ID: 1141156560

View in Genome Browser
Species Human (GRCh38)
Location 16:81601300-81601322
Sequence CCTGCCTGCTGGTTTCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 309}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141156560_1141156576 26 Left 1141156560 16:81601300-81601322 CCCCATGGAAACCAGCAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 309
Right 1141156576 16:81601349-81601371 ACAAAGGCAAGGGAAGGCGAAGG 0: 1
1: 0
2: 3
3: 80
4: 739
1141156560_1141156574 20 Left 1141156560 16:81601300-81601322 CCCCATGGAAACCAGCAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 309
Right 1141156574 16:81601343-81601365 CTCACCACAAAGGCAAGGGAAGG No data
1141156560_1141156568 -10 Left 1141156560 16:81601300-81601322 CCCCATGGAAACCAGCAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 309
Right 1141156568 16:81601313-81601335 AGCAGGCAGGTTTGGGCAGGAGG 0: 1
1: 1
2: 10
3: 88
4: 636
1141156560_1141156570 -3 Left 1141156560 16:81601300-81601322 CCCCATGGAAACCAGCAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 309
Right 1141156570 16:81601320-81601342 AGGTTTGGGCAGGAGGGAGCTGG 0: 1
1: 0
2: 6
3: 106
4: 729
1141156560_1141156571 10 Left 1141156560 16:81601300-81601322 CCCCATGGAAACCAGCAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 309
Right 1141156571 16:81601333-81601355 AGGGAGCTGGCTCACCACAAAGG 0: 1
1: 0
2: 1
3: 16
4: 164
1141156560_1141156572 15 Left 1141156560 16:81601300-81601322 CCCCATGGAAACCAGCAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 309
Right 1141156572 16:81601338-81601360 GCTGGCTCACCACAAAGGCAAGG 0: 1
1: 0
2: 0
3: 12
4: 151
1141156560_1141156569 -9 Left 1141156560 16:81601300-81601322 CCCCATGGAAACCAGCAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 309
Right 1141156569 16:81601314-81601336 GCAGGCAGGTTTGGGCAGGAGGG 0: 1
1: 1
2: 3
3: 56
4: 535
1141156560_1141156573 16 Left 1141156560 16:81601300-81601322 CCCCATGGAAACCAGCAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 309
Right 1141156573 16:81601339-81601361 CTGGCTCACCACAAAGGCAAGGG 0: 1
1: 0
2: 1
3: 14
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141156560 Original CRISPR CCTGCCTGCTGGTTTCCATG GGG (reversed) Intronic
900458848 1:2790507-2790529 CCTGCCAGCTGGTGTCCTGGCGG - Intronic
900801009 1:4737146-4737168 CCTGCCTGCAGTTTACTATGGGG + Intronic
900894963 1:5476972-5476994 CATGCCTGCTAGTTTCTCTGCGG + Intergenic
901014491 1:6220258-6220280 ACTCCCTGATGTTTTCCATGTGG - Exonic
901632143 1:10653201-10653223 CCATCCTGTTGGTTTCTATGTGG - Intronic
904449798 1:30603539-30603561 CCTTCCTTCTGGTCTCTATGTGG - Intergenic
904479067 1:30782867-30782889 CTTGCCCCCTGGTTTCCATCTGG - Intergenic
904564714 1:31421777-31421799 CCTGACTGCTGGTGCCTATGTGG + Intronic
904823457 1:33259381-33259403 CCTGCTTCCTCCTTTCCATGTGG - Intronic
905928016 1:41765800-41765822 CCTGTTTGATGGTTTTCATGGGG + Intronic
906943736 1:50277885-50277907 TGTGACTGCTGTTTTCCATGGGG - Intergenic
907300129 1:53481844-53481866 CCTGCCTGCTGGTCTCCTACTGG + Intergenic
907497034 1:54852074-54852096 CCTTCCTCCTGGCTTCCAGGGGG - Exonic
907645358 1:56236991-56237013 CCTAACTGCTGGTGCCCATGAGG - Intergenic
909189943 1:72539153-72539175 TCTGCCTGTTGATTTCCAGGTGG + Intergenic
