGAGACGG + Intergenic
1078511617 11:11988559-11988581 AGGAGGTTTTGTGGTGATGATGG - Intronic
1080264366 11:30386132-30386154 AACTGGTTGTGTGGTGGAGAAGG + Intronic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1081554449 11:44145056-44145078 ATCTAGTTTTTTTCTGAAGATGG - Intronic
1083465163 11:62840753-62840775 TTTTGGTTTTTTAGTGAAGACGG + Intronic
1084559480 11:69894774-69894796 AACAGGTTTTCTGGAGAAGAAGG + Intergenic
1088763890 11:112958405-112958427 ACCTGGGTATGTTGTGAAGATGG - Intergenic
1089585030 11:119504997-119505019 AGCTGGTCTTGAGGTGAAAAAGG + Intergenic
1091061322 11:132465343-132465365 ATGTGGCTTTGTTGTGAATAAGG - Intronic
1095809603 12:46357794-46357816 ATCTGGTTTTTTACTTAAGAAGG - Intergenic
1096045096 12:48555332-48555354 CTCTGGTGTCGTGGTGCAGAGGG - Intergenic
1096386078 12:51196217-51196239 ATCTGGGTTTGGGGTGGAGCTGG - Intronic
1096787892 12:54028217-54028239 AACTGGTTTGGTGGTGAAGGAGG - Intronic
1100756452 12:97756436-97756458 ACCTTGTTTTGTGGTTTAGAAGG + Intergenic
1101711261 12:107268938-107268960 ATCTGGATTTCTGGTATAGAAGG + Intergenic
1103394494 12:120597419-120597441 ATGTGGATTTAGGGTGAAGAGGG + Intergenic
1105325963 13:19370819-19370841 ACCTGGTGATGTGGAGAAGAAGG + Intergenic
1105867541 13:24474275-24474297 ACCTGGTGATGTGGAGAAGAAGG - Intronic
1108101088 13:46956674-46956696 ATATGGTATTCTGGAGAAGAAGG - Intergenic
1109310960 13:60692774-60692796 AGCAGGCTTTGTGGTGAAGATGG + Intergenic
1109788114 13:67208890-67208912 TTCTGATTTTATGGTGAAGTTGG + Intronic
1115141601 14:30177678-30177700 ATCTGGGGTTGTGGGGAGGAGGG + Intronic
1116242969 14:42370427-42370449 ATATGAATTTGTGGTGAAGGGGG - Intergenic
1117184803 14:53228879-53228901 AACTGGCTTTGTGGGGGAGATGG - Intergenic
1118115705 14:62774218-62774240 TTCTGGTTTTGTACTGGAGATGG + Intronic
1118440982 14:65811589-65811611 GTCTGGTTTTTTGGGGAAGGAGG - Intergenic
1118867028 14:69712003-69712025 TTCTGGGTTTGTGGTGACGGAGG + Exonic
1119020107 14:71103382-71103404 TTCTGGTTTTCAGGTGAATAAGG + Exonic
1119124332 14:72111691-72111713 ATGTGGTCTTCTTGTGAAGATGG - Intronic
1120307751 14:82791868-82791890 ATATGGTTGTGTGTTGATGATGG + Intergenic
1121879286 14:97485652-97485674 ATCTGCTTATGTGGAGGAGAAGG - Intergenic
1125214369 15:37253377-37253399 ATCTGGTTTTATTTTGAACATGG - Intergenic
1126841445 15:52721221-52721243 ACCTGGTTCAGTGGGGAAGAGGG + Intergenic
1128595480 15:68943534-68943556 ATCTGTTTTTGAGGTGAAATGGG + Intronic
1128718020 15:69923272-69923294 ATCTGGTAATGAGATGAAGAGGG - Intergenic
1130227639 15:82072097-82072119 TTTTGTTTTTGTGGTAAAGATGG + Intergenic
1133346588 16:5075231-5075253 ATCTATTTTGGTGGTGGAGAGGG + Intronic
1133952705 16:10410094-10410116 TTCTAGTTTTGTGAAGAAGATGG + Intronic
1134075852 16:11290774-11290796 ATCTGGTTGTGTGTTAAAGATGG + Intronic
1137061110 16:35792418-35792440 TTCTGGATTTGCGGTGAAGTGGG - Intergenic
1139056131 16:63186843-63186865 TTCTGATTTAGTGGTGAAAATGG - Intergenic
1141143649 16:81514196-81514218 ATCTGGTTTTGTGGTGAAGAGGG + Intronic
1142012050 16:87720498-87720520 CTGTGGTTGTGTGGTGAGGAGGG - Intronic
