ID: 1141143852

View in Genome Browser
Species Human (GRCh38)
Location 16:81515343-81515365
Sequence TTTTCCATCTAGAAGCGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141143852_1141143858 14 Left 1141143852 16:81515343-81515365 CCCTCACGCTTCTAGATGGAAAA 0: 1
1: 0
2: 1
3: 4
4: 122
Right 1141143858 16:81515380-81515402 TTGGAGGGCACTGACGTGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 471
1141143852_1141143856 -2 Left 1141143852 16:81515343-81515365 CCCTCACGCTTCTAGATGGAAAA 0: 1
1: 0
2: 1
3: 4
4: 122
Right 1141143856 16:81515364-81515386 AAACACAAGGTCTGTGTTGGAGG No data
1141143852_1141143857 -1 Left 1141143852 16:81515343-81515365 CCCTCACGCTTCTAGATGGAAAA 0: 1
1: 0
2: 1
3: 4
4: 122
Right 1141143857 16:81515365-81515387 AACACAAGGTCTGTGTTGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 181
1141143852_1141143855 -5 Left 1141143852 16:81515343-81515365 CCCTCACGCTTCTAGATGGAAAA 0: 1
1: 0
2: 1
3: 4
4: 122
Right 1141143855 16:81515361-81515383 GAAAAACACAAGGTCTGTGTTGG 0: 1
1: 0
2: 5
3: 37
4: 312
1141143852_1141143859 24 Left 1141143852 16:81515343-81515365 CCCTCACGCTTCTAGATGGAAAA 0: 1
1: 0
2: 1
3: 4
4: 122
Right 1141143859 16:81515390-81515412 CTGACGTGTGTGGCGATGTAAGG 0: 1
1: 0
2: 0
3: 2
4: 44
1141143852_1141143860 29 Left 1141143852 16:81515343-81515365 CCCTCACGCTTCTAGATGGAAAA 0: 1
1: 0
2: 1
3: 4
4: 122
Right 1141143860 16:81515395-81515417 GTGTGTGGCGATGTAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141143852 Original CRISPR TTTTCCATCTAGAAGCGTGA GGG (reversed) Intronic
907573047 1:55501522-55501544 CTTTCCATCTTGAGGGGTGAGGG + Intergenic
908792345 1:67795295-67795317 CTTTCCACCTAGAAGTCTGACGG + Intronic
909196296 1:72629230-72629252 GGTTCCATCTAGAAGCGTTTTGG + Intergenic
910617155 1:89211258-89211280 TTTTCCCTGTATAAGCATGAAGG - Intergenic
912956299 1:114156001-114156023 TTCTCAATCTAGCAGTGTGAAGG + Intergenic
916306422 1:163339639-163339661 TCAACCATCTAGAACCGTGATGG + Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918917188 1:190658325-190658347 TTATCCATCTAGAATTGTTATGG + Intergenic
918917190 1:190658357-190658379 TTATCCATCTAGAATTGTTATGG + Intergenic
1063985150 10:11494235-11494257 TTTTCTCTCTAGAAGCTTGTAGG + Intronic
1064589400 10:16873143-16873165 CTTTCCATACAGAAGCCTGATGG - Intronic
1067835455 10:49636431-49636453 TTTTCCATCTATATTTGTGAGGG + Intronic
1070291935 10:75123025-75123047 TTTTGCATCTATATTCGTGAGGG + Intronic
1071255632 10:83869448-83869470 TATTCCATCTTGAAGTGAGAGGG + Intergenic
1073426484 10:103458383-103458405 TTTGCCGTCGAGTAGCGTGACGG + Exonic
1073515012 10:104068530-104068552 TTGGCCTTCTAGAAGCTTGAGGG - Intronic
1074621463 10:115128311-115128333 TTTTATATCTAGAAGACTGAGGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079182436 11:18205133-18205155 TTTGCCACCTAGGAGCCTGAGGG + Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083343707 11:61975119-61975141 TTTTTCATGCAGAAGAGTGAGGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088767634 11:112999237-112999259 TTTTCCACTTAGAGGAGTGAAGG - Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090500604 11:127257254-127257276 TTTTCCATATTGAAGGCTGAGGG + Intergenic
1093225643 12:16479998-16480020 GTTTCCTTCTAGAAGTGTTATGG - Intronic