910224644 1:84923971-84923993 TCTGCCTGCTGGTTTCATTCTGG - Intergenic
911205651 1:95089659-95089681 CCTGCATGCTCCTTCCCATGAGG - Intergenic
913127126 1:115802611-115802633 ACTGTCAGCTGCTTTCCATGTGG + Intergenic
917042535 1:170822034-170822056 TCTGCCTCTTGGTTTCCAAGAGG + Intergenic
917115113 1:171595139-171595161 CATGCCTGCTGGTTTGCAAGTGG - Intergenic
917525945 1:175788669-175788691 CCTGCCTGTTGGCTTTTATGTGG - Intergenic
918153092 1:181815482-181815504 CCTGCTTCCTGGTTTGCAGGTGG - Intergenic
922190731 1:223316445-223316467 CCTTCCTCCAGGTTCCCATGTGG - Intronic
923152713 1:231247987-231248009 CATGCCTGCTAGTTTCCCTTAGG + Intronic
923357271 1:233171510-233171532 ACTGTCTTCTGGCTTCCATGAGG + Intronic
923641861 1:235771162-235771184 CTTGTCTGCTGGTTTTCGTGTGG - Intronic
924243609 1:242061670-242061692 CCTGCCTGCCTGTTCCCATTTGG - Intergenic
924416523 1:243861620-243861642 TCTGCCCTCTTGTTTCCATGTGG + Intergenic
1062763609 10:45634-45656 CCTGCCTGCCTGTTCCCATTTGG + Intergenic
1063943070 10:11150633-11150655 TCTTCCTGCTGGTTGACATGGGG - Intronic
1064160081 10:12937865-12937887 ACTGCCTCCGAGTTTCCATGGGG - Intronic
1065682194 10:28248315-28248337 GCTGACAGCTGGCTTCCATGTGG - Intronic
1067281984 10:44879980-44880002 CATGCCTGCTGGGTTTCCTGGGG + Intergenic
1068156900 10:53211601-53211623 CCTCCATGCTGTTTTCCATAGGG + Intergenic
1068593662 10:58877393-58877415 CCTCCATACTGTTTTCCATGTGG + Intergenic
1068930604 10:62585265-62585287 CCTATCTCCTGGCTTCCATGAGG - Intronic
1069333563 10:67321960-67321982 CCTGGCTGATGGATTCAATGTGG - Intronic
1071016381 10:81001963-81001985 ATTGCTTGCAGGTTTCCATGAGG - Intergenic
1071219577 10:83448497-83448519 ACTGCCTTCTGGCTTCCATTAGG - Intergenic
1072253556 10:93600590-93600612 CCTGCCTGCTGATCGCCACGTGG - Intronic
1072681260 10:97508595-97508617 CCTACCAGCTTCTTTCCATGGGG - Intronic
1074453428 10:113577690-113577712 TCTGCCTGCTGATACCCATGTGG - Intronic
1075120343 10:119660015-119660037 CCTGCCTCACGGGTTCCATGTGG - Intronic
1075792241 10:125093281-125093303 CCTGCCTTCTGTTTTCCTTGTGG - Intronic
1075895966 10:125994742-125994764 CCTGCCTGTTGGCTTCGCTGTGG + Intronic
1076218201 10:128712552-128712574 GCTGCCTGCTGGTCCCCATATGG - Intergenic
1076853643 10:133104900-133104922 CCAGCCTGCTGGCCTCCCTGAGG - Intronic
1076930220 10:133527442-133527464 TCCTCCTGCTGGTGTCCATGTGG + Exonic
1077031067 11:467834-467856 CCTGCATGCAGGTTTTTATGTGG - Intronic
1077208881 11:1359015-1359037 CTTCCCTGCTGTTTTACATGGGG - Intergenic
1079142564 11:17822208-17822230 CCTGCCTGCTGGGTTCTTTCAGG - Intronic
1084303487 11:68266339-68266361 CCTGCCTCCTGTAATCCATGTGG + Intronic
1084674436 11:70625910-70625932 CTGGCCTGGTGGTTGCCATGGGG - Intronic
1085409980 11:76285125-76285147 CCTGCCTCCTGGTTTGCAGATGG - Intergenic
1089016841 11:115172386-115172408 CCAGCCTGCTGATTTGTATGGGG - Exonic
1089355044 11:117844010-117844032 GCTGGGTGCTGTTTTCCATGTGG + Intronic
1089631108 11:119784781-119784803 CCTGCCTGCTGGGATCCATCGGG - Intergenic
1091313527 11:134594325-134594347 CCTGCCTCCTGGTTTGCAGATGG - Intergenic
1092449231 12:8586325-8586347 CCACCCTGCTGTTTTCCATGTGG - Intergenic
1092524582 12:9301940-9301962 TCTGCCTGCTAGTTTCCACCGGG - Intergenic
1092764257 12:11838550-11838572 CCAGCCTGATGGTTTCCCAGAGG + Intronic
1096106620 12:48999779-48999801 CCACTCTGCTGGTTTCCATGGGG + Intergenic
