ID: 1141153229

View in Genome Browser
Species Human (GRCh38)
Location 16:81579155-81579177
Sequence TGCAATAGCCCTAGGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 1, 2: 3, 3: 21, 4: 186}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141153229_1141153238 10 Left 1141153229 16:81579155-81579177 CCCTGCCTCCTAGGGCTATTGCA 0: 1
1: 1
2: 3
3: 21
4: 186
Right 1141153238 16:81579188-81579210 GGGGTTACTTCTTAACAATGAGG 0: 1
1: 0
2: 0
3: 4
4: 105
1141153229_1141153241 29 Left 1141153229 16:81579155-81579177 CCCTGCCTCCTAGGGCTATTGCA 0: 1
1: 1
2: 3
3: 21
4: 186
Right 1141153241 16:81579207-81579229 GAGGAGGAAGATGAAGGTGAAGG 0: 1
1: 4
2: 47
3: 518
4: 3193
1141153229_1141153237 -9 Left 1141153229 16:81579155-81579177 CCCTGCCTCCTAGGGCTATTGCA 0: 1
1: 1
2: 3
3: 21
4: 186
Right 1141153237 16:81579169-81579191 GCTATTGCAGGGATGATAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 126
1141153229_1141153242 30 Left 1141153229 16:81579155-81579177 CCCTGCCTCCTAGGGCTATTGCA 0: 1
1: 1
2: 3
3: 21
4: 186
Right 1141153242 16:81579208-81579230 AGGAGGAAGATGAAGGTGAAGGG 0: 1
1: 0
2: 10
3: 204
4: 1939
1141153229_1141153236 -10 Left 1141153229 16:81579155-81579177 CCCTGCCTCCTAGGGCTATTGCA 0: 1
1: 1
2: 3
3: 21
4: 186
Right 1141153236 16:81579168-81579190 GGCTATTGCAGGGATGATAAGGG 0: 1
1: 0
2: 1
3: 7
4: 133
1141153229_1141153240 23 Left 1141153229 16:81579155-81579177 CCCTGCCTCCTAGGGCTATTGCA 0: 1
1: 1
2: 3
3: 21
4: 186
Right 1141153240 16:81579201-81579223 AACAATGAGGAGGAAGATGAAGG 0: 1
1: 0
2: 3
3: 97
4: 1009
1141153229_1141153239 13 Left 1141153229 16:81579155-81579177 CCCTGCCTCCTAGGGCTATTGCA 0: 1
1: 1
2: 3
3: 21
4: 186
Right 1141153239 16:81579191-81579213 GTTACTTCTTAACAATGAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141153229 Original CRISPR TGCAATAGCCCTAGGAGGCA GGG (reversed) Intronic
900161296 1:1225217-1225239 GGCAACAGCACTGGGAGGCAGGG + Intronic
901872234 1:12144939-12144961 TGCCCAAGCCCTGGGAGGCAGGG + Intergenic
903470879 1:23586496-23586518 TGCAAGAGCCCTAGAAGGGCTGG - Intronic
904095597 1:27974664-27974686 TATAACAGCCCTATGAGGCAGGG - Intronic
904436711 1:30503660-30503682 TGCAACAGTGCTGGGAGGCAGGG + Intergenic
904658750 1:32069068-32069090 GTCACTAGCCTTAGGAGGCAGGG + Intergenic
904772854 1:32890487-32890509 TGCAATAGCCTTGTGAGGCAGGG - Intronic
905826866 1:41032461-41032483 TGAAATAACACTAAGAGGCATGG + Intronic
906208494 1:43999533-43999555 GGCCATAGCCCCAGAAGGCATGG + Intronic
910729996 1:90384657-90384679 AGCAAAAGCCCTTGGAAGCAGGG - Intergenic
913564414 1:120057902-120057924 TGCAACAACCCTAAGAGACAGGG - Intronic
913633714 1:120735662-120735684 TGCAACAACCCTAAGAGACAGGG + Intergenic
913706815 1:121433882-121433904 TGCTGTAACCCTAGGTGGCAAGG - Intergenic
