ID: 1141146331

View in Genome Browser
Species Human (GRCh38)
Location 16:81532841-81532863
Sequence CTGTCTGGGCAGAGAGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 278}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141146331_1141146336 12 Left 1141146331 16:81532841-81532863 CCTGCGCCTCTCTGCCCAGACAG 0: 1
1: 0
2: 2
3: 31
4: 278
Right 1141146336 16:81532876-81532898 AAGCCTCCCTCCCTTACTGATGG 0: 1
1: 0
2: 1
3: 16
4: 169
1141146331_1141146341 22 Left 1141146331 16:81532841-81532863 CCTGCGCCTCTCTGCCCAGACAG 0: 1
1: 0
2: 2
3: 31
4: 278
Right 1141146341 16:81532886-81532908 CCCTTACTGATGGTGTGATCTGG 0: 1
1: 0
2: 0
3: 6
4: 87
1141146331_1141146343 23 Left 1141146331 16:81532841-81532863 CCTGCGCCTCTCTGCCCAGACAG 0: 1
1: 0
2: 2
3: 31
4: 278
Right 1141146343 16:81532887-81532909 CCTTACTGATGGTGTGATCTGGG 0: 1
1: 0
2: 3
3: 42
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141146331 Original CRISPR CTGTCTGGGCAGAGAGGCGC AGG (reversed) Intronic
900578799 1:3397510-3397532 CTCTGTGGGCAGTGAGGCCCTGG + Intronic
900974195 1:6007174-6007196 GTGACTGGGCAGGGAGGCCCGGG - Intronic
901001958 1:6153317-6153339 CAGGCTGGGCAGACAGGGGCGGG + Intronic
901538795 1:9901308-9901330 CTGTCTGGGCAGGGAGGTCAAGG + Intronic
901623921 1:10612678-10612700 CTGGCTGGGCTGAGAAGGGCTGG - Intronic
901836353 1:11926309-11926331 CGGGCCGGGCAGTGAGGCGCGGG - Exonic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902407296 1:16191749-16191771 CTGGCTGGGCAGACAGCCTCAGG + Intergenic
903212883 1:21828558-21828580 CGGTGTGGGGAGGGAGGCGCAGG + Intronic
903794954 1:25921773-25921795 CTGTCTCTGGAGAGAGGGGCGGG - Intergenic
904418574 1:30377342-30377364 CTGTCGGGGCAGAGAGACTGAGG - Intergenic
904494584 1:30879480-30879502 CTTTCTGGGCAGAGGGGAGCTGG - Intronic
904743289 1:32695113-32695135 CAAACTGGGCAGAGAGTCGCCGG + Exonic
905761185 1:40559242-40559264 AGGTGTGGACAGAGAGGCGCGGG - Intergenic
906124069 1:43415859-43415881 CTGTCTGGCCTGAGAAGTGCTGG + Intronic
907134088 1:52122770-52122792 CTGTCTGGGCAGACAGCAGTAGG - Intergenic
907868769 1:58424074-58424096 CTGTCTCAGCAGAGAGGTGAAGG + Intronic
908356913 1:63330708-63330730 TGGTCTGGGCAGGGAGGCTCAGG - Intergenic
908433006 1:64077468-64077490 GTGTCTGGGAAGAGAGAAGCAGG + Intronic
909907813 1:81221012-81221034 GTGCCTGGGCAGAAAGGGGCGGG + Intergenic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
911594544 1:99785397-99785419 CTGGCTGGGCACAGTGGCTCAGG - Intergenic
912550955 1:110484988-110485010 CCGTGTGGGCAGAGAGTGGCTGG - Intergenic
914620224 1:149398713-149398735 CTGGCTAGGCAGTGAGGGGCTGG + Intergenic
915475843 1:156152415-156152437 CTGTTTAAGCAGAGAGGCCCAGG + Intronic
915754916 1:158250178-158250200 CTGTATGGGCAGACAGTGGCAGG + Intergenic
917971616 1:180211605-180211627 CTGCCTGGGTTGAGGGGCGCTGG - Intergenic
919908392 1:202094153-202094175 CTGACTGGGGAGAGAGGCAATGG - Intergenic
