ID: 1141151364

View in Genome Browser
Species Human (GRCh38)
Location 16:81566574-81566596
Sequence CCTGCCAAGACCTGGTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141151364_1141151369 9 Left 1141151364 16:81566574-81566596 CCTGCTTACCAGGTCTTGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 114
Right 1141151369 16:81566606-81566628 CATTCATTCCTGCTTCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141151364 Original CRISPR CCTGCCAAGACCTGGTAAGC AGG (reversed) Intronic
900613896 1:3555761-3555783 CAGGCCAAGACCTGGAAAGCCGG + Intronic
901841208 1:11955154-11955176 CCTGTAAGGACCTGGTATGCAGG - Intronic
904597628 1:31656725-31656747 CCTGGAAAGACCTGGTACCCAGG + Intronic
906137058 1:43507072-43507094 CCTTCCCACACCTGGTAACCTGG + Intergenic
911247246 1:95532363-95532385 CTTGCCAAAACCTGATAAGTGGG + Intergenic
915692562 1:157704279-157704301 GCTGCGAAGCCCTTGTAAGCAGG + Intergenic
917245179 1:172993173-172993195 CCTCCCAATAACTGCTAAGCAGG - Intergenic
917796232 1:178534652-178534674 CCCACCAAGGCCTGGTGAGCAGG - Intronic
920164933 1:204029127-204029149 CCTGCAATGACCAGGTACGCTGG - Intergenic
921407011 1:214791123-214791145 GCTGGCAGGACCTGGAAAGCAGG - Intergenic
924932577 1:248743836-248743858 GCTGCCAAGACCCGGTGAGTGGG + Intronic
1064913160 10:20425760-20425782 CCTGCCATGACGTTGTTAGCTGG + Intergenic
1073453727 10:103624178-103624200 GCTGCCAAGCCCTGGGAAGAAGG + Intronic
1075414048 10:122249465-122249487 CCTGCCTGGACCTGGGAAGCAGG + Intronic
1079082254 11:17421928-17421950 CAGGCCAAGACCTGGTGACCAGG - Intronic
1081638295 11:44735397-44735419 CCTGCCAACACCTTGTCTGCAGG - Intronic
1081812392 11:45921458-45921480 CCTCCCATGACCTGGAAAGGGGG - Intergenic
1083976598 11:66126981-66127003 CCTGCAAAGACGTGGCATGCAGG - Intronic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1091535832 12:1408234-1408256 CCTCCCCAGACCAGGTAAGATGG + Exonic
1093406649 12:18812853-18812875 CCGGCCAAGACCTGGTGGGCAGG - Intergenic
1094248967 12:28337978-28338000 CCTGACAATATCTGGTGAGCTGG - Intronic
1096807010 12:54147013-54147035 CCTGCCCAGAGTTGGTGAGCTGG - Intergenic
1097415307 12:59308265-59308287 TATGCCAAGGACTGGTAAGCAGG + Intergenic
1098138530 12:67428194-67428216 CCTGCCAAGAACTGCCAAGAGGG - Intergenic
1101728475 12:107407192-107407214 CCTGCCAAACCCTGGTGAGCTGG - Intronic
1102550958 12:113691921-113691943 CCTCCTAAGACCTGGGTAGCTGG - Intergenic
1102584467 12:113913450-113913472 CCTGCCAGTATCTGGGAAGCAGG - Intronic
1103995138 12:124824776-124824798 CCTGGCAGGAGCTGGGAAGCTGG - Intronic
1104919570 12:132283520-132283542 GCTGCCAAGGCCAGGTGAGCAGG - Intronic
1106188027 13:27425738-27425760 TCTGCCAAAAACTGGGAAGCTGG - Intronic
1109219143 13:59623783-59623805 CCTTACAAGTCCTGGTAAGCAGG - Intergenic
1110549584 13:76797540-76797562 CCTGCCAAGACCAGGAAAATGGG + Intergenic
1111923814 13:94441528-94441550 CCTCCCAACCCCTGGTAACCAGG + Intronic
1118819454 14:69335455-69335477 CCTGTGAAGACTTGGAAAGCTGG + Intronic
1120667490 14:87324011-87324033 CCTGACAAGACTTGGGAATCAGG - Intergenic
1120908443 14:89642530-89642552 CCTGCAAAGACCTCATAAACTGG - Intronic
1121408418 14:93733233-93733255 CTTGCCCAGACCTGGTAGCCAGG - Intronic