914285001 1:146217251-146217273 TGCAACAACCCTAAGAGACAGGG - Intronic
914417110 1:147494289-147494311 GGGAATAGACCTAGGAGGAATGG + Intergenic
914546032 1:148667990-148668012 TGCAACAACCCTAAGAGACAGGG - Intronic
914620532 1:149402676-149402698 TGCAACAACCCTAAGAGACAGGG + Intergenic
916415397 1:164587947-164587969 AGAAAGAGCCCTAGGATGCAAGG + Intronic
917679714 1:177353490-177353512 TGCAATAGACCTAGAAGGGCAGG + Intergenic
918411834 1:184267277-184267299 TACAAGAATCCTAGGAGGCAAGG - Intergenic
918507284 1:185270112-185270134 TGCAGTAGCCCTACGAAGTAGGG + Intronic
919165420 1:193885496-193885518 TCCAAGAGCACAAGGAGGCAAGG + Intergenic
920216812 1:204366968-204366990 TGCCATTGCCCCAGGAGGCTGGG + Intronic
920852015 1:209634465-209634487 TGCATTAGGCCTCTGAGGCAGGG + Exonic
921016748 1:211198906-211198928 TGGAATATCTCTAGGAGGAATGG + Intergenic
922041550 1:221903082-221903104 TGCAGTCTCCCTTGGAGGCATGG - Intergenic
923393517 1:233537010-233537032 TGCAATAACTCAAGGAGCCAGGG + Intergenic
923721975 1:236474712-236474734 TGCATTGTCCCTGGGAGGCAAGG - Intronic
1063353416 10:5376392-5376414 TGGGATAGCCCTGTGAGGCAGGG - Intergenic
1064059601 10:12127058-12127080 AGGAAAAGCCCTAGGTGGCATGG + Intergenic
1065277323 10:24098188-24098210 TGCAAGGGCCCTAGGAGGTGTGG + Intronic
1068722600 10:60262868-60262890 TGCAATACCCTTAAGAGTCAAGG + Intronic
1070810240 10:79293854-79293876 TCAAGCAGCCCTAGGAGGCAGGG - Intronic
1071060763 10:81569558-81569580 TGCAGTCTCCCTTGGAGGCATGG - Intergenic
1071717835 10:88114788-88114810 TGCAAAGGCCCTAGGAGGGCAGG - Intergenic
1072793779 10:98338512-98338534 TGAAACAACCCTAGGAGGAAAGG - Intergenic
1073637883 10:105218309-105218331 TACAAAAGCCCCACGAGGCAAGG - Intronic
1075134282 10:119769238-119769260 TGCAGTACCCCTTAGAGGCAAGG + Intronic
1075650225 10:124123125-124123147 TTCATTAGCCCAAGGAGGAAGGG - Intergenic
1081412263 11:42773861-42773883 GGCAGGAGCCCCAGGAGGCAGGG - Intergenic
1081667776 11:44926661-44926683 TGTAACAGCCCTGGGAGGGAGGG - Exonic
1083938683 11:65883495-65883517 GGAAATAGCCCTAGGAGGTTAGG - Exonic
1084726162 11:70943552-70943574 GGCAATACCCCTGGGCGGCAGGG + Intronic
1084947494 11:72646364-72646386 TCCAACAGCCTCAGGAGGCACGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1085198192 11:74684665-74684687 TCCCATATCCCTAGGAGGAAGGG - Intergenic
1085296237 11:75433290-75433312 TGGACTAGCCCTGGGAGGGAGGG + Intergenic
1085646237 11:78224823-78224845 TGCAATAGACCCAGGCTGCACGG - Intronic
1085844729 11:80051904-80051926 TGCAATAACCCTAGAAGTTAGGG + Intergenic
1089749917 11:120643726-120643748 TACAACAACCCTAAGAGGCACGG - Intronic
1090259841 11:125311441-125311463 TGCTATAGCCCTAGGTAGAAGGG + Intronic
1090320819 11:125842008-125842030 TGCAATAGCATTAAGAGGTAGGG + Intergenic
1091660761 12:2381546-2381568 TGCAACAGCCCTGGGAAGCCTGG + Intronic