920099885 1:203510423-203510445 CGGGGTGGGCAGAGAGGAGCAGG + Intergenic
920805591 1:209231500-209231522 CCCTCTGGGCCGAGTGGCGCCGG - Intergenic
922507196 1:226133433-226133455 CTGTCGTGGAAGAGAGGGGCAGG + Intergenic
922905491 1:229170616-229170638 CTGTGTGGCCTGAGAGGCACAGG + Intergenic
923215759 1:231846206-231846228 CTGTTAGGGCAGAGAGGAGGAGG + Intronic
923268702 1:232335673-232335695 CTGTCTGGTGACAGAGCCGCAGG - Intergenic
1062995201 10:1859061-1859083 CAGTCAGGGCACAGAGGGGCGGG + Intergenic
1065316570 10:24469891-24469913 CTGCCTGGGCACAGTGGCTCAGG - Intronic
1067717367 10:48699769-48699791 CTCTCTGGGCTGAGAGGTGAGGG + Intronic
1069567171 10:69471454-69471476 CTGAGTGGGCAGAGTGGCGTGGG - Intronic
1071073525 10:81724781-81724803 CTTTCTGTGCAGAGAGCTGCAGG + Intergenic
1072708517 10:97699774-97699796 CTGGCTGGGCATAGTGGCTCAGG - Intergenic
1072810215 10:98455771-98455793 CTGGCTGGGCACAGAGTGGCTGG + Intergenic
1074536850 10:114334228-114334250 CTGCCTGGGCAGAGAAAAGCTGG + Intronic
1074895127 10:117770801-117770823 CTGTCTGGTTGGAGAGGAGCTGG - Intergenic
1075512188 10:123081509-123081531 CTGGCTGGGGAGAGGGGCGGCGG - Intergenic
1075636978 10:124035975-124035997 CTGTCTGGGCACAGAGAGGTGGG - Intronic
1076881840 10:133243474-133243496 CTGTCAGGGCAGGGAGGCTGTGG + Intergenic
1076930810 10:133530503-133530525 CTGTCCGGCCTGAGAGGGGCGGG - Intronic
1077228635 11:1449043-1449065 CTGTCTGGGCACGTGGGCGCCGG + Intronic
1077414777 11:2420011-2420033 CTGTCTGGGCAGAGTGGTGAAGG - Intronic
1077837216 11:5935766-5935788 CTGTCTGGGCCGAGTGGTCCGGG - Intronic
1078450307 11:11436071-11436093 CTGCGTGAGCAGAGAGGCGAGGG + Intronic
1079086162 11:17446664-17446686 CTGTCTTGGCAGAATGGAGCGGG + Intronic
1079094998 11:17504362-17504384 CTGTTTGTCCAGAGAGGAGCAGG - Intronic
1080811885 11:35712651-35712673 CTGTCAGTGCAGAGAGGAGCTGG - Intronic
1081726918 11:45336557-45336579 TTTCCTGGGCAGAGAGGCGCAGG + Intergenic
1081909343 11:46690676-46690698 CTGTCTGGGGAGAGAGGGCGAGG - Intronic
1082821958 11:57550125-57550147 CTCTGTGGGCAGAGATGGGCAGG + Exonic
1084744988 11:71164322-71164344 CTGTCTAGGCAGAGAGGCTTTGG + Intronic
1088246973 11:107828153-107828175 CTGGCTGGGCACAGTGGCTCAGG + Intronic
1088476337 11:110243434-110243456 ATGTCTGGGCACAGTGGCTCAGG + Intronic
1088720672 11:112589409-112589431 CTGTCTGAGCAGAGGGGCCCTGG + Intergenic
1089666670 11:120024973-120024995 CTGGCTGGGCACAGTGGCTCAGG + Intergenic
1090150073 11:124374653-124374675 ATGTCTAGGCAGATAGGGGCAGG - Intergenic
1091119885 11:133048031-133048053 GTGTCTGGGCAGGGTGGGGCAGG - Intronic
1091358624 11:134957389-134957411 CTGGCTGTGCAGAGTGGCCCTGG + Intergenic
1091734927 12:2913053-2913075 CTGGCTGGGCACAGAGGCAGAGG - Intronic
1093758777 12:22881702-22881724 ATGCCTGGGCAGATAGGGGCGGG - Intergenic
1095213362 12:39520497-39520519 CTGGCTGGGCACAGGGGCTCAGG + Intergenic
