ID: 1141154497

View in Genome Browser
Species Human (GRCh38)
Location 16:81587796-81587818
Sequence CTGAGGCTCTCACCCTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141154497_1141154504 15 Left 1141154497 16:81587796-81587818 CCTCCTGAGGGTGAGAGCCTCAG 0: 1
1: 0
2: 1
3: 24
4: 217
Right 1141154504 16:81587834-81587856 CTGTCCAGCCTCCTGGAGAAAGG 0: 1
1: 0
2: 1
3: 25
4: 302
1141154497_1141154508 23 Left 1141154497 16:81587796-81587818 CCTCCTGAGGGTGAGAGCCTCAG 0: 1
1: 0
2: 1
3: 24
4: 217
Right 1141154508 16:81587842-81587864 CCTCCTGGAGAAAGGTGGCCAGG 0: 1
1: 0
2: 1
3: 38
4: 434
1141154497_1141154505 18 Left 1141154497 16:81587796-81587818 CCTCCTGAGGGTGAGAGCCTCAG 0: 1
1: 0
2: 1
3: 24
4: 217
Right 1141154505 16:81587837-81587859 TCCAGCCTCCTGGAGAAAGGTGG 0: 1
1: 2
2: 2
3: 36
4: 389
1141154497_1141154502 8 Left 1141154497 16:81587796-81587818 CCTCCTGAGGGTGAGAGCCTCAG 0: 1
1: 0
2: 1
3: 24
4: 217
Right 1141154502 16:81587827-81587849 GGCCTGACTGTCCAGCCTCCTGG 0: 1
1: 0
2: 1
3: 31
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141154497 Original CRISPR CTGAGGCTCTCACCCTCAGG AGG (reversed) Intronic
900631787 1:3640376-3640398 CTGAGGCTCTGAGCATCAGCAGG + Intronic
900748098 1:4374931-4374953 CTGAGGCTTTCTCCCCCAGGAGG + Intergenic
903647586 1:24904480-24904502 CGGAGGCTCTCGGCCTCAAGGGG - Intronic
904203057 1:28834331-28834353 CTTAGTCCCTCACCCTAAGGAGG + Intronic
904260253 1:29283869-29283891 CTGAGGTTCCCACCCTGGGGAGG + Intronic
905134684 1:35789436-35789458 CTGGCTCTCTCTCCCTCAGGTGG - Intergenic
905255430 1:36678779-36678801 ATGTGGCTCTCTCCCTGAGGTGG - Intergenic
910867432 1:91801290-91801312 TTGCGGCTCTCTCTCTCAGGAGG + Intronic
911548474 1:99250873-99250895 CTGAGGCTCTCTCCCTCACTTGG + Intergenic
913088066 1:115457409-115457431 CTGAGGAACTCACCGTCAGTGGG + Intergenic
913234612 1:116768891-116768913 CTGTGGCCCACAGCCTCAGGAGG - Exonic
913583018 1:120245970-120245992 CCCAAGCGCTCACCCTCAGGTGG - Intergenic
913625154 1:120652390-120652412 CCCAAGCGCTCACCCTCAGGTGG + Intergenic
914509312 1:148317508-148317530 CTGAGGGCCTGCCCCTCAGGAGG + Intergenic
914565006 1:148857788-148857810 CCCAAGCGCTCACCCTCAGGTGG - Intronic
914607818 1:149272454-149272476 CCCAAGCGCTCACCCTCAGGTGG + Intergenic
915934246 1:160081593-160081615 CTGCGGCTCCCACCCTTCGGGGG + Exonic
917511277 1:175671156-175671178 CTGCACCTCTCACCCTCAGTGGG - Intronic
918586063 1:186189779-186189801 ATGAGGCTCGGACCCTCATGCGG - Exonic
920066630 1:203273923-203273945 CTGGGGCTCCCAGCCTGAGGAGG + Intergenic
922729197 1:227941209-227941231 CTGAGGCTCTCCCTGCCAGGTGG - Intronic
