ID: 1141151792

View in Genome Browser
Species Human (GRCh38)
Location 16:81569435-81569457
Sequence ATGTCCCTCTGGGAGAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 180}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141151792_1141151803 6 Left 1141151792 16:81569435-81569457 CCCTGGCTCTCCCAGAGGGACAT 0: 1
1: 0
2: 0
3: 24
4: 180
Right 1141151803 16:81569464-81569486 GGCTGGGCCTCAGGGGATCCTGG 0: 1
1: 0
2: 7
3: 57
4: 441
1141151792_1141151801 -2 Left 1141151792 16:81569435-81569457 CCCTGGCTCTCCCAGAGGGACAT 0: 1
1: 0
2: 0
3: 24
4: 180
Right 1141151801 16:81569456-81569478 ATGGCACTGGCTGGGCCTCAGGG 0: 1
1: 0
2: 3
3: 31
4: 270
1141151792_1141151800 -3 Left 1141151792 16:81569435-81569457 CCCTGGCTCTCCCAGAGGGACAT 0: 1
1: 0
2: 0
3: 24
4: 180
Right 1141151800 16:81569455-81569477 CATGGCACTGGCTGGGCCTCAGG 0: 1
1: 1
2: 3
3: 45
4: 370
1141151792_1141151802 -1 Left 1141151792 16:81569435-81569457 CCCTGGCTCTCCCAGAGGGACAT 0: 1
1: 0
2: 0
3: 24
4: 180
Right 1141151802 16:81569457-81569479 TGGCACTGGCTGGGCCTCAGGGG 0: 1
1: 0
2: 3
3: 52
4: 401
1141151792_1141151799 -10 Left 1141151792 16:81569435-81569457 CCCTGGCTCTCCCAGAGGGACAT 0: 1
1: 0
2: 0
3: 24
4: 180
Right 1141151799 16:81569448-81569470 AGAGGGACATGGCACTGGCTGGG 0: 1
1: 0
2: 0
3: 23
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141151792 Original CRISPR ATGTCCCTCTGGGAGAGCCA GGG (reversed) Intronic
900176157 1:1292310-1292332 ATGCCCCTCGGGGAGGGCAAGGG + Intergenic
900774716 1:4573906-4573928 AGGTCCCTCCTGGACAGCCAGGG + Intergenic
901468098 1:9436158-9436180 AGGTCCCTCTGGCAGGGCCATGG - Intergenic
901634559 1:10664524-10664546 ACGTCCTGCTGGGAGGGCCAGGG + Intronic
902761477 1:18583649-18583671 ATGTCACTCTGAAAGAGCAATGG - Intergenic
902886436 1:19408128-19408150 ATGCCCCACTGTGGGAGCCAAGG + Intronic
903586455 1:24419323-24419345 CTGTCTGCCTGGGAGAGCCACGG + Exonic
903975886 1:27149928-27149950 ATGTGTCTCTAGGAGTGCCAAGG - Intronic
904043236 1:27596078-27596100 ATGCCCCTCTGGGAGAATGAAGG + Intronic
904698902 1:32346681-32346703 AGGTCCCTATGGGACATCCAGGG - Intergenic
904839078 1:33359445-33359467 ATGTGCCTGTGGGAGAGGAATGG + Intronic
905300187 1:36981660-36981682 ATGTTCCTCCAGGAGGGCCAGGG + Intronic
905910247 1:41648481-41648503 ATGTCCCACTAGGGGGGCCAGGG + Intronic
905925286 1:41745310-41745332 ATGTCCCTCAGGGAACTCCAGGG + Intronic
907257421 1:53190490-53190512 ATGTTCCTTTGGGAGAGTCAAGG - Intergenic
907603068 1:55789289-55789311 AGGTCCCTTTGGGAAAGGCAGGG + Intergenic
907800596 1:57761544-57761566 ATCTTCCTCTGGGAAAGCCTTGG - Intronic
915615295 1:157033150-157033172 AAGTGCCTGTGGGAGATCCAAGG - Intronic