1097742583 12:63261642-63261664 AGGTCTGGGCACAGAGGCTCAGG - Intergenic
1099503084 12:83437563-83437585 CTGGCTGGGCAGGGTGGCTCAGG - Intergenic
1099534618 12:83828505-83828527 CTGACTGTGAAGAGAGGAGCAGG + Intergenic
1102924041 12:116813285-116813307 CGGGCTGGGAAGAGAGGCGAAGG - Intronic
1103982059 12:124742962-124742984 CTGTGTGGGCAGAGCTGGGCGGG - Intergenic
1104747998 12:131221866-131221888 GGGGCTGGGCAGAGAGGGGCAGG + Intergenic
1104834204 12:131776847-131776869 CTTTCTGGGTAAAGAGGGGCAGG + Intronic
1105631987 13:22178587-22178609 CTGTCTTGACAGAGGGGAGCTGG + Intergenic
1108849390 13:54708371-54708393 ATTCCTGGGCAGAGAGGGGCAGG - Intergenic
1111230595 13:85340761-85340783 CTGTCTGGGGAGGGAGGTGGAGG - Intergenic
1114183328 14:20382872-20382894 CTGGCTGGGCAGAGCAGCGTAGG - Intronic
1114908641 14:27164012-27164034 CTTTCAGGGAAGAGAGGAGCTGG - Intergenic
1115602432 14:34968207-34968229 CTGGCTGGGCACAGTGGCTCAGG - Intergenic
1119067182 14:71540843-71540865 CTGGCTGGGCAGGGTGGCTCAGG + Intronic
1121616691 14:95318618-95318640 AGGCCTGGGCAGAGAGGCGATGG - Intronic
1121644142 14:95506423-95506445 CTGTCTGTGCACACGGGCGCAGG + Intergenic
1122136866 14:99638463-99638485 CAGTCTGGCCAGAGAGGCGCTGG + Intergenic
1122267433 14:100553263-100553285 CTCTCAGGGCTGAGAGGCGGCGG - Intronic
1122649940 14:103220706-103220728 GGGTCTTGGCAGAGACGCGCGGG - Intergenic
1122771916 14:104101387-104101409 CTGTCTGGGAAGTGAGGGGCTGG + Intronic
1202849536 14_GL000225v1_random:8335-8357 CGGTATGGGCAGAGAGAGGCCGG - Intergenic
1125513668 15:40306424-40306446 CTGACTGGGCAGAGGGTCACAGG - Intronic
1126920106 15:53511676-53511698 CTGTCAGAGCAGAGAGGCTCAGG - Intergenic
1128028600 15:64460654-64460676 CGGGCGGGGCGGAGAGGCGCGGG + Intergenic
1128054408 15:64689044-64689066 CTGTCTGGGCTGTAAGGCTCAGG + Intronic
1128551278 15:68599602-68599624 CTGTCTGGGCAGCGTGGGGGTGG - Intronic
1128718361 15:69926941-69926963 CTGGCTGGGCAAAGAGGATCTGG + Intergenic
1128749283 15:70137414-70137436 TTGTCTGGGCACAGTGGCTCAGG - Intergenic
1129144391 15:73633589-73633611 CTCTCTGGGCAGTGGGGAGCTGG + Intronic
1129256696 15:74337861-74337883 CAGGCTGGGCAGAAAGGAGCAGG + Exonic
1129272846 15:74428578-74428600 CTTTCTGGGCAGAAAGGAGGAGG + Intronic
1129592660 15:76931560-76931582 CTGATTGGGCAGCGCGGCGCTGG - Intergenic
1131424368 15:92333716-92333738 ATGTCTGGGTAGACAGGAGCAGG + Intergenic
1132212721 15:100036287-100036309 CTGTCTTAGGACAGAGGCGCTGG + Intronic
1133245860 16:4448345-4448367 CTGTCTCGGCAGAGCGGTGGTGG - Intronic
1135728214 16:24873347-24873369 CTGGCTGGGCACAGTGGCTCAGG + Intronic
1136109695 16:28057076-28057098 CTGTGGGGGCAGAGAGGAGTGGG + Intronic
1136297900 16:29314094-29314116 CAGCCTGGACAGAGAGGAGCGGG + Intergenic
1136568994 16:31085805-31085827 CTGTTAGGGCTGAGAGGCACAGG - Intronic
1137982634 16:53082846-53082868 CTGACAGGGCAGAGAGGAGCTGG - Intronic