1143372898 17:6451453-6451475 AGATGGTTCTGTGGTGAAAAAGG - Exonic
1143460964 17:7103076-7103098 ACCTGGTTTTGTGGAGAAAGTGG + Intronic
1144615012 17:16761386-16761408 ATATAGTTTTGTAATGAAGAAGG - Intronic
1145483002 17:23712099-23712121 TTGTGGTTTTGTGGTGGAAAAGG + Intergenic
1145609500 17:25552915-25552937 TTGTGGTTTTGTGGTGGAAAAGG + Intergenic
1145623110 17:25751440-25751462 TTGTGGTTTTGTGGTGGAAAAGG + Intergenic
1145942564 17:28750243-28750265 ATCGGGCTTTGTGTGGAAGACGG + Exonic
1154027657 18:10723820-10723842 ATCTGCTTTTGGGGAGCAGAGGG - Intronic
1158425199 18:57333895-57333917 ATCTGCCTGTGTGGTGTAGAAGG - Intergenic
1158651840 18:59295302-59295324 ATCTGGGTTTGTGGACTAGAAGG + Intronic
1159907588 18:74110338-74110360 AACTGGATTTGTGGTAAATATGG + Intronic
1160083941 18:75756706-75756728 ACCTGATTTTTAGGTGAAGAGGG - Intergenic
1160089503 18:75813052-75813074 CTTTGGTTTTCTGGTCAAGAAGG + Intergenic
1161317753 19:3626188-3626210 TTCTGGCTTTGAGGTGGAGAAGG - Intronic
1163869151 19:19803650-19803672 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163903511 19:20129610-20129632 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163911999 19:20203876-20203898 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163917311 19:20252462-20252484 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163925095 19:20333427-20333449 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163931087 19:20392841-20392863 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163932310 19:20407750-20407772 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163936755 19:20453357-20453379 ATCTGAATTTGTAGTGAAGAGGG + Intergenic
1163941404 19:20498372-20498394 CTCTGAATTTGTAGTGAAGAAGG + Intergenic
1163956296 19:20644471-20644493 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163959915 19:20679945-20679967 CTCTGAATTTGTAGTGAAGAGGG + Intronic
1163974518 19:20837247-20837269 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164102938 19:22075081-22075103 CTCTGGGTTTGTGATGGAGAGGG + Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1166026105 19:40086570-40086592 AATTGGTTATTTGGTGAAGAAGG - Intronic
1166220993 19:41364384-41364406 ATTTGCTTTTTTGGTAAAGAAGG - Intronic
1167101236 19:47405485-47405507 TTCTGGTCTTGTGGGGAAGTTGG - Intronic
1168493984 19:56835182-56835204 ATCTGGTTTCAGGGTGCAGAAGG - Intronic
925251585 2:2443481-2443503 ATCTAGTTTTCTGATCAAGATGG - Intergenic
928354849 2:30602340-30602362 ATCTGGTATTCTGGTGCAGAAGG - Intronic
928429002 2:31202433-31202455 CTCTGGTTTTGGGGTCAAGTTGG - Intronic
929945538 2:46369012-46369034 ATCTGGTTTTGATGGGAAGTGGG - Intronic
931678367 2:64720758-64720780 CTCTGGTTTTGTGATGCAGACGG - Intronic
932021356 2:68090628-68090650 AATTGGTTTTGAGGTGAAGTGGG + Intronic
934578689 2:95420495-95420517 ATTTGGTGTTGTGGTGAATGGGG - Intergenic
934600754 2:95656214-95656236 ATTTGGTGTTGTGGTGAATGGGG + Intergenic
935597686 2:104892211-104892233 ATTTTGTCCTGTGGTGAAGATGG + Intergenic
935634414 2:105238693-105238715 AGATGGTTCTGTGGTGAGGACGG - Intergenic