922959603 1:229635235-229635257 CTGAGGCACTTACTCTCTGGGGG + Exonic
1064965838 10:21014336-21014358 ATGAGGCCCTTACTCTCAGGGGG - Intronic
1067410510 10:46060390-46060412 CTGTAGCTCTCACCCTCACTGGG + Intergenic
1068771460 10:60826202-60826224 CTGTGGCTCCCACCCAGAGGTGG + Intergenic
1069608674 10:69757694-69757716 CTGAGCCTCTGAGCCACAGGAGG - Intergenic
1069742355 10:70693002-70693024 CTGAGGCTCTCACCAGAAGCAGG - Intronic
1070281472 10:75051969-75051991 TTGAGGCTCCCTCCCTCAGCTGG + Intronic
1070312655 10:75284678-75284700 CTGATGGTCTCACCACCAGGTGG + Intergenic
1071394908 10:85213393-85213415 CTGAGGCCCACACCCCCTGGAGG - Intergenic
1073180488 10:101580169-101580191 CTGAGGTTCTCCCTCTGAGGGGG + Intronic
1074156810 10:110807038-110807060 CTGATGCTCTGATCCTCAGGAGG + Intronic
1075255964 10:120926407-120926429 CTGAGAATCTCACCCTCTGCAGG + Intergenic
1075336983 10:121615758-121615780 CCGAGGCTCTCACCCTGGTGGGG + Intergenic
1076769066 10:132653224-132653246 CTGAGGCTTTCGCCCTCATGTGG - Intronic
1077031995 11:472521-472543 CTGAGGGTCTCACCCTCGGCAGG - Intronic
1077576931 11:3391038-3391060 CTGAGGGTTTCATCATCAGGTGG - Intergenic
1077600699 11:3572501-3572523 CTGGGGCTCTGATCCTCAGCTGG + Intergenic
1079040225 11:17052733-17052755 CTGAGGGTTTCATCATCAGGTGG + Intergenic
1080177841 11:29388243-29388265 CTGAGGCTCTCAACATCTGAAGG - Intergenic
1083674811 11:64319315-64319337 CTGAGGGTCCCACCCTCAGGAGG - Intronic
1084228872 11:67735825-67735847 CTGAGGGTTTCATCATCAGGTGG - Intergenic
1084518785 11:69650478-69650500 CTGAGGTGCTCGCCCTCGGGTGG - Intronic
1084531295 11:69729412-69729434 CTGAGACTTCCATCCTCAGGAGG + Intergenic
1084846401 11:71903869-71903891 CTGAGGGTTTCATCATCAGGTGG + Intronic
1085300654 11:75456382-75456404 CTGTGGCACCCACCCTCTGGGGG - Intronic
1085518059 11:77122754-77122776 CTGAGGCTTCCCCACTCAGGGGG + Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1089586116 11:119510907-119510929 CTGAGACACACACCCTGAGGAGG - Intergenic
1089633465 11:119797516-119797538 CTGAGGCTGTCAGCCTGAGATGG + Intergenic
1089775382 11:120832021-120832043 GGGAGGCTCCCACCTTCAGGAGG - Exonic
1090182858 11:124716282-124716304 TTGTGGCTCCCAGCCTCAGGAGG + Intergenic
1090782409 11:130019379-130019401 CTGAGGCTGCTACCCGCAGGTGG + Intergenic
1091038803 11:132257423-132257445 CTCAAGTTCTCACCCTCTGGTGG - Intronic
1092236733 12:6815149-6815171 CTGGGGCCCTCATCCTCAGGGGG + Intronic
1092519534 12:9253685-9253707 GGGTGGCTCTCACCTTCAGGCGG + Intergenic
1094830296 12:34297102-34297124 GTGCGTGTCTCACCCTCAGGTGG + Intergenic
1096182501 12:49558455-49558477 CTGAGGTTCTCAGCCTCTGCTGG + Intronic
