ID: 1141151102

View in Genome Browser
Species Human (GRCh38)
Location 16:81565245-81565267
Sequence TTCCTTTGGAAGGTGGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 242}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141151102_1141151115 20 Left 1141151102 16:81565245-81565267 CCATGGCCCACCTTCCAAAGGAA 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1141151115 16:81565288-81565310 AGTGGGCTTTCTCCAAGAAGAGG 0: 1
1: 0
2: 1
3: 23
4: 182
1141151102_1141151107 -8 Left 1141151102 16:81565245-81565267 CCATGGCCCACCTTCCAAAGGAA 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1141151107 16:81565260-81565282 CAAAGGAAGATTTGCCCCACTGG 0: 1
1: 0
2: 0
3: 19
4: 115
1141151102_1141151110 2 Left 1141151102 16:81565245-81565267 CCATGGCCCACCTTCCAAAGGAA 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1141151110 16:81565270-81565292 TTTGCCCCACTGGGTGGCAGTGG 0: 1
1: 0
2: 0
3: 22
4: 218
1141151102_1141151111 3 Left 1141151102 16:81565245-81565267 CCATGGCCCACCTTCCAAAGGAA 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1141151111 16:81565271-81565293 TTGCCCCACTGGGTGGCAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 159
1141151102_1141151108 -7 Left 1141151102 16:81565245-81565267 CCATGGCCCACCTTCCAAAGGAA 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1141151108 16:81565261-81565283 AAAGGAAGATTTGCCCCACTGGG 0: 1
1: 0
2: 1
3: 17
4: 131
1141151102_1141151109 -4 Left 1141151102 16:81565245-81565267 CCATGGCCCACCTTCCAAAGGAA 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1141151109 16:81565264-81565286 GGAAGATTTGCCCCACTGGGTGG 0: 1
1: 0
2: 0
3: 14
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141151102 Original CRISPR TTCCTTTGGAAGGTGGGCCA TGG (reversed) Intronic
901508212 1:9700005-9700027 TTCCTTTGGATGGTGGGTCAGGG - Intronic
901538040 1:9895916-9895938 TTCCTTGGGAAGGTCGGGCGTGG - Intronic
901772621 1:11538059-11538081 TCACTTTGCACGGTGGGCCAAGG - Intergenic
901924227 1:12555660-12555682 TGCCTGTTGCAGGTGGGCCAAGG - Intergenic
901946759 1:12710593-12710615 TTCCCTTGGAAGGTAGGATAGGG - Intergenic
902073191 1:13759986-13760008 TTCCCTTGTTAGGTGGGTCATGG + Intronic
902334395 1:15746784-15746806 ATCCTGTGGAGGGTGGGTCAGGG + Intronic
903891191 1:26571712-26571734 TTCCCTTGCCAGCTGGGCCAAGG - Intronic
911325343 1:96464849-96464871 TTCTCATGGAAGGTGGGCAAGGG + Intergenic
911370456 1:96989149-96989171 TTCATTTGGAAGGTGGTCTCAGG + Intergenic
912302354 1:108531083-108531105 TTCCTCTGGAAAGTGGGACTGGG + Intergenic
915349217 1:155214088-155214110 TTGCTTTGGAAACTGGGCCTGGG - Intergenic
915352404 1:155234715-155234737 TTGCTTTGGAAACTGGGCCTGGG - Exonic
915615671 1:157036264-157036286 TCCCTTAGGAAGTTGGGTCATGG - Intronic
915843078 1:159232580-159232602 TTCCTCTGGGTGGTGTGCCAGGG - Intergenic
916025625 1:160830932-160830954 TTGCTTTGGAAGATGGGCCTGGG + Intronic