1138178938 16:54929777-54929799 CTGTTTGTTCAGCGAGGCGCTGG - Intergenic
1138346197 16:56321727-56321749 AGGACTGGGCAGAGAGGAGCGGG + Intronic
1138549951 16:57741999-57742021 CTGTCTGCTCAGTGAGGCCCAGG + Intronic
1139374358 16:66487544-66487566 CTGGCTGGGCAGAGGGTCCCAGG - Intronic
1141146331 16:81532841-81532863 CTGTCTGGGCAGAGAGGCGCAGG - Intronic
1141892988 16:86939643-86939665 ATGACTGGACAGAGAGGGGCAGG - Intergenic
1142005018 16:87685497-87685519 CTGCCTGGGCTGGGAGGCGGTGG + Intronic
1142192838 16:88725778-88725800 CAGCGTGGGCAGAGAGGAGCAGG - Intronic
1143465999 17:7137187-7137209 CTGTTAGGGCAGAGAGGCTGTGG - Intergenic
1143837363 17:9702887-9702909 CTGAGTGGACAGAGATGCGCTGG + Intronic
1144484208 17:15651530-15651552 GAGTCTGGGCTGAGAGGGGCTGG + Exonic
1145183454 17:20773352-20773374 CTTTCTGTGCAGAGAGCAGCAGG + Intergenic
1145977345 17:28992000-28992022 CTGGCTGGGCAGTGAGGCAGGGG - Intronic
1146126520 17:30235690-30235712 CTGGCTGTGCGGAGGGGCGCCGG + Exonic
1147745505 17:42692036-42692058 CTGTCTGGGGAGACAGGGGTAGG + Intronic
1149018532 17:51936516-51936538 CAGTCTTGGCAGAGAAGAGCTGG + Intronic
1149656208 17:58310808-58310830 CTGTCTGGGGAGAGGGGAGCAGG - Intronic
1151412978 17:73943277-73943299 ATGTATGTGCAGAGAGGGGCAGG - Intergenic
1151667053 17:75551020-75551042 CGGGCTGGGCAGAGAGGCAGGGG - Intronic
1151981769 17:77515678-77515700 CTGGCTGGGCACAGTGGCTCAGG + Intergenic
1152600641 17:81260461-81260483 CTGGCCTGGCAGAGAGGCTCAGG + Intronic
1153532162 18:6058222-6058244 CTGTCTGGGTAGAGAATCCCAGG + Intronic
1153670695 18:7409242-7409264 CTGGCTGGGCACAGTGGCTCAGG - Intergenic
1154380968 18:13849491-13849513 CTGGCTGGGCACAGTGGCTCAGG + Intergenic
1154496324 18:14963829-14963851 CTGGCTGTGCAGAGTGGCCCTGG - Intergenic
1156127866 18:33929196-33929218 ATGACTGGGCATAGAGGTGCAGG - Intronic
1157600491 18:48890213-48890235 CTGGCAGGGCAGAGAGGGGGAGG - Intergenic
1157649326 18:49312202-49312224 ATGTCTAGGCAGACAGGGGCAGG + Intronic
1160800015 19:963432-963454 CTGTCAGGCCAGGGAGGGGCTGG + Intronic
1162015470 19:7844525-7844547 CTCTCTGGGCAGGGAGGGGCTGG - Intronic
1163128349 19:15256713-15256735 TTTTCTGGGCAGAGAGGAGGTGG - Intronic
1165261652 19:34624136-34624158 CTTTCTAGGCAGAGAGGTGTGGG + Intronic
1165905145 19:39189174-39189196 CTGTCAGGGCAGAGAAGAGCAGG - Intergenic
1166035582 19:40165780-40165802 CTGGGTGTGCAGAGAGGCGCTGG - Intergenic
1166525111 19:43505610-43505632 TTGGCTGGGCACAGAGGCTCAGG + Intergenic
1166796191 19:45427817-45427839 CTGGCGGAGCAGAGAGGCCCCGG - Intronic
1166996363 19:46721466-46721488 GTGTGTGTGCACAGAGGCGCAGG - Intronic
1167424976 19:49425565-49425587 CAGTCTGGGCAGAGAAGCATAGG - Intronic
1167608536 19:50494692-50494714 CTGGCAGGGCAGAGAGGAGGGGG + Intergenic
1168153256 19:54460343-54460365 GTGTCTGGGAAGCCAGGCGCAGG - Intronic