1096507937 12:52108012-52108034 CTGAGGGTTTCATCATCAGGTGG + Intergenic
1096873801 12:54611740-54611762 CTGAGTCTCTTATCCTCAGCAGG + Intergenic
1099751022 12:86772586-86772608 ATGAGGCTGCCACCCTGAGGGGG + Intronic
1100521663 12:95381100-95381122 TAGAGGCTGTCCCCCTCAGGTGG + Intergenic
1103897884 12:124286016-124286038 CTGAGGCTAGCACACTCTGGAGG - Intronic
1105819021 13:24063166-24063188 CTGTGGAGCTCACCCTCACGTGG - Intronic
1106101106 13:26695684-26695706 CTGTGGCTTTCACACTTAGGTGG + Intergenic
1107545677 13:41431496-41431518 CTGAGGGTTTCATCATCAGGTGG - Intergenic
1107547072 13:41443409-41443431 CTGAGGGTTTCATCATCAGGTGG + Intergenic
1107918949 13:45183382-45183404 CTGTGGCTTCCATCCTCAGGGGG + Intronic
1109193267 13:59350777-59350799 CTGAGGGTCACAGCCTCAGATGG - Intergenic
1112095566 13:96128478-96128500 CTGAGGCTCTCCTCCTTAGTTGG + Intronic
1112759584 13:102678943-102678965 CTGATGCTCTGAACCTCAAGAGG - Intronic
1117040316 14:51763323-51763345 CTGAGGGTTTCATCATCAGGTGG - Intergenic
1118501219 14:66364458-66364480 CTGAGTCTCTCACTCTCACTAGG + Intergenic
1119132784 14:72190186-72190208 CTGAGCCTCTCTCCCTAGGGAGG + Intronic
1121472449 14:94165921-94165943 CTGGGGCTCAACCCCTCAGGAGG - Intronic
1122987561 14:105219541-105219563 GGGAGGCTCTCACCCTCACTTGG - Intronic
1125575351 15:40751689-40751711 CTAAGTCTCTAACCCTCAGGAGG + Intronic
1128312234 15:66638220-66638242 ATGAGGCCCTCACCCTCACTTGG - Intronic
1129330131 15:74822950-74822972 CAGACACTCCCACCCTCAGGAGG + Intronic
1129743168 15:78000064-78000086 CTGAGGCTCTAGCCCAGAGGCGG + Intronic
1130148558 15:81293880-81293902 CTGGGACTCTCACCATCAGGTGG - Intronic
1130274431 15:82469160-82469182 CTGAGGCTCAGGCCCTCAGGTGG - Intergenic
1130466778 15:84196534-84196556 CTGAGGCTCAGGCCCTCAGGTGG - Intergenic
1130497486 15:84477002-84477024 CTGAGGCTCAGGCCCTCAGGTGG + Intergenic
1130589073 15:85201127-85201149 CTGAGGCTCAGGCCCTCAGGTGG - Intergenic
1131435109 15:92416171-92416193 CACTGGCACTCACCCTCAGGTGG + Intronic
1132498489 16:274758-274780 CTGAGGCTCCATCCCTCAGCCGG + Intronic
1135484414 16:22851572-22851594 CTGAGATTCTCTCCTTCAGGAGG - Intronic
1136619397 16:31418120-31418142 CTTAGGCCCTCATCCTCAGTGGG - Exonic
1137494914 16:48962227-48962249 CTGAGGCTTAAAGCCTCAGGAGG - Intergenic
1138226899 16:55303754-55303776 AGGAGGCACTCACTCTCAGGAGG - Intergenic
1138714078 16:59001712-59001734 CACACGCTCTCACCCACAGGTGG - Intergenic
1139507812 16:67408026-67408048 AGGAGGCTCTGAGCCTCAGGTGG - Intronic
1141154497 16:81587796-81587818 CTGAGGCTCTCACCCTCAGGAGG - Intronic