916166961 1:161973137-161973159 TTCCTGTGGGAGGTGGGCTTTGG + Intergenic
916776333 1:167968602-167968624 TTCATTTAGTAGGTGGGCCCTGG + Intronic
918384556 1:183992737-183992759 TGACTTTGGAAGGTAGGACACGG + Intronic
920311741 1:205052691-205052713 TTCCTCTGGCAGGTGGGCTCAGG - Intronic
921957314 1:220998134-220998156 TTATTGTGGAAGGTGGGACAAGG - Intergenic
923392215 1:233523712-233523734 TTCCTTTGCAAGGTGGGAAGAGG - Intergenic
923403144 1:233634981-233635003 TTTCTTTTGGAGCTGGGCCAAGG - Intronic
924083441 1:240423244-240423266 TTCCTATGGAGGGTGGGGGAAGG + Intronic
1063849196 10:10164824-10164846 TTCTCTTGGAAGGCAGGCCAGGG + Intergenic
1063920872 10:10931584-10931606 TTACTTTGGAAGGGGTGCCGTGG - Intergenic
1064296009 10:14079806-14079828 TTAGATGGGAAGGTGGGCCAGGG + Intronic
1065342070 10:24716878-24716900 ATACTTGGGAAGGTGGGCCAGGG + Intronic
1066011433 10:31197425-31197447 TTCATGGGGAAGGTGGTCCAGGG + Intergenic
1066780180 10:38936817-38936839 TTCCTTTGGACCATGGACCAGGG - Intergenic
1070771146 10:79082949-79082971 TTCCTTGGGTAGCTGGGCGAGGG - Intronic
1070783629 10:79150940-79150962 TTACTTGGGGAGGTGGGTCATGG - Intronic
1070986301 10:80692963-80692985 TTCCTTTGGAAGCTAGGGGATGG - Intergenic
1072029289 10:91503079-91503101 TTCCATTAAAAGGTGGGCAAAGG + Intronic
1072206019 10:93205801-93205823 TTCCTTTGCAGAGTGTGCCAGGG - Intergenic
1072620483 10:97076029-97076051 TTCCTCAGGAAGGCGGGCCTTGG - Intronic
1073114817 10:101085842-101085864 TTCCTTTGGGGGGTGTGCCTGGG + Intergenic
1073455633 10:103635294-103635316 ATCTTTTGGGAGGTGGGGCAGGG + Intronic
1075966246 10:126614214-126614236 TTCCTTGGGAAAGTGGGCAGGGG - Intronic
1077185806 11:1234861-1234883 GTCCTCTGGAAGGTGGCCCAGGG + Intronic
1077536499 11:3127228-3127250 TTCCTGTGGCTGGTGGGCGAGGG + Intronic
1078670334 11:13359008-13359030 TTCCTTTGAAAAGTGAGTCATGG + Intronic
1080361346 11:31517452-31517474 TTCCTTTGATAGGTTGGGCACGG - Intronic
1081602862 11:44507300-44507322 TTCCTTAGGAAGGTGGTCAGGGG + Intergenic
1081840482 11:46197490-46197512 TCCCTTTTGAAGATGGCCCATGG - Intergenic
1083418727 11:62541824-62541846 TTCCTTTGGAACAAGGGCCTTGG - Intronic
1083474712 11:62908580-62908602 GTACTTTGGAATGTGGGCCGTGG - Intergenic
1084489228 11:69469310-69469332 TTCCTCTGGGAGGAGGGCCCTGG - Intergenic
1087529432 11:99360139-99360161 TGTGTCTGGAAGGTGGGCCATGG - Intronic
1089540875 11:119188360-119188382 TTCCTGTGGGAGGTGGACCCGGG + Exonic
1090532709 11:127607756-127607778 ATCCTTCAGAAGGTGGCCCACGG - Intergenic
1090877238 11:130801670-130801692 TCCCTTTGAAAGGCTGGCCATGG + Intergenic
1091434652 12:462892-462914 TTCCTCTGGAGGGAGAGCCAGGG + Intronic
1091659516 12:2372958-2372980 TTCCTTTGGATGGTGAGTCAAGG - Intronic
1095565628 12:43620526-43620548 TTCCTTTAAAAAGTGGGCAAAGG - Intergenic
1095707593 12:45254320-45254342 TACCTCCTGAAGGTGGGCCAAGG + Intronic
1095957487 12:47814843-47814865 TTCCTTTGATAGGGTGGCCAGGG - Intronic
1097996487 12:65893127-65893149 TTCCTGTGGAAGGGGAGACAAGG + Intronic