1168389552 19:55994675-55994697 CTGGCTGGGCACAGTGGCTCAGG - Intergenic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
926596549 2:14796616-14796638 ATGTCTGGGCAGATAGAGGCGGG + Intergenic
927151193 2:20197076-20197098 ATTTATGGGCAGAGAGGCCCAGG - Intergenic
927192865 2:20528767-20528789 CTCTGTGGGCAGAGAGGTGAAGG + Intergenic
928091433 2:28377298-28377320 CTGGCTGGGCAGGGTGGGGCAGG + Intergenic
928421385 2:31139683-31139705 CTTTATGGGGAGAGAGGGGCAGG - Intronic
930556183 2:52898648-52898670 ATGTCTAGGCAGATAGGGGCAGG + Intergenic
932123834 2:69125557-69125579 TTGTCTGGGCACAGTGGCACAGG + Intronic
933386954 2:81622872-81622894 CAGCCTGGGCACAGAGGCTCCGG + Intergenic
933559960 2:83876577-83876599 CTGTCTGGGCTGAGCGGTCCAGG + Intergenic
933695165 2:85212242-85212264 GTGTCTGGGCTGAGTGGGGCTGG + Intronic
933728141 2:85437885-85437907 CTGGCAGGGCCGGGAGGCGCAGG + Intergenic
934051151 2:88212066-88212088 CTGTGTGGGGAGAGAGGAGGTGG + Intergenic
934732708 2:96669556-96669578 CTGACTGTGCAAAGAGGCCCTGG + Intergenic
937260246 2:120580902-120580924 CTGTCTGCGCAAGGAGGCCCCGG + Intergenic
938292379 2:130157044-130157066 CAGTCTGGAGAGAGAGGCTCTGG + Intronic
938464175 2:131515932-131515954 CAGTCTGGAGAGAGAGGCTCTGG - Intergenic
938994427 2:136662498-136662520 CTCTCTGGGCAGAGAGGTCAGGG + Intergenic
940304424 2:152210524-152210546 CTGGCTGGGCACAGTGGCTCAGG - Intergenic
941963820 2:171280727-171280749 CTGTCTGGGCAGACTGGCGGGGG + Intergenic
942190258 2:173462418-173462440 CTGTCTGGGCTGAGAGGCCAGGG + Intergenic
946486440 2:220105123-220105145 CTCTCTTGGCAGAGATGCCCAGG - Intergenic
947512977 2:230775803-230775825 CTGTGTGGGCAGATAGGCATAGG + Intronic
947759907 2:232596477-232596499 CTGGCTGGGCACAGTGGCTCAGG - Intergenic
947858993 2:233345468-233345490 CTGGCTGGGCAGGGAGGCCAAGG + Intronic
948597595 2:239090175-239090197 CTGGCTGGGCAGAGCAGCTCAGG + Intronic
948852932 2:240717265-240717287 CTGTCTGGCAGGAGAGGGGCTGG + Exonic
949072768 2:242035988-242036010 CAGTCTGCCCAGTGAGGCGCAGG - Intergenic
1168957050 20:1841587-1841609 ATGTCTTGGCAGAGAGGCTCTGG + Intergenic
1170448835 20:16460297-16460319 CTGGCTGGGCACAGTGGCTCAGG + Intronic
1170759948 20:19240489-19240511 CTGTATGTGCAGACAGGCTCAGG + Intronic
1172583260 20:36064838-36064860 CTCTCCGGGCAGAGAGTTGCTGG - Intergenic
1172691479 20:36793400-36793422 CTGGCTGGGGAGAGGGGCTCTGG + Exonic
1172835307 20:37869561-37869583 CTGTCTAGGGAGAGAGGGGCTGG + Intronic
1172979722 20:38931767-38931789 CTGTGTGGTCAGAGAGCTGCTGG - Intronic
1173667322 20:44772255-44772277 GAGTCAGGGCAGAGAGGGGCAGG - Intronic
1174139064 20:48400227-48400249 CTGTCAGGGGTGAGAGGTGCCGG + Intergenic
1175171313 20:57083517-57083539 GTGTGTGTGCAGAGAGGCACTGG + Intergenic
1175951651 20:62586895-62586917 CCGTCTGGGCAGAGCCGTGCAGG - Intergenic
1176250512 20:64118071-64118093 GTGTCTGGGCAAAGCTGCGCGGG + Intergenic
