ID: 1141157447

View in Genome Browser
Species Human (GRCh38)
Location 16:81607082-81607104
Sequence TTGAAGAATGTTGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 1, 1: 0, 2: 3, 3: 70, 4: 539}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141157442_1141157447 -10 Left 1141157442 16:81607069-81607091 CCATTGGGAGCCATTGAAGAATG 0: 1
1: 0
2: 1
3: 13
4: 167
Right 1141157447 16:81607082-81607104 TTGAAGAATGTTGAGGAGGAGGG 0: 1
1: 0
2: 3
3: 70
4: 539
1141157441_1141157447 -5 Left 1141157441 16:81607064-81607086 CCGGGCCATTGGGAGCCATTGAA No data
Right 1141157447 16:81607082-81607104 TTGAAGAATGTTGAGGAGGAGGG 0: 1
1: 0
2: 3
3: 70
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141157447 Original CRISPR TTGAAGAATGTTGAGGAGGA GGG Intronic
900459201 1:2792742-2792764 ATGAAGAATCTTGAAAAGGAGGG - Intronic
900748827 1:4380562-4380584 TCTAAGAAGGTTGGGGAGGAGGG + Intergenic
901001561 1:6151432-6151454 TTGAAGGATGTTTAGGAGTTTGG - Intronic
901069993 1:6512293-6512315 TTGAACAGTGCTGAGCAGGAAGG - Intronic
901236446 1:7669964-7669986 CTGCAGAAAGTGGAGGAGGAGGG - Intronic
901412619 1:9095014-9095036 TTAAAGTATGTTAAGGAGGTGGG - Intergenic
901518781 1:9767664-9767686 TCGCACCATGTTGAGGAGGAGGG - Intronic
902365728 1:15972749-15972771 TTCCAGAATGTTAAGGAGCAAGG + Intronic
902460448 1:16571511-16571533 TTTAAGAATGTTGAAGATGCTGG - Intronic
904016880 1:27428521-27428543 TTGAAGCAGGTGGAGGGGGAGGG + Intronic
904262526 1:29297910-29297932 TTGACTGATGGTGAGGAGGAAGG + Intronic
905839931 1:41167403-41167425 TTCCAGAAAGTTGAAGAGGAGGG - Intronic
906542922 1:46602034-46602056 TTGAAAGATGAGGAGGAGGAGGG + Intronic
907267253 1:53270354-53270376 TAGCTGCATGTTGAGGAGGAGGG + Intronic
907607664 1:55834598-55834620 TTGAGGAATGGTGAAGAGGCAGG + Intergenic
907758756 1:57337356-57337378 TTGAAGGATGGTGAAGAGGCAGG - Intronic
908007652 1:59743226-59743248 GTAAAGAAAGTTGATGAGGAAGG - Intronic
908620963 1:65979022-65979044 TTGAAGAAAGATGAAGATGATGG - Intronic
909066548 1:70941914-70941936 TTGAGGATTTTTAAGGAGGACGG - Intronic
909487999 1:76195755-76195777 TGGAGGAATGTTGGGGAGTAGGG - Intronic
910210865 1:84791473-84791495 TTGAAAAATGTTAAAGAAGACGG + Intergenic
910335896 1:86131152-86131174 TTGAAGAATGTTGATAACTACGG - Intronic
910692659 1:89980859-89980881 TTGTAGGATATGGAGGAGGAAGG + Intergenic
911251263 1:95579133-95579155 TTGAAGGATTTTAAGAAGGAAGG + Intergenic
911529522 1:99028139-99028161 GTGAAGAATCTTGAGAAGGAAGG - Intergenic
911922279 1:103780419-103780441 CTGATGAATGTTGAGGAAGAAGG + Intergenic
912467498 1:109883985-109884007 TGGCTGAATGTGGAGGAGGAGGG - Intergenic
912599258 1:110911459-110911481 CTCAAAAATATTGAGGAGGAGGG + Intergenic
913026922 1:114853485-114853507 TTGAAGAATTTTGAGCAGAAAGG - Intergenic