1098013227 12:66076442-66076464 ATCCTTTGACTGGTGGGCCAAGG + Intergenic
1099439348 12:82682869-82682891 TTCATTTGGAAAGTGTGCCAAGG - Intergenic
1101434414 12:104652788-104652810 TGCCTGTGGAAGCTGGCCCAAGG + Intronic
1101545960 12:105713093-105713115 TTCCTTTGGAGGAAGTGCCATGG + Intergenic
1104045716 12:125161127-125161149 TTCCTTTGCAAGGCTGGGCATGG + Intergenic
1105016400 12:132788536-132788558 TTCCTGTGGAAGCTGAGCCTGGG - Intronic
1105357063 13:19668278-19668300 TTTGTTTGGAAGGTTGGCCTGGG + Intronic
1105846819 13:24300671-24300693 TTCCATTGGAATGTGGGCATAGG + Intronic
1107452472 13:40522309-40522331 TTCTTTTGTAAGGTGGGAAAAGG - Intergenic
1112998159 13:105599542-105599564 CTCCTTTGGTATTTGGGCCACGG - Intergenic
1113367858 13:109693442-109693464 TTCCTTTGGAGGCTGGGAGAAGG - Intergenic
1113766008 13:112881542-112881564 TTCCCTGGGATGGTGGGACAGGG + Intronic
1118128633 14:62937486-62937508 CCCCTTAGGAAGGTGGGCTAGGG - Intronic
1119813559 14:77544850-77544872 TTCTTGTTGAAGGTAGGCCAGGG - Intronic
1120906574 14:89625835-89625857 GACCTTTGGAAGGTGGGTCCTGG + Intergenic
1121479001 14:94245382-94245404 CTCTTTTTGAAGGTTGGCCAAGG + Intronic
1122318442 14:100839359-100839381 CTCCTTTGGAAGAGGGGACAGGG - Intergenic
1202937066 14_KI270725v1_random:99285-99307 TTCCTTTGGATCATGGACCAGGG + Intergenic
1125327142 15:38547542-38547564 TTACTTTGGAAGGTGGTCCTAGG - Intronic
1126229702 15:46310418-46310440 TTCCTCTGGAAGGTGTACCTTGG + Intergenic
1126669361 15:51102129-51102151 TTCCTTTGGAAACTGAGACATGG + Intronic
1126787001 15:52185517-52185539 TGCCTTGGGAAGGAGGGACATGG + Intronic
1127008961 15:54601714-54601736 CTCCTTTGGAATGGGGGACAGGG - Intronic
1128360318 15:66957216-66957238 TTCCCCTGGAAGGTAGGGCAAGG - Intergenic
1128744548 15:70104175-70104197 TTCCTCTGCTAGTTGGGCCATGG - Intergenic
1128749376 15:70138086-70138108 CTCCTTAGGCAGCTGGGCCATGG - Intergenic
1130174224 15:81550831-81550853 TTACTGTGGAAGGTGAGACATGG - Intergenic
1132974763 16:2705743-2705765 TTCCTGTGGAAGATGGCCTAGGG + Intronic
1133582807 16:7162878-7162900 TGCATTTGGAAGGAGGACCAGGG - Intronic
1134754842 16:16657959-16657981 TTCCTTGGGATGGGAGGCCAGGG - Intergenic
1134880418 16:17741124-17741146 TTTCTTTTGAAGGTGGACCAGGG - Intergenic
1134991219 16:18701174-18701196 TTCCTTGGGATGGGAGGCCAGGG + Intergenic
1135849418 16:25949729-25949751 TTCTTGTCGAAGGTGGGACAGGG + Intronic
1136682972 16:31978674-31978696 TTCCATGGGAAGGATGGCCAGGG + Intergenic
1136783613 16:32922230-32922252 TTCCATGGGAAGGACGGCCAGGG + Intergenic
1136886178 16:33931576-33931598 TTCCATGGGAAGGACGGCCAGGG - Intergenic
1136901597 16:34045105-34045127 TTCCTTTGGACAATGGACCAGGG - Intergenic
1136993249 16:35169989-35170011 TTCAGTTTTAAGGTGGGCCAGGG - Intergenic
1138650427 16:58457441-58457463 TTCCCTTGAAAGGTGGGACTTGG - Intergenic
1139760854 16:69183860-69183882 TTCCTATGGACTTTGGGCCATGG + Intronic
1141151102 16:81565245-81565267 TTCCTTTGGAAGGTGGGCCATGG - Intronic