916197587 1:162239240-162239262 AGGTGCCTCTAGGAGAGCCGAGG + Intronic
921898312 1:220424078-220424100 CTATCCCTTTGGAAGAGCCAGGG + Intergenic
924167895 1:241304327-241304349 ATGGCTACCTGGGAGAGCCATGG + Intronic
924945635 1:248844937-248844959 AAGTCCCTCTGGAGGAACCAAGG + Intronic
1063651492 10:7942158-7942180 ACATCCCTCTGTGAGAGCCAGGG + Intronic
1063979369 10:11441354-11441376 ATGGCCCTCTGCGAGAAACAAGG + Intergenic
1065425510 10:25598837-25598859 GTATGCCTTTGGGAGAGCCAAGG + Exonic
1068918385 10:62457973-62457995 ATGTCTCCCTGGGAGAGCTAAGG - Intronic
1071828233 10:89346943-89346965 AGCTCCCTCTGGGAGACCAAAGG - Intronic
1072467845 10:95683173-95683195 ATGACCCTCTTACAGAGCCAGGG - Exonic
1074283912 10:112080070-112080092 ATGTCCCAGAGGGAGAGACATGG + Intergenic
1074575380 10:114663901-114663923 TTTTCCTCCTGGGAGAGCCACGG - Intronic
1075635451 10:124027329-124027351 TTGTCCCTTGGGGAGAGACATGG - Intronic
1077155894 11:1090653-1090675 ATGCCCCTCTGGGAAGGCCGGGG - Intergenic
1082798863 11:57398921-57398943 ACCTTTCTCTGGGAGAGCCAAGG - Intronic
1083308407 11:61772435-61772457 CTGGCCTTCTGGGTGAGCCAGGG - Intronic
1089350448 11:117818954-117818976 ATGTCACTCTGGATAAGCCACGG + Intronic
1091274355 11:134340405-134340427 ATGTGCCTCTGAGGGAACCAGGG + Intronic
1091599030 12:1906771-1906793 ATCTCTCTCTTGGAGTGCCAAGG - Intronic
1091691323 12:2599340-2599362 ATGTCCCCCTTGGACAGCCACGG - Intronic
1092494785 12:8982374-8982396 ATTTCCTTCTGGGAAAGTCAAGG - Intronic
1092641262 12:10513259-10513281 ATGCTCCTCTGGGAGAATCAAGG + Intronic
1093405435 12:18798600-18798622 AACACCCTCTGGCAGAGCCAGGG + Intergenic
1094367269 12:29697613-29697635 ATCTCGCTCCAGGAGAGCCAGGG + Intronic
1095906149 12:47380111-47380133 ATGGTCCTCTGGAAGACCCAAGG + Intergenic
1096779825 12:53985410-53985432 TCGTCCCTCTTGGAGAGCGAGGG - Exonic
1096815703 12:54200502-54200524 ATGTCCCACTTGGAAAGTCAAGG + Intergenic
1099000393 12:77172036-77172058 ATGTCTCTCTGGGGAATCCAGGG + Intergenic
1102548117 12:113671256-113671278 AAATGCCTCTGGGTGAGCCAGGG + Intergenic
1104058284 12:125246885-125246907 ATTTCCCACCGGGAGAGCCTGGG + Intronic
1104963195 12:132497845-132497867 AGGTCCCTGAGGGAGGGCCAGGG + Intronic
1105604107 13:21912588-21912610 ATGTCCGTCTGGGAGTTCCTGGG + Intergenic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1106485148 13:30165969-30165991 GTGTCCCTCTGGGAGAGCAGAGG + Intergenic
1108169352 13:47725260-47725282 ATGTTCCTGTGGGGAAGCCAGGG - Intergenic
1113424790 13:110199164-110199186 ATGTGCCCCTGGGAGAGCTGAGG + Intronic
1114454295 14:22845326-22845348 ATGACCCTCTGGGAGACTCAGGG - Exonic