1099001193 12:77179749-77179771 ACTGCCTCATGGTTTCCAAGAGG + Intergenic
1100588174 12:95998786-95998808 CCTGCTTGCTGGTTTACCTAGGG - Intergenic
1101912787 12:108873034-108873056 CTTGCCTGATCGTTTCCATAAGG - Intronic
1102429835 12:112874584-112874606 CCTTCCTGCTGTTTCCCATATGG - Intronic
1104570179 12:129918169-129918191 CTTGCGTGCTGATCTCCATGTGG + Intergenic
1104860830 12:131922557-131922579 CCTGCCTTCCGGATTCCAGGCGG + Exonic
1105039115 12:132947930-132947952 CCAGGCTGTTGGTTTCCAAGGGG - Intronic
1105070266 12:133230198-133230220 CCTGCCTGCTGGGTTCTGGGAGG - Intronic
1105826429 13:24127337-24127359 CCTCCCTGCTGGTGTCATTGTGG - Intronic
1106586663 13:31063113-31063135 CTTGCCTACAGGTTTCCATAAGG + Intergenic
1106790292 13:33148750-33148772 CCTACGTGCAGGTTTGCATGTGG - Intronic
1106910514 13:34458311-34458333 CATGACTGCTGGTTCCCATCAGG - Intergenic
1106968544 13:35105263-35105285 CTTGCCTACTGGTTTCCAGTTGG - Intronic
1108088966 13:46825600-46825622 TCTACCAGCTGGTTTCCATTTGG - Intergenic
1110072562 13:71195630-71195652 CATGGCTGCTGTTTTCCAAGAGG - Intergenic
1112371174 13:98794997-98795019 CCTGGCTGCTGGTTTACAGAGGG + Intronic
1112380891 13:98888835-98888857 CCTGTTTGCTGTTTTTCATGAGG - Intronic
1113388509 13:109873468-109873490 CCTGACTCCTGGTTTCCTGGGGG + Intergenic
1113818608 13:113194290-113194312 CCAGCCTCCTGGTTTCCTTGGGG + Intronic
1113834467 13:113319595-113319617 CCTGCCTGCTGGCCAGCATGGGG + Exonic
1115525879 14:34280139-34280161 CCTGACTTCGTGTTTCCATGTGG - Intronic
1116249799 14:42466189-42466211 CCTGCCCACTGGTTTCCAGATGG + Intergenic
1116632148 14:47349875-47349897 TTTGCCTGCTGCCTTCCATGTGG + Intronic
1117608322 14:57454952-57454974 CCTGCCTGCTTTCTTCCCTGGGG - Intergenic
1118455877 14:65945443-65945465 GCTGCCTCCTGGCTTCTATGTGG - Intergenic
1118794913 14:69133524-69133546 CCTGCCTACTGGTTTCGATTTGG - Intronic
1120964870 14:90158314-90158336 CCTCCCAGCTGGTGTCCATCAGG + Intronic
1121028171 14:90632101-90632123 CCTCCCTACTGGTATCCCTGGGG + Intronic
1122302626 14:100739555-100739577 CCTGCCTGCTGCTCTCAATGCGG + Intergenic
1122794384 14:104198682-104198704 GCTGCCTGCTGCTTTCCATTTGG + Intergenic
1122804557 14:104249985-104250007 GCTGCCTGCAGGTTTCAATGGGG + Intergenic
1122831266 14:104397535-104397557 GGTGCCTCCTGTTTTCCATGAGG - Intergenic
1123150618 14:106178054-106178076 CCTGCATGGAGGTTTCCATCTGG + Intergenic
1123202736 14:106681775-106681797 CCTGCATGGAGGTTTCCATCTGG + Intergenic
1123399034 15:19965798-19965820 CCTGCATGGAGGTTTCCATCTGG + Intergenic
1123952497 15:25295029-25295051 CCTCCATGCTGTTTTCCATAAGG - Intergenic
1125511356 15:40294054-40294076 CCTTCCCGTTGGTTTCCATGGGG + Intronic
1125815960 15:42584483-42584505 CCTGGCTGCTGACTTCCCTGTGG + Intronic
1125851599 15:42908791-42908813 CCTGTTTGCTGGTGTACATGGGG - Intronic
1126085356 15:45005971-45005993 GCTGCCTGATGGGTTGCATGGGG - Intergenic
1129316781 15:74750005-74750027 CCTGCCGGATGGTGTCCAGGCGG - Exonic
1132343309 15:101091553-101091575 CCTGGCTGCTGCTGGCCATGTGG - Intergenic
1132781778 16:1630581-1630603 CCTGCCTGCTCATTTGCAGGCGG + Intronic
1133172997 16:3993197-3993219 CCTGAGCGCTGGTTTCCACGTGG + Intronic
1133229319 16:4359227-4359249 CCTGCCCCCTGGTGGCCATGTGG - Intronic
1134051554 16:11141209-11141231 CCTGCCTGGTGCTGTCCATATGG - Intronic