913033698 1:114938632-114938654 TTCCAGAATATTGAAGAGGAGGG - Intronic
913069678 1:115287234-115287256 TTCAAAACTGTTGAGCAGGACGG - Intronic
913431058 1:118790910-118790932 TTTAAGAATGTTGAGGGGCCAGG - Intergenic
913604964 1:120457068-120457090 TTTAAGAATGTTGAAGATGCTGG + Intergenic
913641830 1:120819784-120819806 TTTAAGAATGTTGAAGATGCTGG + Intronic
914189595 1:145397421-145397443 TTTAAGAATGTTGAAGATGCTGG - Intronic
914586606 1:149067963-149067985 TTTAAGAATGTTGAAGATGCTGG - Intronic
914890102 1:151613817-151613839 CTGAAGACTGCTGAGGAGAACGG - Intronic
915005608 1:152632506-152632528 TTCCAAAATATTGAGGAGGAGGG + Intergenic
915220929 1:154373823-154373845 TTGAAAAATGTTTATGAGGCCGG - Intergenic
915607281 1:156960583-156960605 TTGGAGAGTGATGAGAAGGATGG - Intronic
915608449 1:156970403-156970425 TTGGAGATCTTTGAGGAGGATGG + Intronic
915803823 1:158823243-158823265 TTCAAAAAAATTGAGGAGGAAGG - Intergenic
916125517 1:161566910-161566932 TTGAAGAATTTTGAGTAGGGTGG + Intergenic
916135399 1:161648303-161648325 TTGAAGAATTTTGAGTAGGGTGG + Intronic
916661881 1:166929822-166929844 TTGGAGAATTTTGATCAGGAAGG + Intronic
918104098 1:181401553-181401575 TTGAAGATTGTTGAGGAGATTGG + Intergenic
918447166 1:184627325-184627347 TAGAAAAATGTTTAGGAGAAAGG + Exonic
918650530 1:186956885-186956907 ATTAATAATATTGAGGAGGACGG + Intronic
918678432 1:187320275-187320297 TTAAAGAAATTTGAGAAGGATGG - Intergenic
918746977 1:188215051-188215073 TTCCAAAATATTGAGGAGGAAGG - Intergenic
918870927 1:189973547-189973569 GTGAAAAATGTTCAGGAGGCAGG + Intergenic
919568143 1:199215127-199215149 TTCCAAAATATTGAGGAGGAGGG - Intergenic
919575707 1:199306634-199306656 GAGAAGAATGCTGAGAAGGATGG + Intergenic
919768725 1:201143710-201143732 TTGAAGCATTTTGGGGAGGTGGG + Intronic
919964217 1:202505110-202505132 CTGAAGAATTTTGAGGAATAAGG + Intronic
920352911 1:205349524-205349546 TTGCACAATGTAGAGAAGGAAGG + Intronic
922322313 1:224499540-224499562 TTGAAAACTGTTGAGGAGGGAGG - Intronic
923826882 1:237510058-237510080 TTGAAAAATGCTTAGCAGGAAGG + Intronic
923898742 1:238302746-238302768 TTCAAGAATGTTGACAAGGGAGG + Intergenic
924658788 1:245997425-245997447 CAGAAGCATGTTGAGGAGGAAGG - Intronic
1063044164 10:2374933-2374955 AGGAAGAGTGTTGGGGAGGAAGG - Intergenic
1063636269 10:7786110-7786132 TTGCAGGATGTTGATGATGAGGG + Intronic
1065668124 10:28084810-28084832 TTGAAAAATTTTAAGGAGCAGGG + Intronic
1065746563 10:28847807-28847829 TGGAAGAATGTTCTGGTGGACGG + Intronic
1066263337 10:33750481-33750503 TTGAAGCATGATGAGGAAAAGGG + Intergenic
1066549632 10:36542323-36542345 TTGAAGATTTTTAAGGAGGAGGG + Intergenic
1066566386 10:36725824-36725846 TTTAGGAATGATGAGGAGGCTGG - Intergenic