1141408493 16:83815556-83815578 CTGAGGCTCTCACTAAGAGGTGG + Exonic
1142713476 17:1735922-1735944 CTGAGCCTCTGACCCTCATCAGG - Intronic
1142991460 17:3733948-3733970 CTGAAGCTCTCTACCTCAGGTGG + Intronic
1143136218 17:4714110-4714132 CTGAGGCTCACAGTCTGAGGAGG + Intronic
1143204397 17:5132221-5132243 CTGTGGCTCTGACTCCCAGGAGG - Intronic
1143730517 17:8880299-8880321 CTGAGGCTCTGGTGCTCAGGGGG - Exonic
1144324172 17:14161777-14161799 CTGAGGCTTTCAGCCTGAGCTGG + Intronic
1146011308 17:29196956-29196978 CTGGGGCACTCACCAGCAGGAGG + Intergenic
1146660949 17:34664884-34664906 CTGGGGGTCTCAGCCTGAGGTGG + Intergenic
1146822927 17:35999008-35999030 CAGAGCCTCTCTGCCTCAGGAGG - Intronic
1147769170 17:42856023-42856045 CTGTGGGTGTCACCCTCTGGGGG + Intronic
1148786607 17:50148996-50149018 CAGAAGTTCCCACCCTCAGGGGG - Intronic
1151328598 17:73393760-73393782 CTGAGGCCCTCACCCTGTGCTGG - Intronic
1151556793 17:74850767-74850789 CTGAGGCTGTCACCCTCCACAGG - Exonic
1151964871 17:77426022-77426044 CAGAGGGTCCCAGCCTCAGGAGG + Intronic
1152931051 17:83110091-83110113 GTGCGGCACTGACCCTCAGGAGG + Intergenic
1153836142 18:8965709-8965731 CTGAGCCTCTTCCCCTGAGGTGG - Intergenic
1155154206 18:23144487-23144509 CTGTCTCTCCCACCCTCAGGAGG + Intronic
1157141494 18:45111786-45111808 TCAAAGCTCTCACCCTCAGGAGG - Intergenic
1159841824 18:73407055-73407077 CTGGGGCTCTCACACTCATGGGG - Intergenic
1160304294 18:77717580-77717602 CTGAGGCAGACACCCTCAAGAGG + Intergenic
1161279619 19:3438738-3438760 CTGAGGATGAAACCCTCAGGAGG - Intronic
1162230401 19:9261202-9261224 CTGAGGGTTTCATCATCAGGTGG - Intergenic
1162476641 19:10904458-10904480 CTGGGGTTCTCACCATCAGATGG - Intronic
1162584963 19:11552958-11552980 CTGAGGCTCTGACGTTCGGGAGG - Intronic
1166390392 19:42406138-42406160 GTGAGGCCCACACCCTCAGCAGG - Intronic
1167137105 19:47623388-47623410 CTGGGGGTCTGACCCTCATGAGG - Intronic
925277938 2:2663604-2663626 CTGAGCCTCTGCCCCTCAGCAGG + Intergenic
927555027 2:24025162-24025184 CCGAGGCCGTCACCCTCAGCAGG - Intronic
928202121 2:29254400-29254422 CTGAGCATCTCACCTTCAGTGGG + Intronic
928987750 2:37197300-37197322 CTGAGGCTCTCGGCTTCAGGAGG - Intronic
929195896 2:39183813-39183835 ATCAGGCTCTGACTCTCAGGAGG + Intronic
929501052 2:42492597-42492619 CTGAGGATTTCGCCCTCAAGAGG + Intronic
932351774 2:71038414-71038436 CTGAGGGTTTCATCATCAGGTGG + Intergenic
934545500 2:95211640-95211662 CCGAGGCTCTCACCCAGTGGAGG + Exonic
937114758 2:119397266-119397288 CTCAGGCTCTCTTCCTCAGAGGG - Intergenic
940871338 2:158863022-158863044 CTGAGGGTTTCATCATCAGGTGG + Intergenic
943821427 2:192327421-192327443 CTGAGGCTCTCACATTCCTGTGG - Intergenic
