ID: 1141151713

View in Genome Browser
Species Human (GRCh38)
Location 16:81568806-81568828
Sequence CACCCACTCGCCTTTCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141151713_1141151719 19 Left 1141151713 16:81568806-81568828 CCAGTCTGAAAGGCGAGTGGGTG 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1141151719 16:81568848-81568870 TGGCCCAGTTGACAATTGAAGGG 0: 1
1: 0
2: 1
3: 15
4: 100
1141151713_1141151718 18 Left 1141151713 16:81568806-81568828 CCAGTCTGAAAGGCGAGTGGGTG 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1141151718 16:81568847-81568869 GTGGCCCAGTTGACAATTGAAGG 0: 1
1: 0
2: 0
3: 12
4: 78
1141151713_1141151716 -1 Left 1141151713 16:81568806-81568828 CCAGTCTGAAAGGCGAGTGGGTG 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1141151716 16:81568828-81568850 GACCTGGGAAAACGCACTTGTGG 0: 1
1: 0
2: 0
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141151713 Original CRISPR CACCCACTCGCCTTTCAGAC TGG (reversed) Intronic
900318126 1:2069562-2069584 CACCTACTGTCCTTTGAGACAGG - Intronic
900430192 1:2597733-2597755 CACCCCTGCGGCTTTCAGACAGG + Intronic
901441957 1:9283387-9283409 CACCAACTTGCTTTTCAGACAGG - Intergenic
903028505 1:20446212-20446234 CACCCACTTGACCTGCAGACTGG - Intergenic
903954418 1:27015207-27015229 CTCCCATTCGCCTGTCAGGCAGG + Intergenic
904591943 1:31619791-31619813 CCCAGACTTGCCTTTCAGACAGG + Intronic
905390176 1:37631128-37631150 CACCCCCTCGCCTGTCAGGGAGG + Intronic
906637349 1:47417925-47417947 CACCAACTCCCCTTTCAGTCAGG - Exonic
908648153 1:66302161-66302183 GACCCACTGGCCTTGGAGACAGG + Intronic
914903103 1:151722549-151722571 CCCCCACCCTCCTTTCAGCCTGG + Intronic
916870217 1:168905807-168905829 CTCCCACTCACCTTTCAGGATGG + Intergenic
921737290 1:218642805-218642827 CACCCACTCCCCTAACAGCCTGG - Intergenic
1062844092 10:690897-690919 CACTCACTCCCCTTTCAGAGTGG + Intergenic
1069673726 10:70232763-70232785 CACCCCCTCGTTTTACAGACGGG - Intronic
1071529479 10:86377813-86377835 CCCCCACTGGCTTTTCTGACTGG - Intergenic
1078152055 11:8767748-8767770 TACCCCCTCGCCTTTGAGATGGG + Intronic
1084398647 11:68931167-68931189 CACCCACTCGGATCTCAGAGTGG - Intronic
1085403327 11:76247322-76247344 CACCCAACCGGCTTTCAGTCTGG + Intergenic
1089831998 11:121337173-121337195 CACCCACTTGCCTGTGAGCCTGG - Intergenic
1095434416 12:42171456-42171478 TAGCCACTGGCATTTCAGACTGG + Intronic
1096057060 12:48662501-48662523 CACCCGCTTTCCTTTCAGATGGG + Intronic
1101616798 12:106345739-106345761 CACCCGGTCGCCTCACAGACTGG - Intronic
1102256398 12:111418101-111418123 CACCCACGTGTCTTTCAGCCCGG + Exonic
1102857513 12:116307049-116307071 CACCCAGTCCCCATTCAGAATGG + Intergenic
1106124195 13:26886738-26886760 CACATACTCTCCTTTGAGACTGG - Intergenic
1112490467 13:99858680-99858702 CAACTGCTCACCTTTCAGACTGG + Intronic
1113828059 13:113272231-113272253 CACCCACTGAGCCTTCAGACTGG + Intergenic
1121729977 14:96179877-96179899 CACACACTTGCCTAGCAGACTGG - Intergenic
1121783899 14:96640236-96640258 CACCCACCTGCCTTTCAGAGGGG + Intergenic
1122843668 14:104478983-104479005 CACTCACTCTCCTTCCACACTGG + Intronic
1125285831 15:38091556-38091578 CACCCACTTTCCTTTTAGAGCGG - Intergenic
1127963180 15:63905428-63905450 CACCCATGCGCCTCCCAGACAGG - Intergenic
1131624417 15:94102400-94102422 CCCCAATTCGGCTTTCAGACTGG + Intergenic
1132838279 16:1965531-1965553 CCCCGACTCGCCTATCAGCCTGG + Intergenic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1136288241 16:29256731-29256753 CACACACTCATCATTCAGACAGG - Intergenic
1141151713 16:81568806-81568828 CACCCACTCGCCTTTCAGACTGG - Intronic
1141518100 16:84559743-84559765 CACCTCCTCCCCTTTCAGACTGG + Intergenic
1145291640 17:21551372-21551394 CAGCCCCTCGCCATGCAGACGGG - Exonic