1067265499 10:44738915-44738937 TTCAAAAAAGTTGAAGAGGAGGG + Intergenic
1067571322 10:47373227-47373249 TTTAAGAATGTTGCCGAGGAAGG - Intronic
1068052195 10:51964219-51964241 ATTAAGAATCTTGAGGTGGAGGG - Intronic
1068511789 10:57975425-57975447 TTCCAGAAAATTGAGGAGGAGGG + Intergenic
1068544573 10:58331424-58331446 TTGGAAAATGCTGGGGAGGAAGG - Intergenic
1069297020 10:66859129-66859151 TTGAAGTATGCTGAGGAATATGG + Intronic
1069767525 10:70874237-70874259 TTTAAGTATATTGAGGGGGAAGG + Intronic
1071357826 10:84816156-84816178 TTTCAAAATATTGAGGAGGAAGG - Intergenic
1071466131 10:85941283-85941305 TTGAAGAATGTTTAATAGCATGG + Intronic
1072172624 10:92880770-92880792 TTGAAGCATATGGAGGGGGAAGG + Intronic
1073313782 10:102563720-102563742 TGAAAGCATGTTAAGGAGGAAGG + Intronic
1074024717 10:109622465-109622487 TTGAAGAATGGTGAGCTGGAGGG + Intergenic
1074602651 10:114931085-114931107 TTGAAGGATTTGGAGGAGGCAGG + Intergenic
1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG + Intronic
1075312004 10:121422097-121422119 TGGAAAAATGTTGAAGAAGATGG - Intergenic
1076349138 10:129802901-129802923 TTGAATGCTGTTGAGGATGATGG - Intergenic
1076483195 10:130798264-130798286 TTAAAGAAAGTTGAGAAGGAGGG - Intergenic
1076619199 10:131776092-131776114 CTGGAGAGAGTTGAGGAGGAAGG - Intergenic
1077166618 11:1143672-1143694 TTCCAGAATGTAGAAGAGGAGGG + Intergenic
1077763094 11:5125057-5125079 TTCCAAAAAGTTGAGGAGGAGGG + Intergenic
1077834346 11:5911399-5911421 TTGAAGAATTTGGAGAAGCAAGG - Intronic
1077840325 11:5967646-5967668 GTGCAGGATGTTGAGCAGGATGG + Exonic
1077840847 11:5972959-5972981 TAAGAGAATGTTTAGGAGGATGG - Intergenic
1077843701 11:6002144-6002166 GTGCAGGATGTTGAGCAGGATGG + Exonic
1077972824 11:7213097-7213119 CTGAGGAATGGTAAGGAGGATGG + Intergenic
1078244097 11:9557709-9557731 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1078862386 11:15261736-15261758 TTGAAGAATATTGAGAAAGATGG + Intergenic
1079755515 11:24254796-24254818 TGGAAGAATGTTTCTGAGGATGG - Intergenic
1080081733 11:28227760-28227782 GTGAAGAATGAGTAGGAGGAGGG + Intronic
1080611672 11:33909660-33909682 TTAAAGAATGTTGAGCACAAAGG + Intergenic
1081514962 11:43819626-43819648 ATGAAGAATGAAGAAGAGGAAGG - Intronic
1082586372 11:54946734-54946756 TAGGAGAATGTTGAGGACTATGG - Intergenic
1082878920 11:58018863-58018885 TTGGTTAATTTTGAGGAGGAGGG + Intergenic
1083175098 11:60944717-60944739 ATGTTGACTGTTGAGGAGGATGG - Intronic
1083688915 11:64394714-64394736 GTGAAGAAATGTGAGGAGGAGGG + Intergenic
1084449604 11:69228223-69228245 TGGAATAATGATGATGAGGATGG + Intergenic
1084701645 11:70790151-70790173 GTGTAGAATTCTGAGGAGGAAGG + Intronic
1084967673 11:72752829-72752851 TTGAAGAATGTGGTGGAGGAAGG - Intronic
1086523160 11:87695046-87695068 TTCCAAAATATTGAGGAGGAGGG - Intergenic