1176250523 20:64118122-64118144 GTGTCTGGGCAAAGCTGCGCAGG + Intergenic
1176250553 20:64118223-64118245 GTGTCTGGGCAAAGCTGCGCGGG + Intergenic
1176250709 20:64118721-64118743 GTGTCTGGGCAAAGCTGCGCGGG + Intergenic
1176250743 20:64118824-64118846 GTGTCTGGGCAAAGCTGCGCGGG + Intergenic
1176250760 20:64118876-64118898 GTGTCTGGGCAAAGCTGCGCGGG + Intergenic
1178417083 21:32412719-32412741 CAGCCTGGGCAGGGAGGCGGCGG + Exonic
1178487368 21:33027578-33027600 GGATCCGGGCAGAGAGGCGCTGG - Exonic
1180230677 21:46425188-46425210 CTGTCTCGCCAGAGAGGCTGAGG - Intronic
1181111885 22:20607185-20607207 CAGTCTGGAGAGAGAGGCTCTGG + Intergenic
1181329000 22:22074819-22074841 CAGTCTGGACAGAGAGCAGCAGG + Intergenic
1181629298 22:24142187-24142209 CTCTCTGAGGAGAGAGGCACTGG - Intronic
1182109827 22:27715264-27715286 GTGGCTGGGCAGGGAGGCGCTGG - Intergenic
1183158420 22:36093467-36093489 CTGGCTGGGCACAGTGGCTCAGG - Intergenic
1183402721 22:37614042-37614064 CTGTCTGGGCAGGAAGGCAGGGG + Intronic
1183506211 22:38210333-38210355 CTGTGTGGGCTGGGAGGAGCTGG + Intronic
1184770814 22:46595496-46595518 CAGTATGGGCACAGAGGTGCAGG + Intronic
1184779491 22:46639867-46639889 CAGCTTGGGCAGAGAGGGGCTGG + Intronic
1185005975 22:48277230-48277252 CTGTCTGGGAGGAGAGGGGCTGG - Intergenic
1185249418 22:49792231-49792253 CTGTGTGCGAAGAGAAGCGCTGG + Intronic
1185324537 22:50219250-50219272 CTGGGTGGGCAGACTGGCGCAGG + Intronic
951601929 3:24386330-24386352 GTGGTTGGGCAGAGAGGAGCAGG - Intronic
952231888 3:31440153-31440175 GTGTTGGGGCAGAGAGGAGCAGG - Intergenic
954054671 3:48011928-48011950 ATGTCTAGGCAGACAGGGGCGGG + Intronic
954186125 3:48918503-48918525 CTATCTGGTCAGAGGGGAGCTGG - Exonic
954581859 3:51707266-51707288 CTGTCTGGACACAGCAGCGCGGG - Intronic
954881026 3:53836169-53836191 CTGGCTGGGCCCAGAGGCGGTGG + Intronic
955334861 3:58077027-58077049 CTATCTGGGGAGAGAAGCACAGG - Exonic
961503317 3:127352779-127352801 CTGTCTTGGCAGTGAGAGGCAGG - Intergenic
963939719 3:151086369-151086391 CTGCCGGGGAAGAGAGGCGGGGG + Intronic
966944064 3:184765253-184765275 CTTTCTGGACACAGAGGAGCTGG - Intergenic
967124126 3:186409299-186409321 CTGTCTGGGGAGAGAGCCCTGGG - Intergenic
967182865 3:186921694-186921716 CTGTCTGGTTAGAGAAGTGCAGG + Intergenic
967811239 3:193762746-193762768 CAGTTTGGGCAGAGAGGTGGGGG - Intergenic
967860634 3:194148777-194148799 GTGTCTGGGTAGAGATGCGGGGG - Intergenic
968705666 4:2076266-2076288 CTGTGTGGCCAGCGTGGCGCCGG - Intronic
968810099 4:2795898-2795920 CTGTCTGGACACCGAGGGGCTGG + Intronic
969066122 4:4482693-4482715 CATTCTGGGCAGAGAGAAGCAGG - Intronic
969092964 4:4709797-4709819 CTGTATGCGAAGAGAGGAGCGGG - Intergenic
969449347 4:7264315-7264337 CTGTCTGTGCAGTGAGGGGTTGG + Intronic
979099803 4:116599734-116599756 CTGGGTGGGCAGGGAGGGGCTGG + Intergenic
980209773 4:129772289-129772311 CTGTCTGGGAAGGGAGGAGGGGG - Intergenic