1122585917 14:102806611-102806633 CCTGCCATGCCCTGGTACACAGG - Intronic
1123023293 14:105412076-105412098 CCTGGCAAGGCCTGGGTAGCAGG + Exonic
1128513269 15:68326645-68326667 ACTTCCATGTCCTGGTAAGCTGG - Exonic
1129439923 15:75573986-75574008 CCTGCAAAGACCCTGTAAGCAGG + Intronic
1134776701 16:16859524-16859546 GTTGCCAAGACCTGGAAAGAGGG - Intergenic
1137435790 16:48453436-48453458 CCTGCCAAGGCCTGGGGAGTAGG - Intergenic
1137762813 16:50954210-50954232 CCTGCCAGGACCTGGCATACAGG + Intergenic
1137982481 16:53081566-53081588 CCTGCCAACAGCAGGTCAGCAGG + Intronic
1139775545 16:69314769-69314791 CCTGCCAAGAGCCGGTCAGGAGG + Intronic
1141148714 16:81549700-81549722 CTTTGCTAGACCTGGTAAGCTGG + Intronic
1141151364 16:81566574-81566596 CCTGCCAAGACCTGGTAAGCAGG - Intronic
1144132481 17:12260077-12260099 GCTTCCTAGACCTGGGAAGCGGG + Intergenic
1145721146 17:27074168-27074190 GCTGCCATGACCTGGTAAACAGG + Intergenic
1148187423 17:45654802-45654824 CCTGGCAAGGCCTGGTCATCTGG - Intergenic
1152689811 17:81712748-81712770 CCTGCCGAGAACTGGGAAGCCGG - Intronic
1153760017 18:8321646-8321668 GCTGCCACGACCTGGTAAACAGG - Intronic
1158107340 18:53900641-53900663 CCTCCCAAGACCTAGAAAGTTGG + Intergenic
1160567613 18:79797092-79797114 CCTTCCAAGACCTGGTGCTCCGG + Intergenic
1160761787 19:789114-789136 CCTGCTGGGACCAGGTAAGCAGG + Intergenic
1161165734 19:2786165-2786187 CCTGCCAAGACCGGGGAAGGAGG + Intronic
1162813924 19:13181798-13181820 CCTGCCAGGGCCTGGTAGCCAGG + Intergenic
1165419908 19:35717660-35717682 CCGGCCAGGACCCGGAAAGCGGG - Intergenic
1165739931 19:38199060-38199082 CCTGCCAAGACCTTGCATCCTGG + Intronic
1166561895 19:43738047-43738069 CCTCCCAAGATCTGGAGAGCTGG - Intronic
924966783 2:84318-84340 CCTGCAATGACTTGGGAAGCAGG - Intergenic
926402833 2:12516300-12516322 AGTGCCATGACCTGGTAACCTGG + Intergenic
928402891 2:30992121-30992143 CCTGGTAAGACCTAGTAAGCAGG - Intronic
930918650 2:56724198-56724220 TCTGCCAAGACCAGCTTAGCTGG - Intergenic
932537170 2:72611060-72611082 CCTCCCAAGACTTGTTAAGGTGG + Intronic
938276379 2:130028465-130028487 GTTGCCAAGACCTGGAAACCTGG + Intergenic
942210036 2:173660844-173660866 CCTGGCAAGCCCTGGGCAGCAGG + Intergenic
947172639 2:227326023-227326045 CCTTCCAGGAGCTGGGAAGCCGG + Intronic
947583698 2:231338108-231338130 CCTCCCAAGCCCTTGTAAGCTGG - Intronic
947941724 2:234062274-234062296 CCAGCCAAGAACTGGAAGGCGGG + Intronic
948302972 2:236922214-236922236 CCTGCCAAGGCCTGGCCAGGAGG - Intergenic
1168957658 20:1845884-1845906 CCTGCCATGGCCTGGCCAGCTGG + Intergenic
1170568508 20:17620055-17620077 CCTGCCCAGCCCTGGTGAACAGG - Intronic
1171189888 20:23151362-23151384 CCTCCCAAGACCAGGGAGGCTGG + Intergenic
1184271480 22:43386999-43387021 CCTGCCACCACCTGGGAGGCAGG + Intergenic
950177180 3:10882999-10883021 CCTGCCCAGAGCTGGCAAGGTGG - Intronic
950412960 3:12850899-12850921 GCTGACAAGACCAGGGAAGCTGG + Intronic
954147763 3:48642665-48642687 TCAGCCAAGCCCTGGTAAGGTGG + Intronic
954437766 3:50504940-50504962 CCTGTCAAGCCCTGGTTTGCTGG - Intergenic
954712409 3:52511732-52511754 GCTGCCACGGCCTGGTAAGGGGG + Exonic
955227745 3:57074935-57074957 CCTGCCAGGACCTGGAGGGCAGG + Exonic
956757032 3:72398856-72398878 TCTGCCAAAACCTTGTCAGCCGG - Intronic