1116016867 14:39417846-39417868 ATGTTTCTATGGGAGAGCAAAGG + Intronic
1116768938 14:49104958-49104980 ATGTCCATTTGGGAGAGAAAAGG + Intergenic
1116960455 14:50963163-50963185 GTGATCCTCTGGGAGGGCCAGGG + Intergenic
1118772102 14:68949136-68949158 CTAACCCTCTGGGAGAGCCTCGG + Intronic
1119529347 14:75348691-75348713 ATGTCAGTCTGGGAGAAGCATGG + Intergenic
1121309008 14:92924698-92924720 GTGTTCCTTTGGGACAGCCAGGG - Intronic
1122863481 14:104593178-104593200 AGGTCCTACTGGGACAGCCAAGG + Exonic
1125041770 15:35195919-35195941 ATTTGGCTCTGAGAGAGCCAGGG + Intergenic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1127892855 15:63270413-63270435 ATGTCCCTGTAGTAGATCCAAGG - Intergenic
1128978639 15:72170563-72170585 ATGTCCCTGAGGGAGAGCGTAGG + Intronic
1129494947 15:75970557-75970579 ATGACCCTCAGGGAGGGCCCTGG + Intronic
1130292322 15:82613876-82613898 ATGCCCCCCTGGGACAGCCCGGG + Intronic
1130975262 15:88769015-88769037 ATCTCCCTCTCGGAGATTCACGG - Intergenic
1131531169 15:93193335-93193357 ATGTCTGTGTGGGAGAGTCACGG + Intergenic
1131714295 15:95091535-95091557 ATCTTCCTCTGTGAGAGCTATGG - Intergenic
1133239317 16:4405055-4405077 ATGTCCCTCTTGCAGAGCCCAGG + Intronic
1133247043 16:4455793-4455815 ATCTCCCTCTGCCTGAGCCAGGG - Exonic
1135127979 16:19827330-19827352 TTGTCCCTGTGGGAGAGAAATGG - Intronic
1136674198 16:31885388-31885410 ATGTCCCTCTTTGACAGCAAGGG - Intronic
1136991237 16:35152478-35152500 CTGTCCCCCTTGGAGAGCCTAGG + Intergenic
1137627737 16:49920268-49920290 ATGTCCCTCTTGGATACCCTTGG + Intergenic
1137924034 16:52522636-52522658 CTGTCCCACTGGGAAAGCAAGGG + Intronic
1138418568 16:56885250-56885272 ATTTACCTCTGGGAGAGCAAGGG - Exonic
1141151792 16:81569435-81569457 ATGTCCCTCTGGGAGAGCCAGGG - Intronic
1142692981 17:1617992-1618014 AGGTCACGCTGGGAGAGTCAAGG + Intronic
1143106849 17:4534403-4534425 ATGGCCCTCTGGGCGTGGCAGGG + Intronic
1143209667 17:5175774-5175796 TTGTCTGTCTGGGAGATCCAAGG + Intergenic
1143833681 17:9672718-9672740 ATTTCCCTTTGGGAGACCCATGG - Intronic
1144617729 17:16791901-16791923 TTGTCTGTCTGGGAGATCCAAGG - Intronic
1144894976 17:18523781-18523803 TTGTCTGTCTGGGAGATCCAAGG + Intergenic
1147647276 17:42041182-42041204 ATGGCCACCTGGGACAGCCAGGG + Intronic
1151310477 17:73289666-73289688 ATGACCCTCTTGGCCAGCCATGG + Intronic
1151558109 17:74857038-74857060 ATGTCCCTATGGGTGAGACATGG + Intronic
1151698452 17:75730226-75730248 ATGTCCCTCTGGGGAAGGCAAGG - Exonic
1151816184 17:76472595-76472617 GTGTCCCTCTGGCAGATCCCAGG + Intronic
1152039478 17:77893634-77893656 ATTTCCCTCTCTGAGAGCCGAGG - Intergenic
1152574652 17:81134708-81134730 ATGTCCCCCTGGCGAAGCCAGGG - Intronic