944479935 2:200145978-200146000 CTGTGGAACTCACACTCAGGTGG + Intergenic
945872797 2:215245829-215245851 CTGAGCCTCTCCCCCTCTGTGGG - Intergenic
946177002 2:217928276-217928298 CTGAGCCTCAGGCCCTCAGGAGG + Intronic
947929193 2:233949173-233949195 CTGTGACTCTCACCCTCTGTGGG + Intronic
947974857 2:234357126-234357148 CTGGAGTCCTCACCCTCAGGTGG - Intergenic
948631016 2:239302853-239302875 GTTAGGCTCTCACCCATAGGAGG + Intronic
1170900111 20:20454361-20454383 CTGAGGCTCTCGCACACAGCAGG + Intronic
1171242951 20:23586283-23586305 ATGCGGCTCTCATCCTCATGTGG - Intergenic
1175199224 20:57266508-57266530 CTGGCGCTCTCGCCCTCGGGCGG + Exonic
1175934424 20:62508470-62508492 CTGAGGCCCTCAGCTCCAGGGGG - Intergenic
1176908354 21:14532240-14532262 CTGCAGCACTCAACCTCAGGTGG - Intronic
1178031294 21:28529349-28529371 CTGAGTCTCTCAGCCTTAGAAGG - Intergenic
1178443960 21:32621777-32621799 CTGAGGGTTTCATCATCAGGTGG + Intergenic
1178973431 21:37201225-37201247 CTCAGGATCTGACCCTGAGGTGG + Intronic
1179016668 21:37600015-37600037 CTGAGCCCCTCTCCCTCTGGAGG + Intergenic
1179579262 21:42329918-42329940 GTCAGGCACTCATCCTCAGGTGG - Intergenic
1182434506 22:30321709-30321731 GGGAAGCTCTCAGCCTCAGGAGG + Intronic
1183195840 22:36352780-36352802 CTGGGGCTCTGACCTTCAGCTGG - Intronic
1184444739 22:44540505-44540527 CTCAGGCTCTCATGGTCAGGGGG - Intergenic
1184504858 22:44894568-44894590 CTCAAGCTCACACCATCAGGCGG + Intronic
1184792389 22:46708050-46708072 CTGAGGCTTCCAGCTTCAGGAGG + Intronic
1184847509 22:47098413-47098435 CTGATGCTGCCACCCCCAGGTGG + Intronic
1185076947 22:48688529-48688551 CTGAAGATCTGGCCCTCAGGGGG - Intronic
951056672 3:18154792-18154814 ATGAGGCTCTGACCCTCAGTAGG + Intronic
951080449 3:18445215-18445237 CCGAGGCTCCCACCGCCAGGGGG - Intronic
951801043 3:26596361-26596383 CTGAGGCTCAATCCCTCAGGGGG + Intergenic
953398965 3:42595893-42595915 CTCAGTCTCACAACCTCAGGAGG - Intronic
954365072 3:50141306-50141328 ATGAGGCTCTCACCCTCCCATGG - Intergenic
954413681 3:50382432-50382454 CTGGGGCACTCTCCCTCGGGCGG + Intronic
954622614 3:52004647-52004669 CTGAGACTCTTACACTCAGGTGG + Intergenic
957045460 3:75370641-75370663 CTGAGGGTTTCATCATCAGGTGG - Intergenic
958061952 3:88494969-88494991 CTCATGCTCTCACTCTTAGGTGG - Intergenic
959649568 3:108738400-108738422 CTGAGGATATCATCCGCAGGAGG - Intergenic
961274041 3:125712818-125712840 CTGAGGGTTTCATCATCAGGTGG + Intergenic
961276927 3:125734976-125734998 CTGAGGGTTTCATCATCAGGTGG + Intergenic
961877496 3:130034765-130034787 CTGAGGGTTTCATCATCAGGTGG - Intergenic
965341940 3:167502218-167502240 CTGAGGCCCTCACCAGAAGGTGG + Intronic