1086853025 11:91833526-91833548 TGGAAGAAGGGAGAGGAGGAGGG + Intergenic
1087569850 11:99912118-99912140 CTGAAGAATGTCAAGAAGGAAGG + Intronic
1088508085 11:110545878-110545900 TTGCAACAAGTTGAGGAGGAGGG + Intergenic
1088676489 11:112198690-112198712 TGAAAGAATGTTGATGAGAAAGG + Intronic
1090980601 11:131718243-131718265 TTCAAGAAAATTGAAGAGGAAGG - Intronic
1091074716 11:132604558-132604580 TGGTAGAATGTTCAGGAGGAAGG - Intronic
1091468101 12:703207-703229 TTGAAAAATGCGTAGGAGGAAGG + Intergenic
1091835219 12:3581033-3581055 TTGAGGGATGTGGTGGAGGAAGG + Intronic
1092442101 12:8513840-8513862 TTAAAGATTGTTGATGATGACGG + Intronic
1092459930 12:8677426-8677448 TTGAACAATATTAAGGAGGTAGG - Intergenic
1092656670 12:10692357-10692379 GTGAAAAATGTTGAGAAGCATGG - Intergenic
1092662193 12:10750495-10750517 TTGAAAATTGGGGAGGAGGAAGG - Intergenic
1092846509 12:12589766-12589788 TGGAAGGAAGTTTAGGAGGAAGG + Intergenic
1093833970 12:23802943-23802965 TTGGAGAATGTTGGGGAAGAGGG - Intronic
1095338972 12:41065552-41065574 CTGAAGAATTCTGAGGAGGGTGG + Intronic
1095364449 12:41385771-41385793 TTCCAAAAAGTTGAGGAGGAAGG + Intronic
1095804258 12:46301112-46301134 CTGAAAAATGCTGAAGAGGAAGG - Intergenic
1096124939 12:49112298-49112320 TTTAAGAATTTAGAGGAGGTCGG - Intergenic
1096526177 12:52211709-52211731 TTGAAGAGTTTTAAGCAGGAAGG + Intergenic
1097512099 12:60556316-60556338 TTGAAAAAAGTTGAGTAGGCCGG - Intergenic
1098032516 12:66269022-66269044 ATGAAGAAGGTAGAGGGGGAAGG - Intergenic
1098145470 12:67493266-67493288 TTTTAAAAAGTTGAGGAGGATGG + Intergenic
1098377415 12:69831958-69831980 TTGAAGAATAAAGAGGAGGCTGG + Intronic
1098659038 12:73069759-73069781 TTCCAAAATGTTGAGGGGGAGGG - Intergenic
1098743352 12:74202718-74202740 TTCCAGAATATTGAAGAGGAGGG - Intergenic
1099032343 12:77542530-77542552 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1099313315 12:81054610-81054632 TTGAAGAAGGTAGGAGAGGAAGG - Intronic
1099439055 12:82679279-82679301 TTTAAGAATATTGATGAGAAGGG + Intergenic
1099631798 12:85157957-85157979 CTAAAGAATGTTAAGGGGGAGGG + Intronic
1099706465 12:86159559-86159581 TTCCAAAAAGTTGAGGAGGAGGG - Intronic
1099885130 12:88519865-88519887 TTTTAGAATGCTGAGGAGGGAGG - Intronic
1100112796 12:91265800-91265822 TTGAAGAATTTTGAAGAAGAGGG + Intergenic
1100152701 12:91759990-91760012 TGGAAGAATTTTGAGGGGTATGG + Intergenic
1100282279 12:93129104-93129126 TTGAAAAATGTGAAGCAGGAAGG + Intergenic
1100531598 12:95466551-95466573 CTAAAGAGTGTTGAGGAGGCTGG - Intergenic
1100902810 12:99262083-99262105 TTGAAGAAGGTGTTGGAGGAGGG - Intronic
1101022470 12:100567174-100567196 TGGAAGAATTTTTAGGAGGAAGG + Intergenic
1101997367 12:109534666-109534688 TTGAAGCAGGTGGAGGAGGTGGG - Exonic