982132709 4:152244830-152244852 TGGTATGGGCAGAGAGGAGCAGG - Intergenic
982133085 4:152247747-152247769 CTGCCTCTGCAGAGAGGCTCTGG - Intergenic
982216395 4:153086060-153086082 CTGTCTCAGGAGAGAGGAGCTGG + Intergenic
983347663 4:166546965-166546987 ATGTCTAGGCAGAAAGGGGCAGG - Intergenic
985670885 5:1206048-1206070 CTGTGTGGGGATAGAGGTGCTGG + Intronic
987054649 5:14179808-14179830 CTGTCTGGGCATGGTGGCTCAGG + Intronic
987138155 5:14918821-14918843 CGGACTGGGCAGGGAGGTGCAGG - Intergenic
988491807 5:31711540-31711562 CTGTCAGTGCAGAGAGGTGGAGG + Intronic
990937565 5:61166545-61166567 CTGCCTGGGCACAGTGGCTCAGG - Intergenic
995542811 5:113201102-113201124 CTGGCTGGGCACAGGGGCTCAGG + Intronic
995742384 5:115368735-115368757 CTGTTTGTGCTGAGGGGCGCTGG - Intergenic
997215930 5:132110687-132110709 AAGTCTGGGCAGAGAGCCTCAGG - Intergenic
998316087 5:141184176-141184198 CGCGCTGAGCAGAGAGGCGCTGG + Exonic
998317276 5:141194169-141194191 CGCGCTGAGCAGAGAGGCGCTGG + Exonic
999153530 5:149442245-149442267 CAGGCTGGGCAGCGAGGGGCTGG - Intergenic
999386481 5:151157468-151157490 GGGTCGGGGCGGAGAGGCGCGGG - Intronic
1001670301 5:173468181-173468203 GTGTCTGGGCAGAGAGGAGAAGG + Intergenic
1002638775 5:180620716-180620738 CTGCGTGGGCAGAAAGGGGCCGG + Intronic
1004621609 6:17335543-17335565 CAGTCTGGGCACAGTGGCTCAGG - Intergenic
1006424823 6:33957448-33957470 CTGGCTGGGCTCAGAGGTGCAGG - Intergenic
1006576557 6:35050761-35050783 CTGTTTGGGCAGAGATTGGCAGG - Intronic
1006742252 6:36317547-36317569 CTGTCTGGGGAGAAAGGATCAGG - Intronic
1006830402 6:36964650-36964672 CTGTGTGGGCAGACAGCCCCAGG - Exonic
1007187394 6:39983962-39983984 CTTCCTGGGCAGAGAGGTGCAGG - Intergenic
1007957882 6:45933746-45933768 CTGGGTGGACAGAGAGGGGCAGG + Intronic
1012144989 6:95670033-95670055 AGGTGTGGACAGAGAGGCGCGGG + Intergenic
1012191609 6:96287046-96287068 CTGTCTGGGCAGACAGGGAGGGG + Intergenic
1015481973 6:133722396-133722418 CTGTCATGGCAGAAAGGCGAAGG + Intergenic
1018038302 6:159900082-159900104 ATGTCTGGGCAGAGAGCCTCTGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019502291 7:1370257-1370279 CTGTGTGGGCAGAGAGGCCCTGG + Intergenic
1019576879 7:1741838-1741860 CTGTCTGGGCAGCGAGGCCTGGG - Intronic
1020112006 7:5452541-5452563 CTCTCTGGGCAGAGCGGGGCGGG - Intronic
1020257259 7:6509130-6509152 CTGTCGGGGCAGATGGGCCCGGG + Exonic
1021874539 7:25036388-25036410 ATGTCTAGGCAGATAGGGGCAGG - Intergenic
1024505676 7:50159292-50159314 CGGGCTGGGCAGGGACGCGCAGG - Exonic
1025806312 7:64837363-64837385 CTGTCTGGGCTGAGCGGTCCGGG + Intergenic
1026976634 7:74502722-74502744 CTGTCTGGGCAAGGAGTCCCTGG + Intronic
1028529022 7:91817631-91817653 CTGTCAGGGCAGGGAGGGGCTGG + Intronic
1028859841 7:95636775-95636797 CTGTCTAGGCAGAGAGACAAAGG - Intergenic
1030048970 7:105521791-105521813 CTGGCCGGGCAGAGCGGAGCGGG + Intronic
1031153780 7:118085307-118085329 CTGTCAGGTCAGAGAGGCATTGG - Intergenic