936534128 2:113298352-113298374 ATTTGGTTTTGTGGTGAATGGGG + Intergenic
937089600 2:119197043-119197065 AACTGGTTTTCTGGTGGAGGGGG + Intergenic
937492949 2:122388713-122388735 ATCTGGCTCTGGGGTGATGAGGG + Intergenic
937684810 2:124683785-124683807 TTCTGTTTTTGTCTTGAAGAGGG - Intronic
938967251 2:136399439-136399461 ATTTTGTTTTGTGGTGGATATGG - Intergenic
940578075 2:155539922-155539944 ATCTTGTTTTTTGATGAATATGG + Intergenic
941083102 2:161085533-161085555 ATCTGGTTCTGCTGTGAAAAAGG + Intergenic
943520352 2:188942062-188942084 AACAGGTGTTGTAGTGAAGATGG - Intergenic
948183148 2:235998931-235998953 ATATGGTATGGTGGTGATGATGG + Intronic
948183173 2:235999074-235999096 ATATGGTATGGTGGTGATGATGG + Intronic
948183192 2:235999209-235999231 ATATGGTATGGTGGTGATGATGG + Intronic
948183216 2:235999374-235999396 ATATGGTATGGTGGTGATGATGG + Intronic
1170164397 20:13346342-13346364 ACCTGGATTTTTGGTAAAGATGG + Intergenic
1171301079 20:24061047-24061069 AGCTGGCTGTGTGGTGGAGATGG - Intergenic
1173265161 20:41472463-41472485 TTATGGGTATGTGGTGAAGAAGG - Intronic
1173672584 20:44809289-44809311 ATTTGGTTCTGGGGTGAGGAAGG - Intronic
1174063097 20:47846100-47846122 ATCTGTCTTTGTGGTGACCAAGG + Intergenic
1174573516 20:51521215-51521237 ATCTGGTATGGGGGTGAACAAGG + Intronic
1175060062 20:56233800-56233822 CTCTTCTTTTGTGGTGAACAAGG + Intergenic
1175315850 20:58046013-58046035 CTCTGGGGTTGTTGTGAAGATGG + Intergenic
1175989839 20:62782958-62782980 ACCTGGTTTTGCTCTGAAGATGG + Intergenic
1176876487 21:14135331-14135353 ATCTGATTTTTTGGTTATGAAGG - Intronic
1178065133 21:28896194-28896216 TGCTGGTTTTGTTTTGAAGATGG + Intergenic
1178747720 21:35269204-35269226 TCCTGGTGTTTTGGTGAAGACGG - Intronic
1180540337 22:16440560-16440582 TTCTTATTTTGTTGTGAAGATGG - Intergenic
1182345205 22:29658367-29658389 TTATGGTTCTGTGGTAAAGAAGG + Intronic
1184469787 22:44690001-44690023 AGGTGGTTTTGTGGTCCAGAGGG + Intronic
1184627612 22:45749379-45749401 ATCTTCTTTTGTGGTGACGGTGG - Intronic
1184707459 22:46224368-46224390 CTCTGGTTTTGTGGCCAAGGTGG + Intronic
955370622 3:58348345-58348367 GTCTGGTTCTGTGGTTCAGAAGG - Intronic
956556411 3:70528227-70528249 ATCTGGGTAGGGGGTGAAGAAGG - Intergenic
960025895 3:113008940-113008962 ATCTGGTGGTGTAGCGAAGAGGG - Intronic
960812195 3:121635944-121635966 ATGTTGTTTTGTGGTAGAGAGGG + Intronic
961550735 3:127669357-127669379 ACATGGTTTTGTGGGAAAGACGG + Intronic
964323752 3:155525010-155525032 ATCTTGTTTTTTGGTGGAGGGGG - Intronic
964945244 3:162214658-162214680 TTCTGGTTATGAGGAGAAGAAGG - Intergenic
965199689 3:165641875-165641897 ATCTGGTTCTGTTGTGGAGAAGG - Intergenic
970124199 4:12791148-12791170 ATCTGGTTTTATGGGTAAAATGG - Intergenic
971959509 4:33467534-33467556 ATCTGGGCTTGTTGTGAAGTGGG - Intergenic
975100903 4:70512102-70512124 ATTTTTTTTTGTGGTGATGAAGG - Intergenic
976782698 4:88778583-88778605 ATCTGGGTTTGAGATGATGATGG - Intronic
977242275 4:94587336-94587358 ATCTGTTTTTGTTGTGATTAGGG + Intronic
977707720 4:100089804-100089826 ATGTGGTGATGTGGTGAAAAGGG - Intergenic