1091785911 12:3243345-3243367 TGCCGCAGCCCCAGGAGGCAGGG + Intronic
1093352405 12:18119885-18119907 TTCAATAGTCTTAGCAGGCAAGG - Intronic
1093630820 12:21407261-21407283 TGCAAAAGCCTTAGGATGGAAGG + Intronic
1094018202 12:25885731-25885753 TGCAGTCTCCCTTGGAGGCATGG + Intergenic
1095804371 12:46302335-46302357 CACAATAACCCTAGGAAGCAGGG - Intergenic
1097324532 12:58261422-58261444 TACAATAGCCCATAGAGGCAAGG - Intergenic
1097924000 12:65107718-65107740 TGAAATAGCCCTTGGAAACAAGG + Intronic
1100507813 12:95237266-95237288 TGCAATAACCTTATGAGGCATGG - Intronic
1102327339 12:111998520-111998542 AGAAATAGCCCTATGAGGCTGGG + Intronic
1102427622 12:112856833-112856855 TGCAACAATCCTAGGAGGTAAGG + Intronic
1102884225 12:116509148-116509170 CCCAACAGCCCTAGGAGGCAAGG - Intergenic
1105225846 13:18430779-18430801 TGCACTAGCCCATGGATGCATGG - Intergenic
1106031703 13:26010695-26010717 AGCAATTGCCCTGGAAGGCATGG - Intronic
1106812214 13:33370115-33370137 TGCAACAGTCCTATGAGGCAGGG - Intergenic
1109375456 13:61486437-61486459 AGCTTTAGCCCGAGGAGGCAAGG + Intergenic
1113813534 13:113156414-113156436 TGCAATAGTACTAGGAGGTGGGG + Intergenic
1114010298 14:18359129-18359151 TGCACTAGCCCATGGATGCATGG - Intergenic
1114146304 14:19981585-19981607 TGCACTAGCCCACGGATGCATGG - Intergenic
1117199443 14:53373267-53373289 TGCAATAGGCACAGGAGGCAGGG + Intergenic
1118846512 14:69551404-69551426 TGCAGCTGCCATAGGAGGCAGGG + Intergenic
1119431184 14:74569009-74569031 TGCAAGTGCTCTAGGAGACAAGG - Intronic
1120723490 14:87912927-87912949 GGCTTTAGCCCTAGGATGCAAGG - Intronic
1122866817 14:104609717-104609739 GGCAAGAGCCCTGGGAGGCAGGG - Intergenic
1128994358 15:72285878-72285900 TTAAATATCCCTAGGAGACAGGG - Exonic
1133366906 16:5217376-5217398 TGCAATAACCCTGTGAAGCATGG - Intergenic
1133698220 16:8285193-8285215 TGGAATAGCCCTAGAAATCATGG - Intergenic
1133817643 16:9210394-9210416 TGCAAAGGCCCCAGGAGGCAAGG + Intergenic
1135051932 16:19200511-19200533 TGCAGCAGCCATAAGAGGCAAGG + Intronic
1135726157 16:24855224-24855246 TGCAATAGTATTAAGAGGCAGGG + Intronic
1137573740 16:49584462-49584484 TCCTATAGCTCTAGGAGGCTCGG - Intronic
1137847310 16:51703368-51703390 TCCAATAACACTACGAGGCACGG - Intergenic
1138476027 16:57271034-57271056 TGCCATAGCCCCAGGAAGCAGGG - Intronic
1139320748 16:66111895-66111917 TGCAATAGTATTAAGAGGCAGGG + Intergenic
1141153229 16:81579155-81579177 TGCAATAGCCCTAGGAGGCAGGG - Intronic
1143307823 17:5961485-5961507 TTCAATGGCCCAAGGAAGCAAGG - Intronic
1148827455 17:50404478-50404500 AGCATTAGACCTAGGAGGCAGGG + Intergenic
1149449657 17:56739742-56739764 TGCAGGAGCACTAGGAGGGATGG - Intergenic
1149452429 17:56760239-56760261 TCCAATATCCCTGAGAGGCAAGG + Intergenic
1150307072 17:64094691-64094713 AGCAAGAGCTCAAGGAGGCAAGG - Intronic
1151513816 17:74579484-74579506 GGGAATAGCCCCAGGTGGCACGG + Exonic
