ID: 1141153324

View in Genome Browser
Species Human (GRCh38)
Location 16:81579617-81579639
Sequence TGTTGCCTTCAGGGGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 178}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141153324_1141153337 21 Left 1141153324 16:81579617-81579639 CCTGCTCCCCCCTGAAGGCAACA 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1141153337 16:81579661-81579683 CCTTCTGTTTTAAGGGACTCTGG 0: 1
1: 1
2: 0
3: 19
4: 159
1141153324_1141153333 13 Left 1141153324 16:81579617-81579639 CCTGCTCCCCCCTGAAGGCAACA 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1141153333 16:81579653-81579675 GTCACCTGCCTTCTGTTTTAAGG 0: 1
1: 0
2: 0
3: 23
4: 240
1141153324_1141153338 22 Left 1141153324 16:81579617-81579639 CCTGCTCCCCCCTGAAGGCAACA 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1141153338 16:81579662-81579684 CTTCTGTTTTAAGGGACTCTGGG No data
1141153324_1141153334 14 Left 1141153324 16:81579617-81579639 CCTGCTCCCCCCTGAAGGCAACA 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1141153334 16:81579654-81579676 TCACCTGCCTTCTGTTTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141153324 Original CRISPR TGTTGCCTTCAGGGGGGAGC AGG (reversed) Intronic
900009103 1:90020-90042 TGTTTCCTTCGTGGGGCAGCTGG - Intergenic
900130528 1:1085350-1085372 TGGTGCCTTCAGGCGGGGGCGGG - Intronic
902197872 1:14811072-14811094 TGTTGCTTTGAGGGGGGAAATGG - Intronic
904700313 1:32353991-32354013 TGCTGGCTGCAGAGGGGAGCTGG - Intronic
905462440 1:38130477-38130499 TGTTGTCTCCAGGAGGAAGCAGG + Intergenic
909475332 1:76075124-76075146 TGTTGGCTCCAGGGGAGAGCAGG + Intronic
910429359 1:87146096-87146118 TGTGGCCTTCAGATGGGAGCAGG + Intronic
914879927 1:151539406-151539428 TGTTGCCTTGAAGAGGGAGCTGG + Intergenic
914946654 1:152072867-152072889 TGTTGCCTAAAGGGGCCAGCAGG - Intergenic
915040856 1:152967293-152967315 GTTTGCCTGCAGGGTGGAGCTGG + Intergenic
917644907 1:177020341-177020363 TGTTGCCTTCTGGAGGCACCCGG + Intronic
918442066 1:184577380-184577402 TGTTGCCTTCAGAAGGAAGGCGG + Intronic
919807780 1:201390905-201390927 TGTTTCCTTCAGGCAGGACCAGG - Intronic
1063447759 10:6130348-6130370 TGGTGCGGTCAGTGGGGAGCGGG + Intergenic
1063929474 10:11014950-11014972 TGTTGCCATCACTGGGGACCAGG - Intronic
1066344882 10:34574994-34575016 TGTCTCTTTAAGGGGGGAGCAGG - Intronic
1067066969 10:43109661-43109683 TGGTGCCCTCAGGGGGAGGCAGG + Intronic
1067562842 10:47315873-47315895 TGTTTCATTCTGGAGGGAGCAGG + Intergenic
1069421173 10:68247907-68247929 TATTGCCTTCAGTGATGAGCTGG - Intergenic
1070787449 10:79170201-79170223 TGGTGCCTGCAAAGGGGAGCTGG + Intronic
1071468312 10:85960890-85960912 TGGTGGCTTCAGGAGGGAGGAGG + Intronic
1072565120 10:96610816-96610838 TCTTGCCTTCAGGAGGAAGTTGG - Intronic
1072736929 10:97885576-97885598 TGTTTCCTTACGCGGGGAGCTGG - Intronic
1073531051 10:104232253-104232275 TGTTTTCCTCAGGCGGGAGCAGG + Exonic
1076411245 10:130252615-130252637 TGTTGTGTTCAGGGTGGACCTGG - Intergenic