1094346758 12:29478586-29478608 TTTCCCTTCTAGAAGGGTTAAGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097593186 12:61596503-61596525 TTTTCCATCCAGAAAGTTGAGGG - Intergenic
1099231317 12:80028877-80028899 TTTTCCAGCTAGAACCATGGAGG + Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101859113 12:108468363-108468385 TTTTCCATCAAGAAGAGGAAAGG + Intergenic
1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG + Intergenic
1111851504 13:93581809-93581831 TTTGCTCTCTAGAAGCCTGAGGG + Intronic
1112102346 13:96203086-96203108 TTCTCCATATAGAAGCATGTTGG + Intronic
1112937084 13:104814311-104814333 TTTTCCAACTGGAATCGTGGAGG + Intergenic
1120060060 14:79971723-79971745 TATTGCATCTAGAAGTATGAGGG + Intergenic
1120124682 14:80727321-80727343 TTTTGCATTTAGAAGCCTCAGGG + Intronic
1120509998 14:85401695-85401717 CTTTCCAGCTAGAAGCCTCAGGG + Intergenic
1122758664 14:104003473-104003495 ATATCTATCTAGAAGGGTGAAGG - Intronic
1124157796 15:27243223-27243245 TTTTCCATGTAGATGCAAGAAGG + Intronic
1124851343 15:33341602-33341624 TCTACCATCTAGAAGCAGGAGGG + Intronic
1125414938 15:39442479-39442501 AATTCCATCTAGCAGAGTGAAGG - Intergenic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1129453132 15:75661833-75661855 TTTCCCCTCTAGATGAGTGAAGG + Exonic
1129702722 15:77776908-77776930 TTTTCCACCTAGAAGCTGGGTGG - Intronic
1134805570 16:17121333-17121355 TTTTCAACCGAGGAGCGTGAAGG + Intronic
1135292886 16:21255383-21255405 TTTTCCAGGCAGAAGGGTGATGG - Intronic
1135664486 16:24324586-24324608 TTCTCCATCTGGCAGCCTGAGGG + Intronic
1141143852 16:81515343-81515365 TTTTCCATCTAGAAGCGTGAGGG - Intronic
1143813105 17:9488431-9488453 TATTCCATCTACAAGCTTAATGG - Intronic
1147673183 17:42188683-42188705 TTTTCCATCTTGGAGGCTGATGG - Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1166042246 19:40211046-40211068 TTTTCCATCTGGAAGCCCTATGG + Intronic
1166862734 19:45819228-45819250 TTCTCCATATAGCAGCCTGAAGG + Intronic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
928081925 2:28319512-28319534 TTGTCCAGCTAGAACCCTGAGGG - Intronic
928796902 2:35034088-35034110 AGTTCCATCTAGAAGCTTGGAGG + Intergenic
940098672 2:150008147-150008169 TTTTCCAGCTAGCAGCAAGAGGG + Intergenic
940726061 2:157337888-157337910 TTTTCCATCCAAAATCCTGAGGG + Intergenic
941599374 2:167522139-167522161 TTTCCCTTCTAGAAGCCTTATGG - Intergenic
943034945 2:182731735-182731757 TTTTCAATATAGCAGCATGAAGG - Intronic
943833930 2:192495106-192495128 ATTTCCATCTAGAAGGGGAAAGG - Intergenic
945510923 2:210701924-210701946 TTTTCCATCTAGCAGTGGAAAGG + Intergenic
1169381825 20:5113740-5113762 ATTTCCATCTAGATTGGTGATGG - Intergenic
1170317186 20:15055413-15055435 TTTCTCATCTAAAAGCATGAAGG + Intronic
1172322718 20:34009144-34009166 TTTTCCATTTATAAGAGTGGGGG + Intronic
1173400435 20:42721516-42721538 TTGTCCAACCAGAAGCCTGAGGG - Intronic
1178679729 21:34663713-34663735 TTTTTCATCTGGAACAGTGAGGG - Intergenic
1180968894 22:19804680-19804702 TTTTCCATCCCCAAGCCTGAGGG - Intronic
1184492560 22:44818482-44818504 TTTTCCACGTGGCAGCGTGATGG + Intronic
1184601711 22:45547723-45547745 TTTCCCATCCTTAAGCGTGAGGG + Intronic
949431230 3:3978081-3978103 GTTTCCATCTAGGACCGTGAAGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
954055172 3:48017119-48017141 TTTTCCATCTATTAAAGTGAGGG - Intronic
955004015 3:54952707-54952729 TTTCCCATCTGGAAGCTGGAGGG - Intronic
957902994 3:86521200-86521222 TTTTCCATTTAGAAGGGTTATGG - Intergenic