1141283184 16:82647408-82647430 TTCTCTTGGGAGGTGGTCCAAGG + Intronic
1141779003 16:86144217-86144239 TTCCTTTGGGAGGTGACCCCTGG - Intergenic
1203086259 16_KI270728v1_random:1186224-1186246 TTCCATGGGAAGGACGGCCAGGG + Intergenic
1145249157 17:21288011-21288033 TCCCTTTGGGCGCTGGGCCATGG - Intronic
1146530989 17:33607532-33607554 TTCCCTTGGGAAATGGGCCATGG + Intronic
1147143877 17:38474383-38474405 TTCCAGGGGAAGGAGGGCCAGGG + Intronic
1150320704 17:64212107-64212129 TTCCTTTGCACGGTGGGGAATGG - Intronic
1151709430 17:75793789-75793811 TTTCATAGGAAGGTGGGACATGG - Intronic
1152458090 17:80427496-80427518 TTCCTCTGGAGGGTGGGCCCAGG - Intronic
1152807948 17:82366067-82366089 TTCTTTTGGAAGGAGGTCCCAGG - Intergenic
1154518767 18:15203247-15203269 TTCCTTTGGACCATGGACCAGGG + Intergenic
1155545517 18:26910378-26910400 TTCCTTTGGAAGCTTGGCGGGGG + Exonic
1156121314 18:33846105-33846127 TTTCTTTGGAAGATGGGACAAGG + Intergenic
1156715477 18:40003816-40003838 TTCCTGCTGAAGGTGGGTCAGGG + Intergenic
1158406936 18:57168201-57168223 TTACTTTGGAAGGTGAACCCAGG + Intergenic
1158744571 18:60184459-60184481 TTCTTTTGGAAGGTGGGGAGGGG + Intergenic
1161208355 19:3053879-3053901 TTCCTTGGAGAGGTGGGCCTGGG + Exonic
1161574115 19:5046422-5046444 TTCCTTTGCAAGGTGAGCCCTGG - Intronic
1162335227 19:10056005-10056027 TTCCTGAGGGAGGAGGGCCAGGG - Intergenic
1163003916 19:14385609-14385631 TTCCTGTGGGAGGGGGGCCCGGG + Intronic
1167250028 19:48394640-48394662 TTGCTCTGGAAGTTGGGCCCCGG - Intergenic
1168082672 19:54021716-54021738 TTCCTTTGCAAAGTGGGTAAGGG - Intergenic
1168493440 19:56830513-56830535 TTCCTCTGGAAGTGGGGACAAGG + Intronic
925214466 2:2082838-2082860 TTGCTTAGGGAGGTGGGCTATGG - Intronic
926019614 2:9483668-9483690 TTGGTTTGGAAGGTGGGGCTGGG - Intronic
927211419 2:20641258-20641280 TTCCTTTGGCTGCTGGGCCTTGG - Intronic
927282106 2:21317951-21317973 TTCTTTTGCAAGATGGCCCACGG - Intergenic
929013504 2:37471215-37471237 TTCCTTTGGAAAGGAGCCCAGGG - Intergenic
929107785 2:38380915-38380937 TTCCTTTGGGGGAGGGGCCAGGG + Intergenic
929272618 2:39989427-39989449 TTATTTTGGAATGTGGGCCTTGG + Intergenic
929604581 2:43226254-43226276 TTCTTGTGCAAGGTAGGCCAGGG - Exonic
931239210 2:60437629-60437651 TTCCTTTGAAGGGTGAGCCCTGG - Intergenic
931450239 2:62362394-62362416 GCTCTTGGGAAGGTGGGCCAGGG + Intergenic
931934997 2:67187048-67187070 TTTCTTTGGAAGGTAGTCCCAGG - Intergenic
932667489 2:73708717-73708739 TGCCGCTGGAAGTTGGGCCAAGG + Intergenic
932714899 2:74093815-74093837 TTTCTCTGGGAGGTGGGCGAAGG - Intronic
934656602 2:96119681-96119703 GTCCTTGGGAAGAGGGGCCATGG + Intergenic
936374866 2:111931854-111931876 TTCCTTTGGAAAATAGACCAGGG - Intronic
936758589 2:115745488-115745510 AACCCTTGGGAGGTGGGCCATGG - Intronic
937354931 2:121192363-121192385 TTCCTGGAGAAGGTGGGCCTAGG - Intergenic
938091371 2:128436983-128437005 TTCATGTGGAAGGTGGGGCCTGG + Intergenic