1076481460 10:130787834-130787856 GCCTGCCTTCAGGGGGGAGGTGG - Intergenic
1083486853 11:62988509-62988531 TGGTGCCCTCATGGGGGAGTGGG + Intergenic
1083528830 11:63397987-63398009 TGCTGGCTTCAGGTGGGACCTGG - Intronic
1088129610 11:106471825-106471847 TGTTTCCTCTAGTGGGGAGCTGG + Intergenic
1091168215 11:133499142-133499164 CGTTGACTTCTGGAGGGAGCTGG - Intronic
1091504158 12:1050059-1050081 AATTGCCTTCAGAGGGTAGCTGG + Intronic
1096446588 12:51698384-51698406 TCTTGCCTTCAGAAGTGAGCAGG + Intronic
1101200994 12:102436237-102436259 TGTTGTCTTCAGGTGCTAGCTGG - Intronic
1102497034 12:113326996-113327018 TGTTGCTTTTGGGTGGGAGCTGG - Intronic
1102872053 12:116421513-116421535 TGTTGTCTTCAGGGGCGTGCTGG - Intergenic
1103821577 12:123702803-123702825 TGTTGCCTTCAAGGTGGAAGGGG + Intronic
1104223663 12:126810637-126810659 GGTTGCCATCAGGGGAGACCTGG + Intergenic
1104580860 12:130009789-130009811 TGTTGGCTTCAGGGCAGGGCCGG - Intergenic
1108437985 13:50420233-50420255 TGTTGCCTTGAGGGGGGATCTGG + Intronic
1109127992 13:58542772-58542794 TGTAGCATTCAGAGGGAAGCAGG - Intergenic
1112472638 13:99702727-99702749 TTTTGCCTTAAGGGGCGAGGAGG + Intronic
1114309240 14:21451701-21451723 TGTTGCCTTCAGGTTGCAGCAGG - Intronic
1115350597 14:32390774-32390796 TGTTGCCTTCAGGGGGTATGTGG + Intronic
1118159636 14:63275558-63275580 TCTTGCCTTCAGGGTGAAGTTGG + Intronic
1119427464 14:74545125-74545147 TGTTTCCTTCAGGGAGGCTCAGG + Intronic
1120474425 14:84969553-84969575 TGTTCCCATCAGAGAGGAGCTGG - Intergenic
1120591981 14:86386473-86386495 CCCTGCCTTCAGGGGGGAGAGGG - Intergenic
1122208739 14:100161211-100161233 TGTTGTCCTGAGGGTGGAGCTGG - Intergenic
1122227142 14:100286482-100286504 TGTTGCTTGCAGAGGGGCGCTGG + Intergenic
1122470763 14:101964536-101964558 GGCTGCCTTTAGGGCGGAGCCGG + Exonic
1122903110 14:104790092-104790114 TGGTGCCTTCAGGGGTGATGTGG - Intronic
1123976608 15:25559811-25559833 GGTGGACTTCAGGGGGCAGCCGG - Intergenic
1125579567 15:40775795-40775817 AGTGGCCTTCAGGAGGCAGCTGG - Intronic
1125719011 15:41836252-41836274 TGTGGCCTGCAGGGAGGGGCTGG + Intronic
1127503202 15:59573824-59573846 TGTTGTCTTCAGGTGGGTACAGG - Intergenic
1127833209 15:62769039-62769061 TGCTACCTCCATGGGGGAGCCGG + Intronic
1129610933 15:77056245-77056267 TGTTTTCTACAGGGGGCAGCTGG - Exonic
1133026035 16:2989378-2989400 TGTGGGGTTCAGGGGGAAGCAGG - Intergenic
1136109503 16:28055835-28055857 TGCTGCCTTCAGGACGGTGCAGG - Intronic
1136624799 16:31455787-31455809 TGTTTCCTTCAAGGGGAAACAGG + Intergenic
1138460995 16:57147534-57147556 TGCTGCCTGCAGGGTGGAGGAGG - Exonic
1139341003 16:66267804-66267826 TGTTGCCTTCGGGGGGACCCAGG - Intergenic
1141153324 16:81579617-81579639 TGTTGCCTTCAGGGGGGAGCAGG - Intronic
1141851919 16:86652158-86652180 TTATGCCTTCTGGGGAGAGCAGG + Intergenic
1142455232 16:90216941-90216963 TGTTTCCTTCGTGGGGCAGCTGG + Intergenic
1144576831 17:16434878-16434900 TGTTGCCCTCAGGGTGGAGGAGG + Exonic
1147257899 17:39192948-39192970 TGCTCCCATCAGGGGGGAGAGGG - Intronic