1152916599 17:83039946-83039968 ATGTCCCCATGTGAGAGCCTGGG - Intronic
1155440631 18:25858264-25858286 ATGTCCTTCTGGGAGATTCTTGG - Intergenic
1155922686 18:31619036-31619058 ATATCCGTCTTGGAGAGGCAAGG + Intergenic
1156495696 18:37524019-37524041 GTGTCTCTCTGGGATATCCACGG - Intronic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1157905371 18:51564745-51564767 AAGTTCCTCTAGGAGAGCCCAGG - Intergenic
1159733531 18:72063213-72063235 ATTTCCCACTGTCAGAGCCATGG - Intergenic
1160455616 18:78996961-78996983 ATCACCCCCTAGGAGAGCCATGG - Exonic
1160712447 19:558802-558824 CTGACCCTCAGGCAGAGCCAGGG - Intergenic
1161731294 19:5962350-5962372 ACACCCCTCTGGGAGTGCCAGGG - Intronic
1163675891 19:18655118-18655140 AGGTCCCGCTGGGAGAGCCTCGG - Intronic
1163730939 19:18948869-18948891 CTCTCCCTCTGGCAGACCCAGGG - Intergenic
1165002652 19:32778077-32778099 TTGTCACTCTGGGAGCTCCAGGG - Intronic
1165447939 19:35866909-35866931 GTTCCCCTCAGGGAGAGCCAGGG - Exonic
1165631328 19:37304545-37304567 AGGTTCCTGTGGGAGACCCAGGG + Intergenic
1166008883 19:39926739-39926761 AGGGCCCTAGGGGAGAGCCAGGG - Intronic
1167386274 19:49166026-49166048 AGGTCCCTCTGGGGGTGCGAGGG - Exonic
1167595603 19:50426340-50426362 ACCTCCCTGTGGGAGAGCCATGG - Intronic
1168379887 19:55911161-55911183 ATGTCCCTATGTTAGAGCCATGG + Intronic
925158385 2:1664056-1664078 ATGGCCAGCTGGGAGAACCAGGG + Intronic
925350010 2:3194391-3194413 GTGACCCTCTGGGCGAGCCGTGG + Intronic
927690899 2:25207418-25207440 GTTTTTCTCTGGGAGAGCCAAGG - Intergenic
929054352 2:37863014-37863036 ATGGTCATCTGGGAGGGCCAGGG - Intergenic
932409243 2:71535432-71535454 ATGTCCCCTTGGGGTAGCCAGGG + Intronic
932466318 2:71926531-71926553 CTGTCCCTGTGGGATAGGCATGG - Intergenic
934028113 2:88017519-88017541 TTGTCCCTCTGGCAGACCCTAGG + Intergenic
935076903 2:99754102-99754124 ATGGCCCTATGGGGGAGCCAAGG - Intronic
946014654 2:216594163-216594185 AGGTCACTCTGGTAGTGCCATGG + Intergenic
946163953 2:217852505-217852527 ATGTTCCACAGTGAGAGCCATGG + Intronic
946432942 2:219635228-219635250 AGGACCCTCAGGGACAGCCAAGG - Intronic
1170607935 20:17887738-17887760 AAGTCCCACTGGCAGGGCCAAGG + Intergenic
1170795754 20:19545561-19545583 AGGTCCCTCTGAGATAGGCATGG + Intronic
1171453427 20:25252352-25252374 ATGTCCCTCTGGGGGGGTCGGGG + Intronic
1171774652 20:29354396-29354418 ATTGCTCTCTGTGAGAGCCACGG - Intergenic
1172027630 20:31959928-31959950 AAGTCCCTCTGGGAGAGCTGAGG - Intergenic
1172657698 20:36547020-36547042 GTGTCCCCCTGGGATGGCCATGG - Intronic
1174201569 20:48809798-48809820 ATGCCCCTTTGGGAGAACCTGGG - Intronic