978308686 4:107361533-107361555 AAATGGGTCTGTGGTGAAGATGG + Intergenic
978429536 4:108619355-108619377 ATCTGGTGTTGTGACAAAGATGG + Intergenic
978909353 4:114046731-114046753 CCCTTTTTTTGTGGTGAAGAAGG + Intergenic
980663540 4:135899087-135899109 ACCTGGTCATGTGGTAAAGAAGG + Intergenic
981932497 4:150206028-150206050 ATTGGGTTTAGAGGTGAAGATGG - Intronic
983641199 4:169945376-169945398 ATCTGGTTTAGGGGTGAAGGTGG + Intergenic
983701764 4:170605281-170605303 ATCTGGATTTCTGGTCCAGATGG + Intergenic
984399312 4:179241274-179241296 ATCTGCTGTTTTTGTGAAGATGG - Intergenic
984563710 4:181301915-181301937 ACCTGGCGTTGGGGTGAAGAGGG - Intergenic
986495540 5:8338345-8338367 TTCTGGTTTCTTGGTCAAGATGG - Intergenic
986739415 5:10692971-10692993 ATCCTATTTTGGGGTGAAGAAGG - Intronic
987847704 5:23307515-23307537 AGCAGGTATTGTGGTGTAGATGG + Intergenic
989290626 5:39761023-39761045 ATCTGTTTCTGTGGTGATGGAGG - Intergenic
990389345 5:55302892-55302914 TTTTGGTTTTGTGTTTAAGATGG + Intronic
995358732 5:111269397-111269419 ATCTGGTTGTGTGGGGGAAAGGG + Intronic
995449676 5:112286783-112286805 TTTTGGTTTTGTTTTGAAGATGG - Intronic
998280684 5:140803718-140803740 TTGTGGTTTTGTGGTTAAAACGG + Intronic
1003964826 6:11242744-11242766 ATCTGTTTTTAGGGTGAGGAAGG - Intronic
1006326279 6:33356394-33356416 TTCTGGGTTTGTGGTGACGGAGG + Intergenic
1007798098 6:44367570-44367592 ATCTGGGTGTGTGGCAAAGATGG + Intronic
1007816552 6:44529204-44529226 AGCTGGTTTTGTGGGGAGGCAGG + Intergenic
1008449654 6:51635838-51635860 AACTGTATTTGTGGTGAAGGTGG + Intronic
1009924389 6:70102393-70102415 CTCTTGGTTTGTGGTGATGATGG - Intronic
1010124305 6:72414369-72414391 ATCTGGTTTGCTGGGGAAGGAGG - Intergenic
1011979648 6:93357025-93357047 ATGAGGTTCTGTGGTGCAGATGG + Exonic
1012068928 6:94586779-94586801 ATGAGGTGTTGTGCTGAAGAAGG - Intergenic
1016143384 6:140641479-140641501 ACCTGGATTTTTGGGGAAGAGGG - Intergenic
1016431164 6:143987639-143987661 AGCTGGCTTCTTGGTGAAGAAGG - Intronic
1016701241 6:147056621-147056643 TTCTGTTTTTGTTATGAAGATGG + Intergenic
1017416148 6:154222966-154222988 ATTTCGTTTTGTGGAGCAGATGG - Intronic
1017844791 6:158247941-158247963 CTCCGGTTTTGTGGCTAAGAGGG - Intronic
1021141764 7:17034260-17034282 ATCTGATCTTGTGGTGGGGAAGG - Intergenic
1021747654 7:23758895-23758917 ATGTGTTTTTGTGCGGAAGATGG - Intronic
1023132479 7:37016569-37016591 ATCTGGGTTTATGTTGAAGGAGG - Intronic
1024133712 7:46384774-46384796 ATTTTTTTTTGTTGTGAAGAAGG + Intergenic
1024443361 7:49447289-49447311 AGCTGGTTTTGTGGTGGGCAGGG - Intergenic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025947505 7:66115474-66115496 GGCTGGTTTTGGGGTGGAGAAGG + Intronic
1026305088 7:69133755-69133777 TTCTGGTTTTGGGGAGAAGATGG - Intergenic
1031139789 7:117929754-117929776 TGCTGATTTTGTGATGAAGAGGG - Intergenic
1031283584 7:119837699-119837721 TTTTGTTTTTGTGGGGAAGAAGG - Intergenic
1031603513 7:123742629-123742651 AACTGCTTTTTTGGTTAAGATGG - Intronic
1032224232 7:130017915-130017937 ATCAGTTTTTGTGGTAGAGAAGG - Intergenic
1033522120 7:142171253-142171275 ATCTGCTTTTGTGTTGCAGTTGG + Intronic