938285719 2:130114250-130114272 TTCCTTTGCATGGTGAGACAAGG - Intronic
938429883 2:131224650-131224672 TTCCTTTGCATGGTGAGACAAGG + Intronic
938474700 2:131597832-131597854 TTCCTTTGTATGGTGAGACAAGG + Intergenic
939285228 2:140121130-140121152 TGTGGTTGGAAGGTGGGCCAGGG - Intergenic
939886903 2:147690988-147691010 TTGCTTTGAAAGGTGAGCAAAGG + Intergenic
940824301 2:158393381-158393403 TTGCTTAGGATGGAGGGCCAAGG + Intronic
941770991 2:169345718-169345740 TTCCTTTTGAGGTGGGGCCAAGG - Intronic
942172272 2:173299901-173299923 TTCCTTTGGAAGGAGGTCCTGGG - Intergenic
942865667 2:180671535-180671557 CTCCATTAGAAGGTGGGCTAAGG - Intergenic
944145790 2:196505890-196505912 TTCCTTTGGGAGGTAGGGCTGGG + Intronic
946159960 2:217830097-217830119 GTCCTTTGCAGGGTGGGCCTCGG - Intronic
946881618 2:224182435-224182457 TGGGTTTGGTAGGTGGGCCATGG + Intergenic
947843655 2:233226379-233226401 CTCCTTAGGAAGGTGGGAGAAGG + Intronic
947846029 2:233244381-233244403 TTCCTTTGGATGGAGGGGAAGGG - Intronic
947985751 2:234446232-234446254 TTCTTGTTGAAGGTAGGCCAGGG + Intergenic
949032177 2:241802425-241802447 TTCCTTTGTAAGGAAGGTCAGGG - Intronic
1169090812 20:2860429-2860451 TTCCTGAGGAAAGGGGGCCATGG - Exonic
1170769319 20:19318334-19318356 ATCCTTTTGTAGGTGGGCGATGG + Intronic
1171452424 20:25245601-25245623 TTCCTGTTGAAGGCAGGCCAGGG + Intergenic
1173638540 20:44582408-44582430 TTCCTTTGGACAATGAGCCAGGG - Intronic
1175345836 20:58274320-58274342 TACCACTGGAAGGTAGGCCATGG + Intergenic
1175925029 20:62467296-62467318 TCCCTGTTGAAGGTGGACCAGGG + Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176201487 20:63862804-63862826 TTCCCATGGCTGGTGGGCCAGGG + Exonic
1176586247 21:8589691-8589713 TTCCTTTGGATCATGGACCAGGG - Intergenic
1176814849 21:13589526-13589548 TTCCATTGGAAAGTGGCCAAAGG - Intergenic
1177088823 21:16740668-16740690 ATCATGTGGGAGGTGGGCCAAGG - Intergenic
1177845321 21:26282029-26282051 TTCTTTTGGAAAGTGGGAGAAGG + Intergenic
1178365462 21:31985995-31986017 GCCCTTTGGAAGGTGGGCTGTGG + Intronic
1179790747 21:43754656-43754678 TCCCTTTGGAATGTGGGGCAGGG + Intronic
1180008669 21:45035197-45035219 TGCCTGTGGAGGGTGGGGCAGGG - Intergenic
1180269053 22:10566595-10566617 TTCCTTTGGATCATGGACCAGGG - Intergenic
1180280884 22:10693822-10693844 TTCCTTTGGACCATGGACCAGGG - Intergenic
1180942052 22:19665985-19666007 TTGCTTTGGAAGGAGGGCCGGGG + Intergenic
1184393005 22:44216214-44216236 TTCCTTTGATGGGTGGGCCCTGG + Intronic
1184984269 22:48118797-48118819 TTTCTAGGGAAGGTGGGGCAAGG - Intergenic
1185190056 22:49429579-49429601 TTCCTGTGGATGGTGAGGCAGGG - Intronic
1203237981 22_KI270732v1_random:25323-25345 TTCCTTTGGATCATGGACCAGGG - Intergenic
1203289676 22_KI270735v1_random:23040-23062 TTCCTTTGGACCATGGACCAGGG + Intergenic
949120727 3:381064-381086 TTACTGAGGAAGGTGGGCCCAGG - Intronic
950446007 3:13039036-13039058 TTATTTTGGAAGCTGGGCGATGG + Intronic