968779686 4:2571027-2571049 CTGTGGCTCTCTCCCTATGGGGG + Intronic
968989738 4:3901797-3901819 CTGAGGGTTTCATCATCAGGTGG - Intergenic
969015122 4:4098807-4098829 CTGGGGCTCTGATCCTCAGCTGG + Intergenic
969060562 4:4430958-4430980 CTGATGCTCTCATCCTGTGGAGG - Intronic
969210194 4:5681446-5681468 GTGAAGGTCTCACCATCAGGAGG + Intronic
969480632 4:7445174-7445196 CAGAGACTCTCACCCTCACCAGG - Intronic
969787398 4:9469730-9469752 CTGAGGGTTTCATCATCAGGTGG + Intergenic
969825573 4:9755554-9755576 CTGAGGGTTTCATCATCAGGCGG + Intergenic
970369094 4:15389864-15389886 ATGAGGCTCACACCGTCAGCAGG + Intronic
976158390 4:82172408-82172430 CTGAAGCTCACAGACTCAGGAGG + Intergenic
980423278 4:132592566-132592588 CAGAAGCTCCCACCCTCAGTCGG + Intergenic
985546868 5:514332-514354 CAGGGGCTCTGTCCCTCAGGGGG + Intronic
985609826 5:881200-881222 CTGAGCGTCTGTCCCTCAGGAGG + Intronic
985693856 5:1329035-1329057 CAGAGGCCCCCACCCACAGGTGG + Intronic
986018066 5:3775218-3775240 CTGAAGCTCTCCTCGTCAGGAGG + Intergenic
995094244 5:108216710-108216732 ATGAGGCACTGACCCACAGGCGG - Intronic
996720807 5:126628376-126628398 GTGAGGCTCTCACCCCAATGTGG + Intergenic
1002466522 5:179411466-179411488 CTGAGGACCCCACCCTCAGTTGG - Intergenic
1002843507 6:925843-925865 CTGGTGCTCTCTCCCTCAGCAGG + Intergenic
1003322766 6:5066927-5066949 CTGAGGCTCTCCGCCTTGGGGGG - Intergenic
1006298438 6:33180449-33180471 CTGAGTCTCCCACCCCCATGGGG + Intronic
1006749057 6:36365226-36365248 CAGAGGCTCTGGCCCTCAGGAGG + Intronic
1007405927 6:41636396-41636418 CTTTGCCTCTCAGCCTCAGGAGG - Intergenic
1007660677 6:43483940-43483962 CTGTGGTCCTAACCCTCAGGAGG + Intronic
1008536347 6:52509080-52509102 CTGGGGCCATCTCCCTCAGGAGG - Intronic
1011806381 6:91077491-91077513 CATAGGCTCTCACCCTCAGCAGG - Intergenic
1013864949 6:114684681-114684703 CTGATGCTCTCTCCCACAAGTGG - Intergenic
1016104865 6:140148883-140148905 CTGTTGCTCTCAGCCTCATGAGG - Intergenic
1019706039 7:2497822-2497844 CTGAGGGAGTCACCCACAGGAGG + Intergenic
1019734693 7:2644922-2644944 CTGAGCCTCTCATCCCAAGGGGG + Intronic
1019754938 7:2762157-2762179 CAAAAGCTCTCACCCTGAGGTGG + Intronic
1020305964 7:6835052-6835074 CTGAGGGTTTCATCGTCAGGTGG - Intergenic
1020312552 7:6879850-6879872 CTGAGGGTTTCATCATCAGGTGG - Intergenic
1021286477 7:18787243-18787265 CTGTGACTCTCACCCTAAAGTGG + Intronic
1021764454 7:23932756-23932778 CTGGGGGTCTCTGCCTCAGGGGG + Intergenic
1022975800 7:35555590-35555612 CTGAGGCTGACACCCACAGAGGG - Intergenic
1024077254 7:45827895-45827917 CTCAAACTCTCAACCTCAGGTGG - Intergenic