957221908 3:77393252-77393274 CCTGCAAAGGTGTGGTAAGCAGG + Intronic
957946432 3:87069091-87069113 CCTGGTCAGACCTGGTAAGAAGG + Intergenic
961323677 3:126096868-126096890 CCTGCCAAGACCAGCTCAGTTGG - Intronic
961805116 3:129483721-129483743 GCTGACAAGACCAGGGAAGCTGG + Intronic
968130841 3:196192028-196192050 CCTGCAAAGACCAGGTGTGCTGG - Intergenic
968914975 4:3493397-3493419 CCTGGCGAGCCCTGGGAAGCAGG + Exonic
971216294 4:24665277-24665299 GCTGCAAGGACCTGGTAAGTGGG + Intergenic
986544022 5:8875610-8875632 CCTGCCATGCCCTGGGAAGGAGG - Intergenic
989179210 5:38559078-38559100 CCTGCCAAGGCCTGGGATGGAGG + Intronic
989599946 5:43192075-43192097 CCGGCCTGGACCTTGTAAGCTGG - Intronic
991477419 5:67037291-67037313 CCCTCCAAGAACTGGGAAGCTGG - Intronic
998124179 5:139605259-139605281 CCTGCAAAGATCTGGTAAGCAGG + Intronic
999797578 5:155002802-155002824 CATGAGAGGACCTGGTAAGCAGG - Intergenic
1006919253 6:37616645-37616667 ACTGCCAGGACTTGGTAGGCTGG - Intergenic
1019860915 7:3657401-3657423 CCTGCCGAGTCCTGGAAAGAGGG + Intronic
1024737035 7:52316777-52316799 GCTGCATAGACCTGGTGAGCAGG + Intergenic
1026085401 7:67259046-67259068 CTTGCCAAGACCAGGTACGGTGG + Intergenic
1026691769 7:72555846-72555868 CTTGCCAAGACCAGGTACGGTGG - Intergenic
1028259406 7:88642316-88642338 TCTACCAAGCCCTGGTGAGCAGG + Intergenic
1028370619 7:90087563-90087585 CCCCCCAAGACCTGGTGAGGGGG + Intergenic
1029034762 7:97507782-97507804 CTTGCCAAGATCCAGTAAGCTGG - Intergenic
1030112374 7:106037901-106037923 CCTGCCAACAGCCTGTAAGCAGG + Intergenic
1037770502 8:21796362-21796384 CCTGCCAAGCCTTGGGGAGCCGG + Intronic
1037974309 8:23199226-23199248 CCCTCCAAGACCTTGTAGGCAGG - Intronic
1038021374 8:23554341-23554363 CCTGCCCTGCCCTGGTAAGAGGG - Intronic
1042839331 8:73107972-73107994 CCAGCCAGGACCTGGAAACCAGG - Intronic
1043521222 8:81047585-81047607 CTGGGCATGACCTGGTAAGCAGG + Intronic
1045064131 8:98430602-98430624 CCTGCCATGACATGGAAACCTGG + Exonic
1047514396 8:125541134-125541156 CCTCCCAAGAAGTGGTCAGCTGG + Intergenic
1047928346 8:129702457-129702479 CCTGCCTAGACCTAGGAAGGTGG - Intergenic
1047928363 8:129702614-129702636 CCTGCCTAGACCTAGGAAGGTGG - Intergenic
1047928377 8:129702738-129702760 CCTGCCTAGACCTAGGAAGGTGG - Intergenic
1049661826 8:143823013-143823035 CCTGCCAAGTGCTGGGATGCTGG + Intronic
1049673892 8:143881217-143881239 CCTGCCCAGGCCTCGGAAGCCGG + Intergenic
1058575515 9:106396708-106396730 CCTGCAAAGCCCTGGTGATCTGG - Intergenic
1060404394 9:123366091-123366113 CGTGCCACGACCTGGTCAACGGG + Exonic
1060822760 9:126671138-126671160 CCTGCCAACGGCTGGTGAGCTGG - Intronic
1061590462 9:131594486-131594508 CCTGCCAAGCCCTGCTTGGCAGG + Intronic
1186318936 X:8403044-8403066 ACTGCTAAGACTTGGTCAGCAGG + Intergenic
1192531744 X:71893666-71893688 CCTGACTAGACCTGGTGAGCAGG - Intergenic
1194979983 X:100430626-100430648 CCTGCCATGGCCTGGTAAACAGG - Intergenic
1200822894 Y:7606181-7606203 CCTCCCAGGACCTGGACAGCAGG + Intergenic
1200878047 Y:8180355-8180377 CCTCCCAGGACCTGGAATGCAGG + Intergenic
1201056133 Y:9994142-9994164 CCTCCCAAGACCTGGACGGCAGG - Intergenic
1202189953 Y:22231437-22231459 CCTCCCAGGACCTGGACAGCAGG + Intergenic
1202237161 Y:22724908-22724930 CCTCCCAGGACCTGGACAGCAGG - Intergenic