951710816 3:25583657-25583679 TTCCCCTGGAAGGTGAGCAAGGG - Intronic
951812761 3:26719037-26719059 TTCCTAATGAAGCTGGGCCAGGG - Intergenic
952955374 3:38554017-38554039 TTCCTCTGGAGGGTGGGGCCAGG + Intronic
953475005 3:43197957-43197979 TTGCCTTGGGAGGTGGGGCAAGG + Intergenic
953921151 3:46952611-46952633 TTCCATTAGAAGGTGAGCCCTGG + Intronic
954697699 3:52436361-52436383 TTCCTTGGGAATGTGTGCCAGGG - Intronic
955604011 3:60680071-60680093 TCCCCTTGGCATGTGGGCCATGG + Intronic
956325691 3:68050146-68050168 TTCCTTTGGAAGGTGATGCCAGG + Intronic
958579415 3:95998412-95998434 TTCATTTGACAGGTGGGTCATGG - Intergenic
958782484 3:98559428-98559450 CTCCTTTTAAAGGTGGGCAAAGG + Intronic
961154315 3:124666017-124666039 TTCCTTTGCAGTATGGGCCAAGG - Intronic
971275684 4:25194421-25194443 TGCCTTTGGAAAGTGGGGCCTGG - Intronic
972775038 4:42232573-42232595 TTCTTTTGGAAGCTGGTTCAGGG - Intergenic
973134249 4:46686347-46686369 TACCTATGGAAGTTGGTCCATGG - Intergenic
974287478 4:59887924-59887946 TTTCTTTGAAAGGTGAGCTAAGG - Intergenic
974822995 4:67091851-67091873 GTCCTGTGGAGGGTGAGCCAAGG - Intergenic
976104809 4:81605239-81605261 TACCTTTGGAAGGTGGGAGTTGG - Intronic
977773533 4:100889466-100889488 TTAGTTTGGAAAGTGGGCCAGGG - Intergenic
991303249 5:65149223-65149245 TACTTTTGGAAGGTCTGCCATGG + Exonic
991940146 5:71842951-71842973 TTCATGTTGAAGGTGGGCCAGGG + Intergenic
992620506 5:78587870-78587892 TTCTTTCTGAAGGTGGGCCAGGG - Intronic
992845497 5:80743062-80743084 CTCCTTGGAAAGGTGGGCGAGGG - Intronic
993932384 5:93955776-93955798 TTGCTATGGAAGCTGGGTCATGG + Intronic
995347358 5:111135910-111135932 TTCCTCTGGAAGGTGGCCTTTGG + Intergenic
995396395 5:111691569-111691591 ATTCTTTGGAAGCTGAGCCAAGG + Intronic
995967102 5:117920930-117920952 TTCCATTAAAAAGTGGGCCAAGG + Intergenic
996030747 5:118701975-118701997 TTCCTTTGGAAGGAGGGGTGAGG + Intergenic
996832972 5:127759969-127759991 TTCCTTGGCAAGCTGGGGCAGGG + Intergenic
999383851 5:151140483-151140505 ATGCTTTGGAAGGTGGTGCAGGG - Intronic
1000117839 5:158170064-158170086 TACCTCTGGAAGATTGGCCACGG - Intergenic
1001374160 5:171238858-171238880 TTCCTTTGGCAGGAGGGCAGGGG - Intronic
1003192570 6:3887477-3887499 TTCCCTGGGAACCTGGGCCACGG - Intergenic
1003500654 6:6700268-6700290 CTCCTCTGAAAGCTGGGCCAAGG + Intergenic
1003876661 6:10443653-10443675 TACCTTTGGGAGTTGGGCCATGG + Intergenic
1004942086 6:20569445-20569467 TTCCTTTGGCAGGTGGCAGAAGG - Intronic
1005848403 6:29800716-29800738 TTCTTTTGGAAGGTGGCTCAGGG - Intergenic
1006502319 6:34466558-34466580 TTCCTTGGGAAGCTGGGGCCTGG + Intronic
1006611876 6:35298909-35298931 CTCCTTTGGAGGATGGGGCAGGG - Intronic
1007521718 6:42455126-42455148 GTCCTTTGGAAGGTGGGGGGGGG - Intergenic
1007831880 6:44645234-44645256 TTCCTTGGGAAGTTGCCCCAAGG - Intergenic
1008534845 6:52499911-52499933 TTCCTTTTGAAGGTAGGGGATGG - Exonic
1008948145 6:57122543-57122565 TTCCATTGAAAAGTGGGCAAAGG + Intronic
1009242070 6:61195914-61195936 TTCTTGTGGAAGGAAGGCCAAGG + Intergenic