1174545822 20:51324431-51324453 ATGGTCCTCTAGGAGAGCCGAGG + Intergenic
1175498122 20:59429171-59429193 CTGTCCCTCTGGAAAAGCAATGG + Intergenic
1176386811 21:6142097-6142119 ATGAGCCTCAGGGAGAGGCAAGG - Intergenic
1179474034 21:41631999-41632021 GTGACCCTCTGGAAGAGACAAGG + Intergenic
1179736662 21:43396155-43396177 ATGAGCCTCAGGGAGAGGCAAGG + Intergenic
1180127021 21:45799881-45799903 ATGTCCCTGTGGCTGAGCCCAGG + Intronic
1180320134 22:11312627-11312649 ATTGCTCTCTGTGAGAGCCATGG - Intergenic
1181029803 22:20144235-20144257 ATGTCCTACAGGGAGGGCCAGGG - Intronic
1181513467 22:23399083-23399105 ATGTCCCACAGGGAGGGCCAGGG + Intergenic
1184873215 22:47254718-47254740 ATATTCCTCTAGGAGAGCAAGGG + Intergenic
1184953114 22:47860217-47860239 ATTTCCCTCTGGGAGAGGTTTGG + Intergenic
950514645 3:13456552-13456574 ATGTCACACTGGGAAAGGCATGG + Intergenic
950634878 3:14307675-14307697 ATGTCCCAGTGGGAGAGGCGCGG - Intergenic
953372111 3:42397686-42397708 ATGTGACTCTGGGAAAGTCACGG - Intronic
953902951 3:46853568-46853590 ATGTGCCTCTGGCCCAGCCATGG - Intergenic
953956595 3:47236332-47236354 GTTTCTCTCTGGCAGAGCCAGGG - Intronic
954100498 3:48368918-48368940 ACGTGCCTCTGGAAGAGTCAGGG + Intergenic
956346622 3:68286710-68286732 ATATTCCTCTGGGACAGCCTCGG - Intronic
958892129 3:99794749-99794771 AGGGCCCCCTGGGAAAGCCAGGG + Exonic
962241959 3:133757319-133757341 ATTTCCTTCTGGGAGGGTCATGG - Intronic
966775157 3:183537155-183537177 CTGCTCCTCTGGGAGATCCATGG + Intronic
966943582 3:184761949-184761971 CTGTCCCTCCGGAAGAGCCTGGG + Intergenic
971377943 4:26069991-26070013 ATATCCCACTGGGGGAGGCAGGG - Intergenic
971677234 4:29647820-29647842 ATGTACATCTGGGAGAGCCTGGG - Intergenic
973716961 4:53686334-53686356 AATTTGCTCTGGGAGAGCCAAGG + Intronic
976004095 4:80407512-80407534 ATGTTCTTCTGGCAGAGGCAGGG + Intronic
976441677 4:85083030-85083052 ATGTGCTTCTGAGAGAGACATGG - Intergenic
979484506 4:121255198-121255220 TTGTCCCTCTAGAAGATCCAAGG + Intergenic
983484600 4:168318585-168318607 ATGTCCCTTGGGAAGAGCCTGGG - Intronic
991227885 5:64293372-64293394 ATTCCTCTCTGTGAGAGCCACGG + Intronic
997295274 5:132764943-132764965 GTGTCCTTCTGGGAGTCCCAGGG + Intronic
999069214 5:148725899-148725921 ATGTCCCTGTGGGAGGCTCAAGG + Intergenic
999133409 5:149301267-149301289 CTGTCCCTCTGGAGGAGGCAAGG + Intronic
999492809 5:152068157-152068179 ATGAGCCTCAGGGAGAGCCAGGG - Intergenic
1001716172 5:173818128-173818150 ATGTCCCTCATGGGGAGCCTGGG - Intergenic
1002166542 5:177351252-177351274 ATGCCCCTCTGGGACTTCCAGGG - Exonic
1002209511 5:177588783-177588805 ATGGCGCTCTGGGGGAGGCAGGG - Intergenic
1004342324 6:14818625-14818647 ATGTGCCTCTGGGAGGGCAAGGG - Intergenic