1134216152 16:12318377-12318399 TCTACCTGCTGGTTCCCATCCGG - Intronic
1134302666 16:13005572-13005594 CTTGCTTACTGGTTCCCATGAGG + Intronic
1137252214 16:46748597-46748619 CCTGCCAGCTGGGCTCCAGGAGG + Intronic
1137361058 16:47815644-47815666 CCTCCATACTGTTTTCCATGGGG + Intergenic
1139563055 16:67755979-67756001 CCTGCCTGCTGGTTCAAATGTGG - Intronic
1141147670 16:81543057-81543079 CCTGCCCGCTGGAGCCCATGAGG + Intronic
1141156560 16:81601300-81601322 CCTGCCTGCTGGTTTCCATGGGG - Intronic
1141557523 16:84845856-84845878 CCAGTCTGCTGGTGTCCATCGGG + Exonic
1141777644 16:86134906-86134928 CTTGCCTGCTGGTTGCACTGGGG + Intergenic
1141903683 16:87008814-87008836 CATGGCTGCTGGGTTCCAAGAGG - Intergenic
1144092983 17:11874386-11874408 CCTGCCTGCTGGTGCCTGTGGGG - Intronic
1144147373 17:12411633-12411655 CCTTCCTTGTGGTTTCCATCGGG - Intergenic
1144965730 17:19076393-19076415 CCTGCCTTCTAATTTTCATGTGG - Intergenic
1144982237 17:19175789-19175811 CCTGCCTTCTAATTTTCATGTGG + Intergenic
1144985986 17:19202450-19202472 CCTGCCTTCTAATTTTCATGTGG - Intergenic
1145737827 17:27245458-27245480 CCTGCCTCCTGCTTTCCCTTGGG + Intergenic
1147918545 17:43902495-43902517 CCAGCCTGCTGGGCTCCCTGGGG - Intronic
1151217083 17:72584323-72584345 CCTCCCTGCTGCTTGCCCTGCGG - Intergenic
1151419300 17:73986883-73986905 CCCGCCTGGTCTTTTCCATGAGG - Intergenic
1152956518 18:45965-45987 CCTGCCTGCCTGTTCCCATTTGG + Intergenic
1154251964 18:12752076-12752098 CCTTCCTGCTGGCTGACATGAGG + Intergenic
1155223538 18:23707336-23707358 CTTGCCTGCTGGCTTCCAAGAGG + Intronic
1155502531 18:26501100-26501122 CCAGGCTGCTGGTGTACATGTGG + Exonic
1156609221 18:38706979-38707001 TCTGCCTGCTGTTTTCCATTTGG + Intergenic
1156788132 18:40939867-40939889 CCCGGCTGCTGCTTTCCAGGAGG - Intergenic
1156817240 18:41326081-41326103 CCTATCTGCTGATTTCCTTGGGG - Intergenic
1156907852 18:42376006-42376028 CCTCCATGCTGTTTTCCATAGGG + Intergenic
1157711542 18:49853162-49853184 CCTGGCTGCTGGCTTCCAAGAGG - Intronic
1159187180 18:64990126-64990148 CCTGCCTGCTTGTTTCCTCAAGG + Intergenic
1159583562 18:70261714-70261736 CTTGCCTGCTGGCGTCCATGTGG - Intergenic
1160021508 18:75185258-75185280 CCTGAGGGCTGGTTTCCAGGGGG + Intergenic
1160563474 18:79772825-79772847 CCTTCCTGCTGCTTTCCAGCTGG - Intergenic
1161067887 19:2247530-2247552 CCTGCCTGATGGTCGCCCTGAGG + Intronic
1163222876 19:15934571-15934593 CTTGGCTGCTGGTTTTCATTGGG - Exonic
1165158262 19:33801292-33801314 CCAGGCTGCTGGTGTACATGTGG - Exonic
1166095899 19:40538971-40538993 CCTGTCCTCTGGCTTCCATGTGG - Intronic
1166590722 19:43995939-43995961 CCTGATTTCTGGTTTGCATGAGG - Intronic
1167958489 19:53087152-53087174 CCTGCCTCAAGGCTTCCATGTGG - Intronic
1168162559 19:54521283-54521305 CCTGCCTGCTGCTTCTCCTGGGG - Intergenic
1168688522 19:58362865-58362887 CGCGCCTTCTGGTTCCCATGGGG + Intergenic
925370163 2:3339199-3339221 CCTACCTGCTGGTTCTCATTTGG - Intronic
926732922 2:16050728-16050750 TTTGTCTGCTGGTTTCCCTGAGG + Intergenic
927020507 2:19011934-19011956 CATTGCTGCTGGTTTCCCTGTGG + Intergenic
931099632 2:58982011-58982033 CTTGCCTTCTGGTTTCCAGTTGG + Intergenic
931207323 2:60160556-60160578 TAAGCCTGCTGGTTTCCAAGTGG - Intergenic
931212266 2:60208409-60208431 TCTTCCTGCTGGCTTCCATGGGG - Intergenic
931262979 2:60636610-60636632 CCTCCCTGGTGGTTTTCATTCGG - Intergenic