1147449920 17:40497795-40497817 TGTTGCCCTCAGGGTTGAGCTGG - Intronic
1149106449 17:52973051-52973073 TGTTGCATTCAGGGTAGAGAGGG + Intergenic
1151480630 17:74368435-74368457 TGTGGCCACCAGGGGGCAGCAGG + Intronic
1152479793 17:80543046-80543068 TGTTGCCTTCAGATGAGAACGGG + Intergenic
1152584754 17:81183904-81183926 TCTTCCCTTCTGGGGTGAGCCGG - Intergenic
1152937775 17:83150483-83150505 TGTTGCCTTCAGGTTGAAGGGGG - Intergenic
1153589568 18:6659170-6659192 TCTGCCCTTCAGCGGGGAGCTGG + Intergenic
1154006116 18:10528542-10528564 TGTCGACTTCAGGGGAGAGGTGG + Intronic
1155179685 18:23333648-23333670 TTTTTCCTTCAGGTGGGAGTAGG - Intronic
1158115824 18:53994013-53994035 TGGTGATTTCAGGGGAGAGCTGG + Intergenic
1160143785 18:76348106-76348128 GGGTGCCTTGAGGGCGGAGCAGG - Intergenic
1160874838 19:1292153-1292175 TGGCGCCTGCAGGGGGGAGGGGG - Intronic
1161483632 19:4523455-4523477 TGTGGCCACCAGGGGGCAGCAGG + Exonic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1163354051 19:16798131-16798153 TTGTGCCTTCAGAGTGGAGCAGG + Intronic
1164563139 19:29307941-29307963 AGGTGCCTTGAGGGGGCAGCGGG - Intergenic
1164598985 19:29548621-29548643 TGCTGCGTCCAGGGGAGAGCTGG + Intronic
1164717443 19:30403846-30403868 TGTTGCCTTCAGGGATGGGATGG + Intronic
1165335964 19:35169788-35169810 GGTAGCCTTCAGGGGCGGGCAGG - Exonic
1165354687 19:35296186-35296208 TGCTGCCCTCAGGGGGAAACAGG + Intronic
1165461429 19:35946182-35946204 TGTGGCATTCAGGAGGGTGCAGG + Intergenic
1165737056 19:38183502-38183524 ACTTGCCTTGAGTGGGGAGCAGG + Intronic
1165897880 19:39154462-39154484 GGTTGCCTCCAGGGCTGAGCTGG + Intronic
1166751219 19:45164806-45164828 TCTTGCCCTCAGGAGGAAGCTGG + Intronic
1166751244 19:45164933-45164955 GCTGGCCTTCAGGGAGGAGCTGG - Exonic
1168612074 19:57809223-57809245 TGTTGGCTTCAGGTGGAAGATGG + Intronic
1168620456 19:57875346-57875368 TGTTGGCTTCAGGCGGAAGATGG + Intronic
924961709 2:41348-41370 TGTTGCTTCCAGAGGGCAGCTGG - Exonic
926007937 2:9387231-9387253 TATAACCTTCAGGGGGGAGCAGG + Intronic
926117276 2:10221416-10221438 TGCTGCCATCAAGGGCGAGCAGG + Intergenic
927381786 2:22487829-22487851 TTTTGGATTCAGGGGAGAGCTGG + Intergenic
927429107 2:23011896-23011918 TGTGGCCTTGAGGAGGGAGATGG + Intergenic
929454306 2:42055223-42055245 TGCTGACTTCAGGGAGGAGTGGG + Intronic
929915363 2:46131238-46131260 TGTGGCCTTCAGGAGGGCCCTGG + Intronic
932276060 2:70453243-70453265 TCTTCCCTTCAGGAGGGCGCTGG + Exonic
932313182 2:70760624-70760646 TGTTACCTCCAGGGGGAAGCAGG + Intronic
932319663 2:70812446-70812468 TGTGGCCTCCAAGGAGGAGCAGG - Exonic
934814089 2:97309755-97309777 TGGTGCCTTCACGGGGGTGGGGG + Intergenic
936941678 2:117890442-117890464 TCTTGCCTTCAGTGGTGGGCTGG - Intergenic
938605210 2:132885175-132885197 TGTTGCCTTAAGTTGGTAGCAGG - Intronic
938735914 2:134186609-134186631 TGTTGCCTTCTGGGCTTAGCAGG + Intronic
939728435 2:145752473-145752495 TGTGGCCTTCAAGGGGGAAAAGG - Intergenic
944147295 2:196519586-196519608 TTTTGCCTTCAGGGGTGGACTGG - Intronic
945248770 2:207745398-207745420 TGTTGCCTTTACGGGTAAGCTGG - Intronic