1102942876 12:116959469-116959491 TTTAAGAATGCTGAGAAGTAAGG - Intronic
1102954191 12:117048814-117048836 CTGAGGAATGTTTAGGATGAAGG + Intronic
1102962325 12:117100664-117100686 ATGATAAATGTTGGGGAGGAAGG + Intergenic
1103302329 12:119937629-119937651 TAGGAAAGTGTTGAGGAGGAGGG + Intergenic
1104232123 12:126895639-126895661 TTGAAGAAAGTAAAGAAGGAAGG - Intergenic
1104265160 12:127225336-127225358 TTGTTGAATGTTGAGGAGTGTGG - Intergenic
1105211400 13:18259145-18259167 TTTGAGGATGTTGAGGATGAGGG + Intergenic
1106670091 13:31896140-31896162 TTGAAGAATGGGCAGGAGAAAGG + Intergenic
1106699296 13:32211745-32211767 TTCAAGGAATTTGAGGAGGATGG - Intronic
1107104039 13:36624686-36624708 TTGCAGAATGTTCCGGATGATGG + Intergenic
1107310948 13:39077035-39077057 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1107431437 13:40344162-40344184 TTGAAGATATTTGAGCAGGATGG + Intergenic
1107725118 13:43291539-43291561 TTCATGAATGTCTAGGAGGAAGG - Intronic
1108097516 13:46919296-46919318 TTTAAAAAAATTGAGGAGGAGGG - Intergenic
1108305443 13:49127557-49127579 GTGAAGCATGTCAAGGAGGAAGG - Intronic
1109018428 13:57051541-57051563 TTCAAAAATATTTAGGAGGAGGG + Intergenic
1109235980 13:59820924-59820946 TTGAAAAATGTTGAGTTGGGTGG - Intronic
1109374994 13:61480938-61480960 TTTCAAAAAGTTGAGGAGGAGGG - Intergenic
1109440565 13:62366795-62366817 TTTTAGAGTGATGAGGAGGAAGG - Intergenic
1109695782 13:65955333-65955355 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1111099756 13:83568347-83568369 TTGAAGAATGTAGAGAAGAATGG - Intergenic
1111161584 13:84401519-84401541 TTGAAGAATATAGAGATGGATGG + Intergenic
1111914435 13:94346280-94346302 TTGCAGACTGTTGAGGATGGGGG + Intronic
1112209204 13:97358111-97358133 TTGGTGAAAGTTGAGAAGGATGG - Intronic
1112320441 13:98402204-98402226 TTGCAGAATGTTGAGGAGTGAGG + Intronic
1113021709 13:105894846-105894868 TGGAAGAATGAAAAGGAGGAAGG - Intergenic
1114368366 14:22055703-22055725 TTCCAAAATATTGAGGAGGACGG + Intergenic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115490630 14:33954509-33954531 TTCAAGCATGTGGAGGAGTAGGG + Intronic
1116385645 14:44326504-44326526 TTGAAGAATGTTTGGGAGTAAGG + Intergenic
1116575700 14:46572436-46572458 TAGAAGAATTTTCAGGTGGAAGG + Intergenic
1116802140 14:49454142-49454164 GTGAAGATGGGTGAGGAGGAAGG - Intergenic
1117080663 14:52149011-52149033 TTCCCAAATGTTGAGGAGGAGGG - Intergenic
1118451074 14:65902649-65902671 ATGAAAAATATTGAAGAGGATGG + Intergenic
1118522970 14:66607536-66607558 TTCAAAAAAATTGAGGAGGAGGG - Intronic
1119329503 14:73783546-73783568 TTGAAGGTTGCTGAGCAGGAAGG + Intronic
1120300715 14:82702899-82702921 TTACAGAAAATTGAGGAGGAGGG - Intergenic
1120960371 14:90119249-90119271 TTCCAAAATATTGAGGAGGAAGG + Intronic