931918504 2:66986134-66986156 GCTGCCTGATGATTTGCATGTGG - Intergenic
932188785 2:69721117-69721139 CCTGGCTGCTGCTTCACATGTGG + Intronic
932631729 2:73350264-73350286 CATGCCTGTTGGTGTACATGTGG - Intergenic
933558846 2:83866469-83866491 CCTCACTACTGCTTTCCATGTGG - Intergenic
934687271 2:96330637-96330659 TCTGCCTTGTGGTTTCCAAGTGG + Intergenic
935897219 2:107750459-107750481 CTTGCCTTCTGGTTTCTAGGTGG - Intergenic
936084283 2:109455962-109455984 CCTGCATGATGGTTCCCACGTGG - Intronic
936835028 2:116699267-116699289 TCTGCCTCCTGGCTTCCAGGTGG - Intergenic
937258904 2:120573024-120573046 CCAGCCTGCTGCTTCCCACGGGG - Intergenic
937432222 2:121848585-121848607 TCTGGCTGCTGCTTTCCCTGGGG + Intergenic
937442395 2:121927749-121927771 CCTGCCTTCTGGTTTGCAGAAGG + Intergenic
937990482 2:127659417-127659439 GCTCCCTGCTGGTCTCCACGGGG + Intronic
939284793 2:140115014-140115036 CATGCCTCTTGCTTTCCATGTGG - Intergenic
939894673 2:147776934-147776956 CCTCCCTGCTGGCTTCTTTGTGG + Intergenic
940538237 2:154974487-154974509 TCTGCCTTCTGGTTTCTATTTGG + Intergenic
942786753 2:179709525-179709547 TCTGCCTGTTGATTTCCAGGTGG - Intronic
942849542 2:180467746-180467768 CTTTCCTACTGGTTTCAATGTGG - Intergenic
943186142 2:184609614-184609636 CCTGCTTCCTGGTTTGCATGTGG + Intronic
947385864 2:229589501-229589523 TATGCCTCCTGGTTTCCATCAGG + Intronic
948093621 2:235316111-235316133 CCTGCCTGCTGGCTTCCTGTTGG - Intergenic
948382347 2:237559574-237559596 CCTGCCGGCTCGTTTGCTTGTGG - Intergenic
948799884 2:240427899-240427921 CCTGCTTAGTGGTTTCCTTGTGG - Intergenic
948877826 2:240839603-240839625 CCTGCCTCCTCGTCTCCATCAGG + Intergenic
948881215 2:240858124-240858146 CCTGCCTGATGGTCACCAGGTGG - Intergenic
1171386184 20:24770737-24770759 CCTCCCTGATGGTGCCCATGGGG - Intergenic
1172592152 20:36125436-36125458 CCTGCCTCATGGTTTTCTTGGGG + Intronic
1172997039 20:39078544-39078566 CCTCCCTGCTGGGTTTCCTGTGG + Intergenic
1173270487 20:41529898-41529920 CCTGCCTCCATGTTTTCATGAGG + Intronic
1173317869 20:41961301-41961323 CCTTCCTTCTGGTTTCCAGATGG + Intergenic
1173460874 20:43242611-43242633 CCTGCCTGGTGCTCTCCAAGTGG - Intergenic
1173783873 20:45778140-45778162 CATGGCGGCTGGTTTCCAAGAGG - Intronic
1174017033 20:47497185-47497207 TCTGGCAGCTGGGTTCCATGAGG + Intergenic
1175326840 20:58135489-58135511 CCTCCCTGCTGGCTTACCTGAGG - Intergenic
1175664610 20:60847798-60847820 CCTGCCCGCTGCTTTCTCTGGGG + Intergenic
1175936248 20:62515462-62515484 CCCACCTGCGGGTTTCCAGGTGG - Intergenic
1175965143 20:62656604-62656626 GCTGCTTGCTGGTGTCCAGGGGG - Exonic
1177042647 21:16132740-16132762 CCTGCCTGCTGGCTCCCAGCAGG - Intergenic
1178704042 21:34858283-34858305 CCTGCATGGTGGTTTCTAGGTGG - Intronic
1178708992 21:34897634-34897656 CCTGGCTTCAGGTTTCCATGTGG + Intronic
1178711930 21:34924847-34924869 CCTGCTTCCTGGTTTGCATATGG + Intronic
1179225065 21:39445775-39445797 CCCGCGCGCGGGTTTCCATGGGG - Intronic
1180175186 21:46083836-46083858 CCTGCCTGCTCTGTTCCTTGAGG - Intergenic
1180214395 21:46315297-46315319 CCTGGGTGCAGGTTTCCATCAGG - Intronic
1180250333 21:46582019-46582041 CCTGCCTGCTGGTTCTGAAGAGG - Intergenic
1180802103 22:18636758-18636780 CCTTCCTGCTGGCGTCGATGCGG - Intergenic
1181219620 22:21358501-21358523 CCTTCCTGCTGGCGTCGATGCGG + Intergenic