1152424008 17:80209178-80209200 TGCAACAGCCCCAGGAGGCAGGG - Exonic
1152511124 17:80789598-80789620 GGCAAAAGCCCTAGGAAGAAGGG - Intronic
1154527530 18:15308742-15308764 TGCACTAGCCCATGGATGCATGG + Intergenic
1155309566 18:24510408-24510430 TGCAGAGGCCCTGGGAGGCATGG + Intergenic
1159583639 18:70262291-70262313 TGCAATAGCCTTAGGGATCACGG - Intergenic
1161306921 19:3573565-3573587 TGCATGAGCCCGAGGAGGCAGGG - Intronic
1162551035 19:11358349-11358371 TAGAACAGCCCTAGGAGGCCGGG - Intronic
1166006767 19:39913585-39913607 TATAATAGCCCTATGAGGTAGGG - Intronic
1166672023 19:44716172-44716194 TTCAACAATCCTAGGAGGCAGGG - Intergenic
925305709 2:2846841-2846863 TGCAGCAGCCCAGGGAGGCAGGG + Intergenic
927496330 2:23554083-23554105 TGGAGCAGCCCCAGGAGGCAGGG + Intronic
927995889 2:27485712-27485734 TGCAAATGCACTAAGAGGCAGGG + Intronic
929353931 2:40996346-40996368 TGCACTTACCCTAGGAGGCATGG - Intergenic
929808820 2:45170529-45170551 TGCAAATGCCGTAGGAGGCCAGG - Intergenic
929992855 2:46804124-46804146 TGCCACAGCCCCACGAGGCAGGG - Intergenic
932522580 2:72428574-72428596 TGCAGTCTCCCTTGGAGGCATGG + Intronic
933645210 2:84807155-84807177 TGAAATAGCCCTGAGAGGAATGG + Intronic
935747033 2:106197407-106197429 TGCAACAGCCCTGTGGGGCAGGG + Intergenic
937533386 2:122857103-122857125 TGCAAAACCCCTAGGTGCCATGG + Intergenic
938526626 2:132140199-132140221 TGCACTAGCCCATGGATGCACGG + Intergenic
939638542 2:144611879-144611901 AGAAATCGCCTTAGGAGGCACGG - Intergenic
942521911 2:176813327-176813349 TGCATTGGCCCTGGGAGGCGAGG + Intergenic
945936191 2:215905011-215905033 TGCAATAACCCTGTGAGGTAGGG + Intergenic
946059963 2:216933334-216933356 CTCAATAGCCCTGGGAGGCAGGG + Intergenic
946148972 2:217751359-217751381 GTCAAAAGCCCTGGGAGGCATGG - Intronic
947202662 2:227628796-227628818 TGCAATTACCTTAGGAGGAATGG - Intronic
1168860329 20:1041715-1041737 GGGAAGAGCCATAGGAGGCAGGG - Intergenic
1173060354 20:39654474-39654496 TGCAGTAGGGCTAGGAGGCAAGG + Intergenic
1176769901 21:13059802-13059824 TGCACTAGCCCATGGATGCATGG - Intergenic
1180434794 22:15289930-15289952 TGCACTAGCCCATGGATGCATGG - Intergenic
1183173422 22:36204563-36204585 CGCAATAGCTCTATGAGGGAAGG - Intronic
1183178166 22:36239376-36239398 TGCAATAGCTCTATAAGGGAAGG - Intronic
1183462291 22:37959163-37959185 TACAATAACCTTATGAGGCAGGG - Intronic
1183692261 22:39397162-39397184 TGTAACATCCCTGGGAGGCAGGG + Intergenic
1184058651 22:42068565-42068587 AGCAAGAGCACTAGGGGGCAAGG + Exonic
950181518 3:10916904-10916926 TGCAATGACCCTAGGAATCAAGG - Intronic
951162905 3:19448185-19448207 TGAAATAGCCCTATGAGTAAGGG + Intronic
951182158 3:19671536-19671558 TGCAGTCTCCCTTGGAGGCATGG - Intergenic
952766738 3:36960884-36960906 TGCAATAGTAGTAAGAGGCAGGG + Intergenic
954973502 3:54671699-54671721 TGCAATAGTCCATGGAGGGAGGG + Intronic
