ID: 1141156560

View in Genome Browser
Species Human (GRCh38)
Location 16:81601300-81601322
Sequence CCTGCCTGCTGGTTTCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 309}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141156560_1141156569 -9 Left 1141156560 16:81601300-81601322 CCCCATGGAAACCAGCAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 309
Right 1141156569 16:81601314-81601336 GCAGGCAGGTTTGGGCAGGAGGG 0: 1
1: 1
2: 3
3: 56
4: 535
1141156560_1141156574 20 Left 1141156560 16:81601300-81601322 CCCCATGGAAACCAGCAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 309
Right 1141156574 16:81601343-81601365 CTCACCACAAAGGCAAGGGAAGG No data
1141156560_1141156570 -3 Left 1141156560 16:81601300-81601322 CCCCATGGAAACCAGCAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 309
Right 1141156570 16:81601320-81601342 AGGTTTGGGCAGGAGGGAGCTGG 0: 1
1: 0
2: 6
3: 106
4: 729
1141156560_1141156571 10 Left 1141156560 16:81601300-81601322 CCCCATGGAAACCAGCAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 309
Right 1141156571 16:81601333-81601355 AGGGAGCTGGCTCACCACAAAGG 0: 1
1: 0
2: 1
3: 16
4: 164
1141156560_1141156573 16 Left 1141156560 16:81601300-81601322 CCCCATGGAAACCAGCAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 309
Right 1141156573 16:81601339-81601361 CTGGCTCACCACAAAGGCAAGGG 0: 1
1: 0
2: 1
3: 14
4: 170
1141156560_1141156568 -10 Left 1141156560 16:81601300-81601322 CCCCATGGAAACCAGCAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 309
Right 1141156568 16:81601313-81601335 AGCAGGCAGGTTTGGGCAGGAGG 0: 1
1: 1
2: 10
3: 88
4: 636
1141156560_1141156576 26 Left 1141156560 16:81601300-81601322 CCCCATGGAAACCAGCAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 309
Right 1141156576 16:81601349-81601371 ACAAAGGCAAGGGAAGGCGAAGG 0: 1
1: 0
2: 3
3: 80
4: 739
1141156560_1141156572 15 Left 1141156560 16:81601300-81601322 CCCCATGGAAACCAGCAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 309
Right 1141156572 16:81601338-81601360 GCTGGCTCACCACAAAGGCAAGG 0: 1
1: 0
2: 0
3: 12
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141156560 Original CRISPR CCTGCCTGCTGGTTTCCATG GGG (reversed) Intronic