1181484630 22:23222996-23223018 TCTTCCTGCTGTTTTTCATGTGG + Intronic
1181628851 22:24139960-24139982 ACTGCCTGCATGTCTCCATGCGG + Intronic
1182066931 22:27437693-27437715 CCTGCCTTCTGGTGTTGATGTGG - Intergenic
1182074939 22:27488927-27488949 CCTGGCTCCTGGCTTCCATCAGG - Intergenic
1183107576 22:35625837-35625859 CCTTCCTGCTGGTTGGAATGAGG - Intronic
1183298147 22:37044188-37044210 CCTGCCTGCTGAGGTCCTTGGGG - Intergenic
1183500090 22:38173592-38173614 CTTGCCTGCTGGGTTCATTGAGG + Intronic
1183579425 22:38714869-38714891 CCCGTCAGCTGCTTTCCATGAGG - Intronic
1183735260 22:39641478-39641500 CCTCCCTGCTGGGATCCATAGGG - Intronic
1183978143 22:41524985-41525007 CCTGCTTGCTGGTTGCTGTGTGG + Intronic
1184839150 22:47042496-47042518 ACAGCCTTCTGATTTCCATGCGG + Intronic
1185057616 22:48589132-48589154 CCTGCCCGCTGGTTGCCTTGGGG + Intronic
1185109753 22:48894349-48894371 CCTCCCTGTTCCTTTCCATGTGG + Intergenic
1185205746 22:49537065-49537087 CCTCAGTGCTGGTTTCCATGCGG + Intronic
1185310704 22:50152731-50152753 CCCGGCTGCTGGGTTCCAGGTGG + Intronic
950028899 3:9838996-9839018 CCTGCCTGCTGCTTTCTGAGGGG - Intronic
950512165 3:13437140-13437162 CTTTCCTGCTAGTTTCCAGGAGG - Intergenic
950855347 3:16099437-16099459 CCTGCCTGCTGGCTACCATGAGG - Intergenic
953815837 3:46155384-46155406 CCTGCCTTCTGGTTTCCCCATGG - Intergenic
953877944 3:46676979-46677001 CCTGCCAGCGGCTTTCCACGGGG + Exonic
954576355 3:51678446-51678468 CCTGCCTGCTTGCTTATATGGGG + Intronic
954754542 3:52832094-52832116 CCTACTTGCTGGACTCCATGGGG - Intronic
955486410 3:59438925-59438947 CCGGCCTGCTGGGTGCCAGGTGG + Intergenic
955851299 3:63223000-63223022 CCAGGCTGCTGTGTTCCATGGGG + Intergenic
956865352 3:73363709-73363731 CCTTCCTCCAGCTTTCCATGAGG - Intergenic
960940229 3:122928516-122928538 CCTGTCTGCTGGTGCACATGGGG + Exonic
961380833 3:126495719-126495741 GCTTCCTCCTGATTTCCATGTGG + Intronic
961749269 3:129085951-129085973 CCTGCCTCCTGGCTTCCCTGAGG + Intergenic
961756128 3:129128334-129128356 CCTGCCTCCTGGCTTCCCTGAGG - Intronic
962320885 3:134389386-134389408 CTTGCCGCCTGATTTCCATGAGG + Intergenic
963138490 3:141929117-141929139 CATGCTTGCTGTTTTCAATGTGG + Intergenic
963824160 3:149933050-149933072 AATCCTTGCTGGTTTCCATGTGG - Intronic
964607502 3:158572915-158572937 GGTGCCTGCTGCTTTCCATTTGG + Intronic
967490377 3:190083811-190083833 CCTCCCTGGTGGCTCCCATGGGG + Intronic
968357820 3:198122263-198122285 CCTGCCTGCCTGTTCCCATTTGG - Intergenic
968972984 4:3805760-3805782 CCCTCCTGCAGGTTTCCCTGCGG + Intergenic
969154835 4:5201337-5201359 CAGCCCTGCAGGTTTCCATGGGG + Intronic
970131460 4:12876169-12876191 CCTGCCTGGACGTTGCCATGGGG - Intergenic
970636082 4:18010891-18010913 CCTTGCTCCTGGTTTCTATGAGG + Intronic
971047750 4:22824536-22824558 CCTGCCTGCTCTCTTCCCTGAGG - Intergenic
971512920 4:27449215-27449237 TCAGCCTGCTGGAGTCCATGTGG + Intergenic
972074338 4:35065852-35065874 GCAACCTGCTGGTTTCCCTGAGG + Intergenic
972520878 4:39855141-39855163 CCTGGTTGCTGGGTCCCATGAGG - Intronic
977280367 4:95032197-95032219 CCTGCCTCCTGGTTTGCAGCTGG + Intronic
977282307 4:95056517-95056539 CTGGCCTGCTGGGTCCCATGAGG - Intronic
980652185 4:135732470-135732492 CTTGCCTCCTAGTTTCTATGGGG + Intergenic
980681742 4:136171449-136171471 CCAGCATGCTGTTCTCCATGGGG - Intergenic