955222938 3:57038028-57038050 CACACCAGCCCTAGGAGGCAGGG + Intronic
957454485 3:80423186-80423208 TGCAAAAACCTTAGGAGACATGG - Intergenic
958675429 3:97264252-97264274 TGCATTCTCCCTTGGAGGCATGG - Intronic
960274254 3:115709226-115709248 TGCAAAAGCAAGAGGAGGCAGGG - Intronic
962414334 3:135168526-135168548 TGCATTAGCCCTTCCAGGCAGGG + Intronic
964555346 3:157930901-157930923 TTCAATAGCCCTGTGAGGGAAGG - Intergenic
965309764 3:167114783-167114805 TGCAATCTCCCTTGGAGGCGTGG - Intergenic
967640696 3:191859529-191859551 TGCATTAGCCCTGAGAGGCTAGG + Intergenic
971647002 4:29219547-29219569 TGCAATAGGCCTGGCAGGCGAGG - Intergenic
977044326 4:92050602-92050624 TGCCATAGCCCTCAGTGGCAAGG - Intergenic
978259128 4:106731734-106731756 TGCAAGTGCCCCAGTAGGCATGG - Intergenic
981005069 4:139866107-139866129 TGCAGAACCCCCAGGAGGCAGGG + Intronic
981677801 4:147359900-147359922 TGCATGAGACCCAGGAGGCAGGG - Intergenic
986092191 5:4520742-4520764 GGCAATACCCCTAGGTGGCAGGG + Intergenic
987656851 5:20818192-20818214 TGGAATAGCTTTAGGAGGAATGG - Intergenic
987730607 5:21766530-21766552 TGCAACAGCACTATGAAGCAGGG - Intronic
988766702 5:34385759-34385781 TGGAATAGCTTTAGGAGGAATGG + Intergenic
990806207 5:59665689-59665711 TGCAATAGTGTTAGGAGGTAGGG + Intronic
991445158 5:66691774-66691796 TGCGATAGTATTAGGAGGCAGGG - Intronic
991924932 5:71695858-71695880 TGCAATAGCCCTAGGAGGTGTGG + Intergenic
992011365 5:72531006-72531028 TGCAATAGCGCTAGGAGGCAGGG - Intergenic
992032518 5:72736603-72736625 GGCTTTATCCCTAGGAGGCAAGG - Intergenic
992391993 5:76338028-76338050 TGCAGTAGCAGTAGGTGGCATGG - Intronic
992676018 5:79107173-79107195 TACAATAGCCCTGTGAGGTAGGG - Intronic
993108159 5:83623714-83623736 TGCAACAGCACTGGGAGGTAGGG + Intergenic
993582209 5:89677101-89677123 TGCTGTAGCCCTTGGTGGCATGG - Intergenic
993841349 5:92883686-92883708 TGCTCTAGCCCTGGGAGGCTTGG - Intergenic
994300471 5:98141135-98141157 TGCAATAGGAATGGGAGGCAAGG - Intergenic
995910909 5:117185228-117185250 TGCAGTAGCCCAGGGAAGCAAGG + Intergenic
996927526 5:128846016-128846038 TGCTATAGCTCTTGGTGGCAAGG - Intronic
1000441371 5:161267709-161267731 TGGAGAAGCCCTAGGAAGCAGGG - Intergenic
1001947214 5:175789680-175789702 TGCAATAGCACTGGGAGGTGGGG + Intergenic
1002863821 6:1103526-1103548 GGCAAGAGCCCTAGGAAGCTGGG - Intergenic
1003278696 6:4674058-4674080 GGGAATAGCCCGGGGAGGCATGG + Intergenic
1004050769 6:12076708-12076730 TGCAACAGCAATGGGAGGCAGGG - Intronic
1004507356 6:16257858-16257880 TCCAATGGCATTAGGAGGCAGGG - Intronic
1005932848 6:30496710-30496732 TACAATGGCCCAAGGAGGCAGGG - Intergenic
1006459470 6:34150007-34150029 TGCAATACCCCCAGGAGGCCTGG - Intronic
1012678844 6:102153503-102153525 TGCTATAGCCCTTGGTGGCAAGG - Intergenic
1014310931 6:119800610-119800632 TGCAAGATCCCTTGTAGGCAAGG - Intergenic