1025023364 7:55497031-55497053 CTGAGGCTCCCGCCCACAGGAGG + Intronic
1027433152 7:78135008-78135030 CTCAGGCACTCACCCTCCTGAGG + Exonic
1031993055 7:128210347-128210369 CTGAGTCCCTCTCCCTCTGGAGG - Intergenic
1033627636 7:143126382-143126404 CTGAAGATGTAACCCTCAGGGGG - Intergenic
1035309162 7:157953784-157953806 CGGTCGCCCTCACCCTCAGGAGG - Intronic
1035310630 7:157965623-157965645 CTGGGGCTCTGACCCTCCTGAGG - Intronic
1036243908 8:7100830-7100852 CTGGGGCTCTGATCCTCAGCTGG - Intergenic
1036818496 8:11920051-11920073 CTGAGGGTTTCATCATCAGGTGG - Intergenic
1036904485 8:12696523-12696545 CTGAGGGTTTCATCATCAGGTGG - Intergenic
1038743279 8:30234153-30234175 CAGATCCTCTCACTCTCAGGCGG + Intergenic
1041566729 8:59286834-59286856 CAGAAGCTCTCACCTTCAGGAGG - Intergenic
1042198750 8:66258859-66258881 CTGAGGCTATCAGCCACATGGGG + Intergenic
1042873549 8:73419711-73419733 TTGAGGGTCTAAACCTCAGGTGG + Intergenic
1047493146 8:125390535-125390557 CTGAGGCTCTCACCTGCCTGTGG + Intergenic
1051780611 9:20684510-20684532 CTGGGGCTCTCAGCTTCTGGAGG + Intronic
1052159656 9:25241588-25241610 ATCAGGCTCTCACACTAAGGAGG - Intergenic
1053281662 9:36824212-36824234 CTGAGGGACACAGCCTCAGGAGG + Intergenic
1053803614 9:41779323-41779345 CTGGGGCTTTCTTCCTCAGGAGG + Intergenic
1054955526 9:70905462-70905484 TGGAGGCTGTCACCCTCAGTCGG - Intronic
1055571762 9:77623973-77623995 CAGAGGATCCCACCCTCATGGGG + Intronic
1055810920 9:80146823-80146845 CTGAGGCTACCAGCCTCTGGAGG + Intergenic
1055915839 9:81399405-81399427 TTGAAGCTCTAACCCTCAGTGGG + Intergenic
1056459445 9:86795298-86795320 CTGCGGCACTCACCCTCACTTGG + Intergenic
1056844936 9:90029562-90029584 CTGAGGCTCTCATTCTCTGCTGG + Intergenic
1056915508 9:90742731-90742753 CTGAGGGTTTCATCATCAGGTGG - Intergenic
1057918612 9:99077057-99077079 CTGTGGCTATCAGCCTCAGGAGG - Intergenic
1060396724 9:123321524-123321546 CTGAGACTCTGTCCCCCAGGGGG - Intergenic
1062516436 9:136939308-136939330 CTGAGACTAACACCCTCAGAAGG - Intronic
1186059240 X:5685917-5685939 CAGAGGTTCTCATCCCCAGGTGG + Intergenic
1188504194 X:30863663-30863685 CTGAGGCTCTCACCAGAAGCTGG + Intronic
1189268475 X:39734074-39734096 CTGAGTCCCTCACCCTCTGCTGG + Intergenic
1190366105 X:49696032-49696054 CTGAGGCTAGCACCCAAAGGTGG + Intergenic
1192399491 X:70820590-70820612 CTGAGGCTCTCACCAGAAGCTGG - Intronic
1195406054 X:104514499-104514521 CTGAAGCTCTAACCCCCAGGGGG - Intergenic
1197355973 X:125437716-125437738 CTGAGGTGGCCACCCTCAGGAGG + Intergenic
1198221623 X:134607805-134607827 CCGAGGCTCTCACCTCCCGGAGG - Intronic
1202147155 Y:21810434-21810456 ATGGAGCTCTCATCCTCAGGTGG + Intergenic