982973127 4:162016413-162016435 CCTGCCAGCTGTTTTCCATAGGG - Intronic
983632857 4:169867142-169867164 GCTCCCTCCTGGTTTCCATGGGG - Intergenic
985379214 4:189374510-189374532 GCTGCCTGCTGGGTTCTTTGTGG + Intergenic
987289646 5:16496409-16496431 CCTTCCTGCTGGTGGCAATGTGG - Intronic
988967679 5:36436687-36436709 CCTGTCTGCTGGTGTTGATGGGG - Intergenic
990445003 5:55886173-55886195 CCTGCCTCCTGTTTTCCTGGAGG + Intronic
993852078 5:93023180-93023202 CCTTCCTGCTGCTCTCCATTGGG + Intergenic
994987901 5:106961497-106961519 CCTGCCTGATGTTGTCTATGGGG + Intergenic
996529466 5:124512435-124512457 CCTGCCAGCTGGCTTCCACTGGG - Intergenic
997839323 5:137224756-137224778 GCTGCCTGCGGGTCTCCCTGGGG - Intronic
998655899 5:144179358-144179380 GTTGCCTCCTGGTTCCCATGGGG - Intronic
1000110257 5:158101412-158101434 CATGCATGCTGGATACCATGGGG + Intergenic
1000588424 5:163128628-163128650 CCTGCTTGCTGATTTCCCTCAGG - Intergenic
1000976962 5:167775289-167775311 CCTGCTTACTGGTTTCAAGGTGG - Intronic
1001335976 5:170796970-170796992 TCTGCATCCTGGTTCCCATGAGG + Intronic
1001924582 5:175627008-175627030 CCTGCCTGCAGATGTCCTTGGGG - Intergenic
1002473304 5:179450329-179450351 TCTGACTGCTGGTTTGCATAGGG + Intergenic
1002480922 5:179500324-179500346 TCTGACTGCTGGTTTGCATAGGG - Intergenic
1003348102 6:5289783-5289805 CCTCCCTGCTCTTCTCCATGTGG - Intronic
1006863210 6:37187403-37187425 CCTGCCTTCTGGCTTCCAGTTGG - Intergenic
1007182203 6:39937487-39937509 CCTGACCTCTGGTTTCCAGGTGG + Intergenic
1009734750 6:67662592-67662614 CTGGCATGCTGGCTTCCATGTGG + Intergenic
1010167907 6:72939220-72939242 CCTGCCAGCTAGTGTCCCTGAGG - Intronic
1010902351 6:81442707-81442729 CCTGCCTTCAGGATTCCAGGTGG + Intergenic
1013499909 6:110738897-110738919 CCTGCCTGCTGGGCACTATGTGG + Intronic
1014549161 6:122769016-122769038 CCTGTCTGGTGGTTTCTCTGTGG + Intergenic
1017499207 6:155007669-155007691 CCTGCCTGTTGGTATCCCTCAGG - Intronic
1019180239 6:170182285-170182307 CCTGCCTGCAGGTGTACGTGTGG - Intergenic
1019287655 7:231634-231656 GCTGCCTGCCTGTTTCCAGGAGG + Intronic
1019300848 7:302704-302726 CCTGCCTGCTGGTTAGGGTGGGG + Intergenic
1019345497 7:527997-528019 GCTGCCTGCTGGTTTGAATGTGG - Intergenic
1019656384 7:2198299-2198321 CCGGCCTGGAGGCTTCCATGGGG - Intronic
1021846031 7:24763462-24763484 CCTGCCTGCTGGTCACTTTGTGG - Intergenic
1021974344 7:25997223-25997245 CTTGCTTGCTGGCTTCCATTTGG - Intergenic
1022391467 7:29947898-29947920 CCTGCTTGCTGGTTTGCAGACGG - Intronic
1022981068 7:35605464-35605486 CCTTCTTCCTGGTTTCCATATGG - Intergenic
1023075944 7:36482996-36483018 CCTGGCTGCTGGTAGCCAGGTGG - Intergenic
1023998192 7:45174805-45174827 CCTGCCATCTGGGTTCCAGGGGG - Intronic
1024522699 7:50319957-50319979 CCTGCTTGGTGGTTTCCCTGGGG + Intronic
1025937754 7:66050838-66050860 TCTGGCTGCTGGAGTCCATGGGG + Intergenic
1027875630 7:83764168-83764190 CCTGCCTGCTGGTGCCCAGAAGG + Intergenic
1029267603 7:99354545-99354567 CCTGCCTGCAGTTTTCATTGAGG - Intronic
1029658926 7:101946063-101946085 CCTGACTGCTGGTTTCCTCTGGG - Intronic
1033771371 7:144556300-144556322 CCTGCTTGCTGGTTTACAGATGG + Intronic
1034100494 7:148446063-148446085 CCTGGCTGCTGGACCCCATGCGG + Intergenic
1034309844 7:150077722-150077744 ACTGCCAACTGGTTTGCATGTGG - Intergenic
1034494326 7:151410670-151410692 CCCGGCGGCTGGTTTCCATTAGG + Intronic