1007661314 6:43488402-43488424 ATGTCCCTCAGAGACAGCCAGGG - Intronic
1008019090 6:46555386-46555408 ATCCTCCTCTGGGAGAGCCCTGG - Intronic
1009927223 6:70134651-70134673 AAGGCCCTGTTGGAGAGCCAAGG - Intronic
1010448727 6:75978444-75978466 ATGCCCCTCTGAGAAAGGCAAGG + Intronic
1011383324 6:86766529-86766551 GAGTCACTCTGGGACAGCCAAGG + Intergenic
1014154545 6:118095319-118095341 ATGTCCTTGTTGGAGTGCCACGG - Intronic
1022902244 7:34822318-34822340 AGGGCTCTCTGGGAGAGTCATGG + Intronic
1023043670 7:36193826-36193848 ACCTCCCTCTGGGAGGGCCTGGG + Intronic
1023885187 7:44349190-44349212 TTGACTCTCTGGGAAAGCCATGG - Intergenic
1024800383 7:53071005-53071027 ATGTGCCTTTAGGAGAGACATGG - Intergenic
1024845722 7:53639242-53639264 ATGAGCTTCTGGGAGAGACATGG - Intergenic
1028826850 7:95283430-95283452 ATCTCCCACTTGGAGGGCCAGGG - Intronic
1030259082 7:107543830-107543852 AGGCTCCTCTGGCAGAGCCAGGG + Intronic
1033248961 7:139742439-139742461 ATATCCCTCTTGGAGATCCACGG - Intronic
1034066830 7:148145061-148145083 AAGACCCACTGTGAGAGCCAAGG - Intronic
1037308428 8:17529825-17529847 ATGTCCCTCTGGGCCAGGCGTGG - Intronic
1038845778 8:31228546-31228568 AGGACCCTCTGGGAAAGCCCTGG + Intergenic
1039432940 8:37539753-37539775 AAGTCCCTGCAGGAGAGCCAAGG + Intergenic
1041470980 8:58208814-58208836 TTGCCCCTGTGGGAGAGCCTGGG + Intergenic
1041685547 8:60641496-60641518 ATCTCCAGATGGGAGAGCCATGG + Intergenic
1046591003 8:116207070-116207092 GTTCCCCACTGGGAGAGCCACGG + Intergenic
1048988930 8:139750110-139750132 ATGCCACACTGGGACAGCCAGGG - Intronic
1050063533 9:1735017-1735039 ATGTCCCAGTTGGAGAGTCATGG - Intergenic
1053410246 9:37911612-37911634 CTGCCCCTGTGAGAGAGCCAGGG - Intronic
1053858053 9:42357648-42357670 TTGTCCCTCTGGCAGAACCTAGG - Intergenic
1054253127 9:62738592-62738614 TTGTCCCTCTGGCAGAACCTAGG + Intergenic
1056577811 9:87869319-87869341 ATGCCCCCCAGGGAGAGCCATGG + Intergenic
1056615453 9:88161528-88161550 ATGTCCCTTGGGAGGAGCCAGGG - Intergenic
1058747946 9:108009924-108009946 GTGTGCCTCTGGGAAAGTCATGG + Intergenic
1203368354 Un_KI270442v1:278381-278403 ATTGCTCTCTGTGAGAGCCATGG - Intergenic
1186443379 X:9604917-9604939 ATGATCCTCTGGGAGAGGCTTGG + Intronic
1189295994 X:39918257-39918279 AGGTCCCTCTGAGAGGGCAAAGG + Intergenic
1190690171 X:52907389-52907411 CAGCCCCTCTGGGAGAGGCACGG - Exonic
1190695812 X:52948403-52948425 CAGCCCCTCTGGGAGAGGCACGG + Exonic
1192173741 X:68873283-68873305 CTGACCCACTAGGAGAGCCAAGG - Intergenic
1193258643 X:79379743-79379765 ATTTCTCTCTGTGAGTGCCAGGG - Intergenic
1195420474 X:104669793-104669815 AAGTGCCTGTGGGACAGCCAAGG - Intronic