1032016054 7:128381059-128381081 CTGTCTGGGCAGGGAGGCTGGGG + Intergenic
1033609678 7:142953651-142953673 CTGTGCGGGCAGAGAAGCGTGGG - Intronic
1034494500 7:151411440-151411462 CTTTCTGGGCAGAGGGGCCAAGG + Intergenic
1034733837 7:153411355-153411377 CTGTCTGGGCTGAGTGGTCCGGG + Intergenic
1035468210 7:159093561-159093583 CTGTCAGTGCAGAGCAGCGCTGG + Intronic
1035572940 8:685861-685883 CTGACTGGGCACAGTGGCTCAGG + Intronic
1035685902 8:1523355-1523377 CCGTCTGTGCTGTGAGGCGCGGG - Intronic
1036570243 8:9974068-9974090 CTGCCTGGGCAGAGTGGCCTGGG + Intergenic
1037069985 8:14632302-14632324 CTGTCTGGGCATGGTGGCTCAGG - Intronic
1039686283 8:39805269-39805291 ATGCCTAGGCAGATAGGCGCAGG + Intronic
1040616940 8:49046617-49046639 CTGCCTGGCCGGAGAGTCGCTGG - Intergenic
1041222514 8:55665680-55665702 ATGGCTGGGCACAGAGGAGCCGG + Intergenic
1047080832 8:121458524-121458546 CTTTCTGTGCAGAGAGCAGCAGG - Intergenic
1048300439 8:133247497-133247519 CTGGCAGGGGAGAGAGGCACTGG - Intronic
1049198685 8:141329474-141329496 CTGTCTGGGCAGACACCGGCGGG - Intergenic
1049948070 9:617477-617499 CTGTCTGGCCAAAGAGGTTCAGG + Intronic
1052580637 9:30349899-30349921 GTTTCTGAGCAGAGAGGGGCAGG - Intergenic
1053179701 9:35958032-35958054 CTGGGTGGGCAGAGAGCCTCAGG + Exonic
1053184511 9:36003801-36003823 TTGGGTGGGCAGAGAGGCCCAGG + Intergenic
1053185535 9:36013228-36013250 ATGGGTGGGCAGAGAGGCCCAGG - Intergenic
1057023843 9:91721323-91721345 CTGTCTGGGAGGAGAAGGGCGGG - Intronic
1057164706 9:92916488-92916510 CGGTCTGGGCAGAGAGGCTGAGG + Intergenic
1057827222 9:98380452-98380474 TTGTCTGGGCAGACAGGGGCTGG + Intronic
1058588311 9:106533506-106533528 ATGCCTGGGCAGATAGGGGCGGG - Intergenic
1059419178 9:114180587-114180609 CCATCTGTGCAGAGAGGAGCTGG - Intronic
1061169496 9:128944067-128944089 CTGGCTGGGAAGACAGGCTCCGG - Intronic
1061959435 9:133980446-133980468 GTGTCAGGGCAGAGGGGCCCTGG + Intronic
1062142455 9:134967127-134967149 CAGTCTGGGCTGGGAGGCACTGG - Intergenic
1062211803 9:135368733-135368755 CTTTCTGTGCAGAGAGCCGCAGG + Intergenic
1062501898 9:136855260-136855282 CTGGCCGGGCAGACAGGCCCGGG + Exonic
1203429282 Un_GL000195v1:75375-75397 CTGTCTGGGCAGCCATGGGCAGG + Intergenic
1187021350 X:15385985-15386007 TTGTAGGGGCAGAGAGGCACTGG + Intronic
1188811263 X:34656735-34656757 CTGTCCTGGCAGTGGGGCGCGGG + Intronic
1190105293 X:47556346-47556368 CTGGGTTGGCAGAGAGGAGCTGG + Intergenic
1197747651 X:129943049-129943071 CTGTCTGGGGACAGAGGTGGAGG + Intergenic
1197804398 X:130385226-130385248 CTGTGTGGGCCGAGAAGGGCTGG + Exonic
1198799125 X:140431777-140431799 CTGCCTGGGCAGAGGTGCCCAGG - Intergenic
1198800061 X:140439454-140439476 GAGTCTGAGCCGAGAGGCGCGGG - Intergenic
1200232079 X:154449087-154449109 CTGTCTGGGGAGTGAGGCCCAGG + Intronic
1201148614 Y:11081950-11081972 CTGTCTAGGCAGAGGGGCTTTGG + Intergenic