1123131413 14:105988580-105988602 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123581646 15:21719777-21719799 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123618295 15:22162400-22162422 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123699259 15:22902577-22902599 TTTAAAAATGTTGAGGAAAATGG + Intronic
1124205604 15:27716978-27717000 TTCAAGAAAGTAGAAGAGGAGGG - Intergenic
1124574294 15:30894491-30894513 TTTAGGAATGATGAGGAGGCTGG + Intergenic
1124781702 15:32642255-32642277 TAGAAGAATGATTAGAAGGAGGG + Intronic
1126395390 15:48210011-48210033 ATGAAGAATTTTGAGAAGGGAGG + Intronic
1128207796 15:65868665-65868687 TTGATGAATCTTGATGAGGAGGG + Intronic
1128830029 15:70760246-70760268 TAGAAGAAAGTTGGGGAGGGGGG + Intronic
1129564925 15:76611534-76611556 TTGCAAAAAATTGAGGAGGAGGG + Intronic
1130636308 15:85623921-85623943 TTGAAGGATGCTGAGGAAAATGG - Intronic
1131386818 15:92014852-92014874 TTGAGGGAGGTGGAGGAGGAGGG + Intronic
1131589854 15:93736971-93736993 TTCCAGAAGATTGAGGAGGAGGG - Intergenic
1132149968 15:99452336-99452358 TTGAGGGATGATGAGGAAGAAGG + Intergenic
1133661961 16:7927153-7927175 TTGAAGAATGTGTAGGAGCTTGG + Intergenic
1134024951 16:10946391-10946413 TTGAAGAGTGGGGAGCAGGAGGG + Intronic
1134800465 16:17079574-17079596 TTGGAGAAAGTTGAGGAGAGAGG - Intergenic
1134824777 16:17275729-17275751 TCGGAGAATGTTGGGGAGGAAGG - Intronic
1135198436 16:20414735-20414757 TGGAAGAATTTTGAGGAGCACGG + Intronic
1135376452 16:21951608-21951630 TTGAAGAATTTTAAGCAGGCAGG + Intergenic
1135469512 16:22717008-22717030 ATTAAGGAGGTTGAGGAGGAAGG + Intergenic
1135597859 16:23756925-23756947 GTGGAGAATGGTGTGGAGGATGG + Intronic
1135866235 16:26105016-26105038 TTGAAGAAGGATAAGGAGGTGGG - Intronic
1136236860 16:28919726-28919748 TGGAAGAATGTTGAGGACTGTGG - Intronic
1137458116 16:48633809-48633831 CTGAGGAATGTTGTGGGGGATGG + Intergenic
1137701500 16:50501199-50501221 GAGAAGAAAGTTGAGGAGGAAGG + Intergenic
1137869775 16:51938804-51938826 TTCTAGAATGGTGAGGTGGAGGG - Intergenic
1137961559 16:52886721-52886743 AGGAAGAATGTGGAGGAAGAAGG - Intergenic
1138014419 16:53415759-53415781 TTCAGGAATGATGAGGAGGCTGG - Intergenic
1139769382 16:69261285-69261307 TAGAACTATGTTGGGGAGGAAGG - Intronic
1140185189 16:72763338-72763360 TTGAAGAAAGAAGAGGAGGAGGG + Intergenic
1140649730 16:77074254-77074276 TAGAACAATGTTGAATAGGAGGG - Intergenic
1141112704 16:81283182-81283204 TTGAAGAATCTTCAGGATGTGGG - Intronic
1141157447 16:81607082-81607104 TTGAAGAATGTTGAGGAGGAGGG + Intronic
1141315621 16:82960027-82960049 TTGAAGAGTTTTGAGCAGTAAGG + Intronic
1141319293 16:82991803-82991825 TTGAACATAGTTGAGGAAGAGGG + Intronic
1143696192 17:8621313-8621335 TTTCAGAATGTTGAGGAACAGGG - Intronic