1015906332 6:138121045-138121067 TGCAATGGTACTAGGAGGCGGGG + Intergenic
1017316908 6:153041967-153041989 TACAATGGCCTTACGAGGCAGGG + Intronic
1019335389 7:480312-480334 GGCAAGAGCCCTGGGGGGCAGGG + Intergenic
1020745604 7:12074728-12074750 TGCACTAGCCCACGGATGCATGG - Intergenic
1022445226 7:30464921-30464943 TGCAACAACCCTAGGTGCCAGGG + Intronic
1025113868 7:56241214-56241236 TGGAATAGCTCAAGGAAGCAAGG + Intergenic
1031024059 7:116661554-116661576 TCCAAGAGCCCTAGCAGGCATGG + Intergenic
1033606471 7:142931660-142931682 TCCAATAGCCCCAGGAGCCAGGG + Intronic
1034398493 7:150846063-150846085 TGCAATAGTCTTGGGGGGCAAGG - Intronic
1035835598 8:2748440-2748462 TGCAATAAACATAGGAGGCCAGG - Intergenic
1036940482 8:13047657-13047679 TGCAATAGCCCTGGAAAGCTGGG + Intergenic
1039631906 8:39121663-39121685 TGCTACAGGCCCAGGAGGCAAGG + Intronic
1040359395 8:46650899-46650921 TGCAATGACCCCAGTAGGCAGGG - Intergenic
1040676112 8:49752266-49752288 TTCAATAGCCCTATGTGGCTAGG + Intergenic
1041258229 8:55997596-55997618 GGCAATAGTATTAGGAGGCAGGG - Intronic
1044921511 8:97174373-97174395 TGAAATAGCCTAGGGAGGCAGGG - Intergenic
1048736730 8:137510307-137510329 TGGAATAGCCAAAGGAGTCATGG - Intergenic
1048864739 8:138751487-138751509 TCCAATAGGCCCAGAAGGCAGGG - Exonic
1050455417 9:5830312-5830334 TGCAGTAACCCTTGAAGGCAGGG + Intronic
1050932586 9:11349088-11349110 TGCAGTAGCTGTAGGAGCCAGGG - Intergenic
1053705334 9:40747557-40747579 TGCACTAGCCCATGGATGCATGG + Intergenic
1054415410 9:64871164-64871186 TGCACTAGCCCATGGATGCATGG + Intergenic
1055339338 9:75264367-75264389 TGCTATAGCCCTTGGAGGCAAGG + Intergenic
1059984317 9:119807335-119807357 TTCAATATTCCTAGGAGGAAGGG + Intergenic
1060404948 9:123368525-123368547 TGCCACAGCCCCATGAGGCAGGG + Intronic
1060987621 9:127828695-127828717 TGCCAAAGTCCTAGGAGGGAGGG - Intronic
1061428391 9:130515649-130515671 TCCAATAGCCCTGGAAGGAAGGG - Intergenic
1185913017 X:4003233-4003255 TGCAATAGTATTAAGAGGCAGGG + Intergenic
1189283192 X:39833576-39833598 CTCAACAGCTCTAGGAGGCAGGG + Intergenic
1191041380 X:56084297-56084319 TGCTTTAGCCCTAGAAGTCAAGG + Intergenic
1192928227 X:75778724-75778746 TGCAAAAGGCCTAGGAGGGAGGG - Intergenic
1193147591 X:78093216-78093238 TGCTGTAGCCCTCGGTGGCAAGG + Intronic
1194920346 X:99758060-99758082 TGCCATAGCCCTTGGTGGCAAGG - Intergenic
1195091207 X:101460853-101460875 TGCATGAACACTAGGAGGCATGG - Intronic
1195934572 X:110112628-110112650 TGCAATAAACTTATGAGGCAAGG + Intronic
1197046974 X:122009304-122009326 TAAAATAGCCCTATGAGGTAAGG + Intergenic
1197083026 X:122441174-122441196 TCCCATAGCCCTAGGACCCAGGG - Intergenic
1198694785 X:139324459-139324481 TGCTGTAGCCCTTGGTGGCAAGG - Intergenic
1199024912 X:142925091-142925113 GGCAAAAGCCATAGGAGACAGGG + Intergenic