1013360149 6:109386415-109386437 TTTCTTTGAAAAGTGTGCCAGGG + Intergenic
1014180226 6:118376362-118376384 TTCCTTTGATACCTGGGCCATGG - Intergenic
1015940211 6:138442299-138442321 TTCCTTTGGAAGGTGGAACTTGG - Intronic
1018064740 6:160117102-160117124 TTCCTAGGGAACCTGGGCCAGGG - Intergenic
1018170450 6:161139679-161139701 TTCCCTTGGAAGCAGGGCCTCGG - Intronic
1018900954 6:168051490-168051512 TGCCTTTGTAAGGGGGGCCCTGG + Intergenic
1019811805 7:3170484-3170506 TTTATTTGGGAGGTGGCCCAGGG - Intronic
1021713995 7:23444418-23444440 GTTCTTTGGAAGGTGGGATAGGG - Intronic
1025138919 7:56446605-56446627 TTTCATAGGAAGGTGGGACATGG + Intergenic
1026210949 7:68304626-68304648 CTCCTGTGGTAGGAGGGCCAGGG + Intergenic
1026278844 7:68903866-68903888 TTCCTTTGTAGGGTGGGACGGGG - Intergenic
1026673847 7:72412841-72412863 TTCCTTTTGGAGGTGGGAGATGG - Intronic
1026904806 7:74056837-74056859 TGGCTTTGGAAGATGGGGCAGGG - Intronic
1028855152 7:95583107-95583129 GTCATTAGGAAGGTGGGCAAAGG + Intergenic
1032898019 7:136273898-136273920 TCCCTTTGGCAGGTGGGGCCAGG + Intergenic
1033472239 7:141660456-141660478 TTCCTTTGAATGGTGAGTCAGGG - Exonic
1034433439 7:151052051-151052073 TACCTCTGTGAGGTGGGCCAGGG + Exonic
1035855176 8:2966708-2966730 TTCCGTTGGTGGGTGTGCCAGGG + Exonic
1039813212 8:41068482-41068504 TTCCTTTGGAGGGGGGTCAACGG - Intergenic
1041473124 8:58233297-58233319 TTTCTCTGGGAGGTGGGCCAGGG - Intergenic
1048004936 8:130411532-130411554 TTTCTTTGGGAGGTGATCCAAGG - Intronic
1048213250 8:132474813-132474835 TGCCTGGGGAAGCTGGGCCAAGG + Intronic
1050629242 9:7541480-7541502 TTCTTTTGAATGGTGGGTCATGG + Intergenic
1051159051 9:14185187-14185209 TTCCTAGGAAAGGTGGGCAAGGG + Intronic
1051354837 9:16232039-16232061 TTCCTCTGGAGGGTAGGCCTGGG + Intronic
1055418736 9:76113198-76113220 TTCCCTTGGAAGGTGAGAGAGGG - Intronic
1055910783 9:81348441-81348463 TCCCATTGGAAAGTGGGCAAAGG - Intergenic
1058948157 9:109878107-109878129 TTCCATTGGAAAGTGGGAAAGGG - Intronic
1060047682 9:120353649-120353671 TTGCTTGGGAAAGTGGGCCTGGG - Intergenic
1061035048 9:128108771-128108793 TTCCTTTGGCAGGTTGGGGAAGG + Exonic
1061907642 9:133707013-133707035 CTCCTTAGAAAGGTGGCCCATGG - Intronic
1203616155 Un_KI270749v1:67206-67228 TTCCTTTGGATCATGGACCAGGG - Intergenic
1187154829 X:16712711-16712733 TGCCTTTGCAAAGTGAGCCACGG - Intronic
1187717859 X:22121355-22121377 TTCTTGTGGAAGGCAGGCCAAGG + Intronic
1189101628 X:38196674-38196696 TTCATTTGGAAGGTGATCCCAGG + Intronic
1189191530 X:39112387-39112409 TGCCTTTGGGAGGTTGCCCAAGG - Intergenic
1189385869 X:40536472-40536494 ATGATTTGGAAGGTGGGGCAAGG + Intergenic
1192785540 X:74331368-74331390 TTCTTGTTGAAGGTAGGCCATGG + Intergenic
1193035292 X:76943818-76943840 TCCCTTTAAAAAGTGGGCCAAGG - Intergenic
1197297612 X:124738209-124738231 GTCATTTGGGAGGTGGGACAAGG - Intronic
1199513456 X:148649072-148649094 TTCCTTTGGAAAGCAGGCCTGGG + Intronic