959103386 3:102039401-102039423 CTTTCTATCTGGAAGAGTGAAGG + Intergenic
961412847 3:126735337-126735359 TTATCCATCTAGAGACCTGAGGG - Intronic
962324141 3:134419359-134419381 TGTTCCAAATAGAAGAGTGATGG + Intergenic
962905512 3:139797953-139797975 TTTTCCAGCTTGATGAGTGAGGG + Intergenic
965237327 3:166142179-166142201 TTTTCCATCAAGAAGTTGGAAGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967647806 3:191947619-191947641 TTTTTCTTCCACAAGCGTGAGGG - Intergenic
971775517 4:30959617-30959639 TTTTTCTTCCAGAAGCCTGATGG + Intronic
984232301 4:177113979-177114001 TCTTCCATCTAGAGGCTTGGAGG - Intergenic
987743907 5:21946070-21946092 TTTTCCATCTGAAACCATGAAGG + Intronic
987852838 5:23379321-23379343 TTTTCCATCTAGTAAAGGGATGG - Intergenic
988916865 5:35903335-35903357 TTTTCCATCTTGATGCTTCATGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991764108 5:69956209-69956231 TTTTCCATCTGAAACCATGAAGG + Intergenic
991783217 5:70161938-70161960 TTTTCCATCTGAAACCATGAAGG - Intergenic
991843340 5:70831281-70831303 TTTTCCATCTGAAACCATGAAGG + Intergenic
991875661 5:71162262-71162284 TTTTCCATCTGAAACCATGAAGG - Intergenic
994849111 5:105031100-105031122 TTTTCCATCAAGAAAAATGAAGG - Intergenic
998820003 5:146049614-146049636 TGCTCCATCTAGTGGCGTGATGG + Intronic
999924069 5:156355964-156355986 TTTTTCTTCTAGAAGTGTGAGGG + Intronic
1000038561 5:157467577-157467599 TTTTCCACCTAAAAGAGTCAGGG - Intronic
1004816059 6:19312807-19312829 TTTTCCAGCTAAAACCCTGAAGG - Intergenic
1010296222 6:74199716-74199738 TTTTGCATCTTGAAGAATGAAGG + Intergenic
1013070452 6:106724311-106724333 TTTTACAACTGGAAGAGTGATGG + Intergenic
1018655438 6:166029730-166029752 CTTTCAATCAAGAAGGGTGAAGG - Intergenic
1022043326 7:26601801-26601823 TTTTCCTTCCAGAAGGGAGAAGG + Intergenic
1023761589 7:43469330-43469352 GTTGGCATCTAGCAGCGTGAGGG - Intronic
1024038491 7:45530157-45530179 TTTTGCATCTACATGCATGAGGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030714179 7:112789686-112789708 TGTCCCATCTAGAAGTGTCAAGG + Intronic
1030879816 7:114863973-114863995 TCTTCCATCTAGAAGTGGGCTGG - Intergenic
1035149327 7:156854465-156854487 TTTTCCTGCTGGAAGCTTGAAGG - Intronic
1037392706 8:18410918-18410940 TTTTGCATCTATATTCGTGAGGG - Intergenic
1042538311 8:69881717-69881739 GTTTCCTTCTAGAACCCTGATGG - Intergenic
1042642944 8:70955606-70955628 TTTTCCATCTGGAAACCTGTGGG + Intergenic
1046071352 8:109258587-109258609 TTTTCCTTCTAGAATCTTAAAGG - Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051794321 9:20847669-20847691 TTTTCCATGTAGAAGAGTTTTGG + Intronic
1051891136 9:21944253-21944275 TTTTCCTTCTAGAATCTAGAGGG - Intronic
1052399418 9:27981684-27981706 TTGTCCATCTAGATTAGTGAAGG + Intronic
1055622005 9:78135680-78135702 TTTTCCACCTATATGCATGAGGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056425469 9:86471247-86471269 TTTTCCATCTAAAAATGGGAAGG - Intergenic
1203684621 Un_KI270757v1:33981-34003 TTTTCCCTCTAGAGGCCTCAAGG - Intergenic
1186792013 X:13008796-13008818 TTTTCCCTCCAGAAGAGTAATGG - Intergenic
1188310983 X:28616384-28616406 ATTTACATTTAAAAGCGTGAAGG + Intronic
1190456264 X:50630448-50630470 TTTCCCATCTAAAAGCATGGGGG - Intronic
1196766451 X:119249836-119249858 TTTTCAAAGTGGAAGCGTGATGG - Intergenic
1198412531 X:136386069-136386091 TTTTACATCTTGTAGCCTGATGG - Intronic