1033911472 7:146268594-146268616 AGCTGTTTTGGTGGTGGAGATGG - Intronic
1034054906 7:148023906-148023928 AATTGCATTTGTGGTGAAGAAGG + Intronic
1035098410 7:156376219-156376241 TCCTGATTTTGTTGTGAAGATGG + Intergenic
1035561431 8:607106-607128 TTCTGGTTTTCAAGTGAAGACGG + Intergenic
1038750554 8:30291524-30291546 ATCTGGATTTTTGTTTAAGAGGG + Intergenic
1040896051 8:52369431-52369453 ATCTGGTACTGTGTTGATGAGGG + Intronic
1042164398 8:65931317-65931339 ATGTGTGTTTGTGGTGGAGATGG + Intergenic
1042497905 8:69476211-69476233 ATTTGTCTTTGTAGTGAAGAAGG - Intronic
1042657398 8:71115087-71115109 ATCTGGCTTGGAGGTGAGGATGG - Intergenic
1043424310 8:80133445-80133467 ATCTGGTTTTGGAGGGAAGAAGG - Intronic
1044206099 8:89493497-89493519 ATCTGGTTTTCTGGGGAAGTTGG - Intergenic
1044429274 8:92089686-92089708 ATCTGTTTATGTAGTGAGGAGGG - Intronic
1045664171 8:104467669-104467691 AACTGGTTTTGTGGAAAAGCTGG - Intergenic
1045775500 8:105797710-105797732 AGCTGGTTTGGTGGAGAAGAGGG - Intronic
1046392719 8:113597628-113597650 ATATTGCTTTGTTGTGAAGATGG + Intergenic
1047135696 8:122075592-122075614 ACCTGGTTATGTAGTGATGAAGG + Intergenic
1047385632 8:124406615-124406637 ATCTGTTTTTGTTTTGAAGATGG - Intergenic
1050073843 9:1843579-1843601 ATATGGTTTTGGGGGGAACATGG - Intergenic
1052283113 9:26754997-26755019 AGCTGGTTTTGGCTTGAAGAGGG - Intergenic
1052738848 9:32374178-32374200 GGCTGGTCTTGTGGTGAAGGAGG - Intergenic
1053569907 9:39293600-39293622 ATCTGGATTTGGGCTGGAGATGG + Intergenic
1053835870 9:42134630-42134652 ATCTGGATTTGGGCTGGAGATGG + Intergenic
1054091537 9:60852602-60852624 ATCTGGATTTGGGCTGGAGATGG + Intergenic
1054112952 9:61128176-61128198 ATCTGGATTTGGGCTGGAGATGG + Intergenic
1054127242 9:61325410-61325432 ATCTGGATTTGGGCTGGAGATGG - Intergenic
1054594761 9:67054015-67054037 ATCTGGATTTGGGCTGGAGATGG - Intergenic
1059316835 9:113432982-113433004 AACTTGTTTTGGGGAGAAGAGGG + Intergenic
1059916010 9:119101197-119101219 ATCTGGGTTAGAGGTGAAGTGGG - Intergenic
1060254910 9:122018990-122019012 AGCGGGTTTAGTGGAGAAGAAGG - Intronic
1061068497 9:128294231-128294253 ACCTGGTTTTATGGTGAAGGAGG + Intergenic
1185962319 X:4558040-4558062 AAATGGTTTTCTGGTGAAGGAGG - Intergenic
1186637091 X:11418146-11418168 TTCTGGTTCTGTTGTGAATATGG + Intronic
1187974656 X:24693411-24693433 TTCTGGTTATTTGGTTAAGACGG + Intergenic
1188308525 X:28587864-28587886 ATCTGCTTTTATGGTGAACTTGG + Exonic
1192507593 X:71698397-71698419 TTCTGGGTTTGTGGTGACGGAGG + Intergenic
1192519103 X:71783155-71783177 TTCTGGGTTTGTGGTGACGGAGG - Intergenic
1192791179 X:74383072-74383094 TTCTGCTTTTGGGTTGAAGAAGG - Intergenic
1193027421 X:76859182-76859204 TTGTGGTTTTGTGTTGAATATGG - Intergenic
1194727841 X:97419038-97419060 ATCTGCTTTTGAGGTGCTGAAGG - Intronic
1195532327 X:105970528-105970550 CTCTGGTCCTGTGGTGAACATGG + Intergenic
1197050070 X:122046966-122046988 ACCTGGCTTTGTAGTGAACAGGG - Intergenic
1199076620 X:143533273-143533295 CTCTTCTTTAGTGGTGAAGAAGG + Intergenic
1199322359 X:146455586-146455608 ACCTGGGATTGTGGTGCAGAGGG + Intergenic