1145388428 17:22435656-22435678 CAGCCCCTCGCCATGCAGACGGG + Intergenic
1147958990 17:44154731-44154753 CACCCTCTCCCTTTGCAGACAGG + Intronic
1150009838 17:61493393-61493415 CAACCACTGGCTTTTCAGTCTGG - Intergenic
1157619335 18:49007066-49007088 CACCCACTCCTCTCTCAGCCTGG + Intergenic
1160122829 18:76145911-76145933 CACTCTCTAGCCTTCCAGACAGG - Intergenic
1166783572 19:45354606-45354628 CACACACTCTCCTGTCACACAGG + Intronic
926154098 2:10441615-10441637 CACCCACATGCATTTCAGGCAGG + Exonic
929831104 2:45347096-45347118 CACCCAATCACTTTTCACACTGG - Intergenic
930155671 2:48105522-48105544 CACCTACTCGCCTCTCACCCTGG - Intergenic
931817304 2:65917294-65917316 CACCCACAAGCCCTCCAGACAGG - Intergenic
938123826 2:128656023-128656045 CACCCAATCCCCTATCAGAGTGG - Intergenic
941822020 2:169853121-169853143 CTCCCTCTCACCTTTCAAACTGG - Intronic
942499855 2:176578093-176578115 TCCCCACTCCCGTTTCAGACGGG + Intergenic
943761247 2:191611848-191611870 CAACCAATCGCCTGTCAGAGTGG - Intergenic
948599286 2:239099295-239099317 CACCTCCACGCCTTTCAGAATGG - Intronic
1176309720 21:5143066-5143088 CCCCCAGCCGCCTTTCAGAAGGG - Intronic
1179655639 21:42842573-42842595 GCCCCACTCCCCTTCCAGACAGG - Intergenic
1179847338 21:44118967-44118989 CCCCCAGCCGCCTTTCAGAAGGG + Intronic
1183009362 22:34932185-34932207 CACCCACCCTCCTTCCAAACAGG - Intergenic
949906432 3:8862527-8862549 CTCCCACTCGGCTGTCAGCCGGG - Intronic
956757192 3:72400515-72400537 CATAGACTCGCCCTTCAGACAGG + Intronic
963814257 3:149812645-149812667 CACCCACTCTGATCTCAGACTGG + Intronic
964570320 3:158103323-158103345 CACCCACTGGCCTCTCACACCGG + Intronic
967279079 3:187805016-187805038 CACCCACTCCCCTCTCCGAAGGG + Intergenic
973169568 4:47122616-47122638 CACCCAGTGTCCTTTGAGACTGG - Intronic
983810889 4:172060710-172060732 CACCCACTACCATTTCAGGCTGG + Intronic
984327408 4:178271548-178271570 CACCCTCTCCCCTTTCAGCTGGG + Intergenic
998451316 5:142236450-142236472 CTCCCACTCGCCATGCAGTCCGG - Intergenic
999492447 5:152064516-152064538 CACCCACTGACCTTTGAGAGTGG - Intergenic
1000905665 5:166963070-166963092 CACCCACTCCGCATTCTGACAGG - Intergenic
1001591971 5:172871905-172871927 CACCAACTAGCCTCTCAGCCAGG + Intronic
1005206318 6:23409499-23409521 CACCCACACACCTTCCACACAGG + Intergenic
1018033987 6:159866473-159866495 CCCCCACTGGCCTTCCAGGCAGG - Intergenic
1019050124 6:169176468-169176490 CAGCCACTCGCCATGCAGAGTGG + Intergenic
1022511381 7:30936964-30936986 CACCCACTCTCCTTACAGGTGGG - Intergenic
1023636251 7:42213890-42213912 CACCCAAACGGCTTTCAGCCGGG + Intronic
1025255023 7:57378956-57378978 TCCCTACTCTCCTTTCAGACAGG - Intergenic
1035319020 7:158016351-158016373 CTCCCCCTCGCCCTTCAGCCAGG - Intronic
1038439872 8:27564346-27564368 CACCCTCTCCCCATTCAGCCAGG + Intergenic
1042503817 8:69538523-69538545 CTCCCCCTCGCCTTCCAGACAGG - Intronic
1046664537 8:116986304-116986326 CTCCCACTCTCCTACCAGACCGG - Intronic
1048254841 8:132897972-132897994 CACCCACTTGTCTTTCAGGCTGG - Intronic
1048314825 8:133354108-133354130 GACCCACTCACCTTTTACACAGG + Intergenic
1049011905 8:139892886-139892908 CACCCAGTCGTCTATCAGCCAGG + Intronic
1050623436 9:7478336-7478358 CAGCCACTCTCCTCTCAGCCCGG + Intergenic
1050950356 9:11583805-11583827 CACCCACTCTCCACTGAGACTGG + Intergenic
1052297676 9:26916235-26916257 TATCCACTGGCCTTGCAGACTGG - Intronic
1057008849 9:91583974-91583996 CACCCACTCCCCTCCCTGACAGG + Intronic
1059520264 9:114934215-114934237 CACCCAGCCTCCTTTCAGCCTGG + Intergenic
1061037102 9:128120078-128120100 CACCCACTGGCCCTTCCGACTGG - Intergenic
1188756197 X:33967468-33967490 GACTCACTCACCTTTCATACTGG - Intergenic
1200083495 X:153591345-153591367 CACCCAGTCATCGTTCAGACTGG - Intronic