946402036 2:219473244-219473266 TGCTGCTTTCAGGAGGGAGAAGG - Intronic
949063837 2:241977166-241977188 TGCTACCTTCAGGGGAGGGCTGG + Intergenic
949086713 2:242161667-242161689 TGTTTCCTTCGTGGGGCAGCTGG + Intergenic
1169066835 20:2698520-2698542 GGGTGCCTGCAGGGGAGAGCAGG + Intronic
1169899484 20:10538334-10538356 TGATGCCTTGCGGTGGGAGCTGG + Intronic
1170554346 20:17503694-17503716 TGTTGCCTGCAGCAGGGAGGAGG - Intronic
1171045721 20:21808287-21808309 TGTGGCCTCCAGGAGGGAGCTGG + Intergenic
1171388002 20:24783093-24783115 TGTGGCCTTTAAGAGGGAGCAGG - Intergenic
1173818630 20:46006590-46006612 TCTTACCTTCAGTGGGTAGCAGG + Intergenic
1174124323 20:48291549-48291571 TGCTGCCTGCAAGGGTGAGCTGG + Intergenic
1175394443 20:58649423-58649445 TGTCCCCTAAAGGGGGGAGCGGG + Intergenic
1175792821 20:61752863-61752885 GGTTCCTTTCAGGGGGCAGCAGG + Intronic
1176239318 20:64068598-64068620 TGTGGCCTGCAGCTGGGAGCTGG + Intronic
1176869744 21:14075219-14075241 TGTTGCCTTGGGGGTGGACCCGG - Intergenic
1178798534 21:35768530-35768552 TCCTGTCTTCAGCGGGGAGCTGG + Intronic
1180621630 22:17166465-17166487 TCTTGCCTTCAGAAGGGACCTGG - Intergenic
1181025572 22:20125516-20125538 TGTTGCCTTTTGGGGAGAGGGGG + Intronic
1181636642 22:24177766-24177788 TGCTGCCTTTGGGGGAGAGCAGG - Exonic
1181958935 22:26609173-26609195 TGTCTCCTTCTGGGGAGAGCAGG - Intronic
1182143642 22:27983516-27983538 TGTTGCCTGCAGGGCGGGTCTGG + Exonic
1182712465 22:32331534-32331556 TGTTTCCTTCAGGAAGAAGCTGG + Intergenic
1183708639 22:39489772-39489794 TGTGGCCTTGAGGGGGAAGTGGG + Exonic
1184771086 22:46596963-46596985 TGCTGCCTCCAGGTGGGATCGGG + Intronic
1184968203 22:47996633-47996655 TGTTGACTTCAGCTGGGTGCAGG + Intergenic
954132518 3:48567753-48567775 TGATGCCTGCAGGGAGAAGCTGG - Exonic
954903287 3:54038689-54038711 TGCAGCCTTCAGGTGGGAGATGG + Intergenic
961386261 3:126524884-126524906 TGTGGATTTCAGGGTGGAGCAGG - Intronic
961518320 3:127452375-127452397 TGTGGCCTTCAGGCAGCAGCTGG + Intergenic
961926790 3:130489851-130489873 TGTTGCGTTCATGGGGAAGAGGG + Intergenic
962635333 3:137325553-137325575 TGGGGGCTTCAGGGAGGAGCTGG + Intergenic
963465464 3:145675184-145675206 TGTTGCATTCAGCTGGTAGCTGG - Intergenic
967833847 3:193944342-193944364 TGACGCTCTCAGGGGGGAGCTGG - Intergenic
967841051 3:194004700-194004722 TGTTTCCTTTAGTGGGAAGCAGG + Intergenic
968452764 4:682987-683009 TGCTGCCTTCAGGAGGGTGGTGG - Intronic
968610394 4:1554315-1554337 AGGTGCCCTCAGGGGGCAGCCGG + Intergenic
971365323 4:25972367-25972389 TCTTGCCTTCATGCGTGAGCAGG - Intergenic
972244400 4:37229423-37229445 TGTTCCCTTCTGGTGGGAGAAGG + Intergenic
973165468 4:47071532-47071554 TGCTGGCTTGAGAGGGGAGCAGG - Intronic
976850471 4:89539518-89539540 TGTGGCCTCCAGAGGGGAGGAGG - Intergenic
980593186 4:134918105-134918127 TGTTGCCTTCTGGGAGCTGCAGG - Intergenic
981673989 4:147319983-147320005 TTATACCTTCAGGGGAGAGCAGG - Intergenic
984657051 4:182329346-182329368 TGTTGCCTTGTGGGAGCAGCTGG + Intronic