1034797009 7:154022898-154022920 ACTGCCAACTGGTTTGCATGTGG + Intronic
1035041371 7:155930356-155930378 GCTGGCTGTTGGTTTCCATCAGG + Intergenic
1035351597 7:158251228-158251250 CCTGCCTGCTGAGGTCCCTGGGG + Intronic
1035380419 7:158436243-158436265 CTTGTTTCCTGGTTTCCATGTGG + Intronic
1036740254 8:11354763-11354785 CCTGCCTGGTGGCTTCTGTGGGG - Intergenic
1038181237 8:25230183-25230205 CTTCTCTGCTGGTTTGCATGAGG + Intronic
1040008451 8:42640819-42640841 CCTGCCCTCTGGTTTCCAGCTGG - Intergenic
1041231830 8:55760099-55760121 CCTGCCTGCTGTTCTCTATATGG + Intronic
1042081638 8:65060313-65060335 CCTGCCTGCTGCCTCCCATGAGG + Intergenic
1043947780 8:86274010-86274032 GCTGCCTTCTGGTTCCCATTAGG + Intronic
1047717955 8:127613157-127613179 CCTGAGTGCTTATTTCCATGGGG - Intergenic
1048934203 8:139341820-139341842 ACTGCCTCCTGGCTTCCAGGTGG - Intergenic
1049163288 8:141111340-141111362 CCAGCATCCTGGTTTCCCTGGGG - Intergenic
1049281949 8:141753898-141753920 CCTGCCTGCAGCTTCCCACGGGG + Intergenic
1049369570 8:142257434-142257456 CCTGCCTGGGGGTCTCCAGGAGG - Intronic
1050057906 9:1674824-1674846 CCTGCCTTCAGGTTTCTATCTGG + Intergenic
1051559287 9:18422435-18422457 CCTCCCTGTGGGTTTTCATGTGG + Intergenic
1051590857 9:18776014-18776036 CCTGCCTGCAGCCCTCCATGGGG - Intronic
1052855655 9:33404700-33404722 TCTGCCTGCTGGATGCCCTGGGG - Intergenic
1054895318 9:70303490-70303512 CCTGGATGATGGTTTTCATGTGG + Intronic
1055260825 9:74431399-74431421 CCTGCCAGCTGGTTTGAAAGGGG - Intergenic
1056581962 9:87895150-87895172 CTTGCCTGATGGTGTCCATGGGG - Intergenic
1056617496 9:88180786-88180808 CCAGGCTGCTGGTGTACATGTGG - Intergenic
1057645577 9:96872029-96872051 CCTGCCTCCAGGTTAACATGCGG - Intronic
1058438041 9:104981971-104981993 CCTTCCTGTTGGTTGCAATGGGG - Intergenic
1060410780 9:123398773-123398795 GCTGTGTGGTGGTTTCCATGGGG - Intronic
1060791129 9:126486471-126486493 CATACCTGCTGTTTACCATGGGG + Intronic
1060803976 9:126563511-126563533 TCTGCATCCTGGTTTCCTTGTGG - Intergenic
1060893508 9:127202986-127203008 CTTCCCTGTTGGTTTCCAAGGGG - Intronic
1061083666 9:128386846-128386868 CCTGTCTGCTGGCTTCCCAGAGG + Intronic
1061587688 9:131579271-131579293 CCTGCCTGCTGGCTGCCCTGAGG + Exonic
1062647298 9:137555193-137555215 TCTCCCTCCTGGTTTCCTTGTGG + Exonic
1062741661 9:138178743-138178765 CCTGCCTGCCTGTTCCCATTTGG - Intergenic
1186901256 X:14059290-14059312 GTTGGCTGCTGGTTTCCATCAGG + Intergenic
1187559144 X:20383631-20383653 TGTGCCTTCTGTTTTCCATGAGG - Intergenic
1190894391 X:54602448-54602470 CCTGCCTGCTGGTATCATGGAGG + Intergenic
1191712933 X:64171783-64171805 CCTGTCTGGTGGTTTCCTGGAGG + Intergenic
1193162324 X:78241461-78241483 CCTGACTGCTGGTAGCCAGGTGG + Intergenic
1193736207 X:85159773-85159795 CCAGTTTGCTGGCTTCCATGTGG - Intergenic
1194190064 X:90824596-90824618 CCTGCCTGCTTTCTCCCATGGGG - Intergenic
1194610365 X:96035800-96035822 GTTGGCTGCTGGTTTCCATCAGG - Intergenic
1196907079 X:120447868-120447890 CTTGTCTGCTGGCTACCATGGGG - Exonic
1197742481 X:129905922-129905944 CCTGGCCCCTGGTTTCCACGTGG - Intergenic
1197884026 X:131199284-131199306 CCTGCCAGCTAGCTTCCAAGTGG - Intergenic
1200536663 Y:4406715-4406737 CCTGCCTGCTTTCTCCCATGGGG - Intergenic
1201489454 Y:14524809-14524831 TCTGCCTGCGGTTTTCCAGGAGG + Intronic