987023336 5:13897796-13897818 TCTTCCCTTCATGGGGGAGGGGG + Intronic
987086464 5:14474202-14474224 TGTAGCCTCCTGGAGGGAGCTGG + Intronic
987298000 5:16571144-16571166 AGTTGCCATCAGGGAGGAGATGG + Intronic
988065894 5:26228818-26228840 TGTAGCCTGCAGATGGGAGCTGG - Intergenic
990301776 5:54456023-54456045 TGATGTCTTCAGGGAGGAACTGG - Exonic
998069119 5:139182896-139182918 GGTTTCCTCCAGAGGGGAGCTGG + Intronic
998334343 5:141357369-141357391 TGCTGCCTTCAGCGTGAAGCAGG - Exonic
999449743 5:151668965-151668987 TGTTGCCTTGGAGGGGGAGCAGG + Intronic
1000087637 5:157901962-157901984 GCTTGCCTTCAGGGAGGAGAGGG - Intergenic
1002313297 5:178327764-178327786 GGAGGCCTTCAGAGGGGAGCAGG - Intronic
1002851889 6:1003841-1003863 TGTCGTCCTCAGGGAGGAGCTGG - Intergenic
1003094597 6:3132376-3132398 TGTGGCCCACATGGGGGAGCAGG - Intronic
1003322354 6:5063316-5063338 TGTAGCCCTCAGGGAGGACCTGG + Intergenic
1003514338 6:6805679-6805701 AGTTGGCTTCACGGGGCAGCAGG - Intergenic
1005724416 6:28634959-28634981 TGTTCCCTCCAGCGGCGAGCTGG - Intergenic
1006837390 6:37007264-37007286 TGTAGGCTTCAGGGTGGAGATGG + Intronic
1007070965 6:39037837-39037859 TGATGCCTGCAGGAGGGAGGAGG + Intergenic
1007275607 6:40671334-40671356 TGTTGCCTTGAAGGCGGGGCAGG - Intergenic
1007318329 6:41007902-41007924 TGTCACCCTCAGGGGGGAGGAGG + Intergenic
1007412936 6:41675247-41675269 TGCTGGCTTCAGGGTGGAGTGGG + Intergenic
1015629252 6:135215093-135215115 TGTTGACATCAGTGGGGAGATGG + Intronic
1018710957 6:166497921-166497943 TGGTGACCTCAGGGTGGAGCAGG - Intronic
1018714453 6:166521093-166521115 AGTTGCCTTCTGGAGGGAGCAGG + Intronic
1021085928 7:16421152-16421174 TGTTGCCTGCCGGGGGGTGCGGG - Exonic
1027434815 7:78153518-78153540 TATTGCCTTGAAAGGGGAGCTGG + Intronic
1030271175 7:107669919-107669941 TGTTGCCTTCTGAGGGTAGAGGG + Intronic
1034242699 7:149622528-149622550 TTTTGCCTTGGGTGGGGAGCTGG + Intergenic
1034968204 7:155404233-155404255 TGTTTCCTTCTGGGAGGTGCTGG - Intergenic
1035497996 8:69602-69624 TGTTTCCTTCGTGGGGCAGCTGG - Intergenic
1041330262 8:56716517-56716539 TCTTGCCTTCAGGGAGCAGCAGG - Intergenic
1048968134 8:139628724-139628746 TGATGCCTTAAGGGGGGAAATGG + Intronic
1049323059 8:142007427-142007449 TCTTACCTCCAGGGTGGAGCTGG + Intergenic
1055915678 9:81397725-81397747 TGTTATCTTCAGGGAGGAGAGGG - Intergenic
1056095433 9:83248449-83248471 GGCTGCCTTCACTGGGGAGCTGG + Exonic
1060929456 9:127479692-127479714 TGTAGCCTACTGGGAGGAGCTGG + Intronic
1061623115 9:131824421-131824443 CGCTGCCTTCTGGGAGGAGCTGG + Intergenic
1061903283 9:133683896-133683918 TGTGGCCTTCAGGAGGGGGTGGG - Intronic
1062165833 9:135106828-135106850 TATCGCCTTCAGGGGCGAGAGGG - Exonic
1185573100 X:1149553-1149575 TGTTGCCCTCACTGGGGAGTGGG - Intergenic
1185766790 X:2732231-2732253 TGTTGGCTTCGCGGGGGACCTGG + Intronic
1190324330 X:49197602-49197624 TGTAGCCTCGAGGTGGGAGCTGG + Intronic
1194519497 X:94901401-94901423 CATTGGCTTCAGTGGGGAGCTGG + Intergenic
1200671916 Y:6103420-6103442 TTTTGCCTTCAGTGTGTAGCAGG - Intergenic