1143774985 17:9193302-9193324 TTGAAAAATGTTGAGAAGTAGGG + Intronic
1144137469 17:12311505-12311527 TTCCAAAAAGTTGAGGAGGAGGG - Intergenic
1144499664 17:15774654-15774676 TAGAAGAATGGATAGGAGGATGG - Intergenic
1144532855 17:16056610-16056632 TTTAAGAATGCTGAGAAGGCCGG - Intronic
1147055158 17:37828489-37828511 TTAAGGAAAGTGGAGGAGGAAGG + Intergenic
1147319665 17:39638154-39638176 TTGAAGGATGTTCAGGAAGTTGG - Intronic
1148617489 17:49012207-49012229 TTGAAGAAAATTGAGATGGATGG + Intronic
1149127932 17:53257854-53257876 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1149310740 17:55390901-55390923 TTGGAGAATGTTGCTGTGGAAGG - Intergenic
1149522037 17:57324720-57324742 TGGAAGAAAGTGAAGGAGGAGGG - Intronic
1150520680 17:65864494-65864516 CTGAAGAATGTCGAGGAAGGTGG - Intronic
1150528469 17:65951266-65951288 TTTCAGAATATTGAGGAAGAAGG - Intronic
1151182715 17:72341532-72341554 TTGAAGAATGTTGGGTAATAAGG - Intergenic
1151290671 17:73147728-73147750 TGGCAGCATGTTGAGGAGGAAGG - Intergenic
1151797572 17:76356557-76356579 TTTAAGCATGTTGACCAGGATGG - Intronic
1152070813 17:78132772-78132794 TGGAGGGCTGTTGAGGAGGAAGG - Exonic
1152707298 17:81851224-81851246 TTTAAGAAGTTTGAGGAGGCCGG - Intronic
1153290152 18:3493034-3493056 CAGGAGCATGTTGAGGAGGAGGG + Intergenic
1155406674 18:25496208-25496230 TGGGAGAATGTGGAGAAGGAGGG + Intergenic
1155855689 18:30831298-30831320 TTCCAAAAAGTTGAGGAGGAGGG + Intergenic
1156515720 18:37678476-37678498 GTGAACAATGATGAGGAGAAAGG + Intergenic
1157112616 18:44835094-44835116 TTGAAGAGTATTAAGGATGAGGG + Intronic
1157370294 18:47104644-47104666 TTGATGAATGATGAAGAAGAAGG - Intergenic
1157618182 18:49000085-49000107 ATAAAAAATGTTGATGAGGACGG - Intergenic
1157642158 18:49227676-49227698 TTGAAGCTTGCTGAGGTGGATGG + Intronic
1158419547 18:57280600-57280622 GCTAAGAATGTTGAGGAAGAAGG - Intergenic
1159698434 18:71591282-71591304 TTGAAGATGCTTGAGGTGGAAGG + Intergenic
1159965193 18:74588064-74588086 TTGAAGAATAATGTGGAGGGTGG - Intergenic
1160425494 18:78776230-78776252 TGGAAAAATGTGGAGGAGGAAGG + Intergenic
1161852250 19:6743685-6743707 CTGAAGAATGCAGAGGTGGAAGG - Intronic
1162174753 19:8822800-8822822 TTGAAGAAGGATGGGAAGGATGG - Intronic
1164279078 19:23752480-23752502 TTTAAGAATGTGGATGAGTATGG - Intronic
1164592167 19:29513051-29513073 TAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164896889 19:31884586-31884608 TTTAAGAATGCAGGGGAGGAGGG + Intergenic
1165121022 19:33558644-33558666 TTGAAGGATGTAGAGGAGTTTGG + Intergenic
1165647099 19:37450183-37450205 TTTCAGAATATTGAGGAGGAGGG - Intronic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1166211452 19:41309198-41309220 GGGAAGAGTCTTGAGGAGGATGG - Intronic
1167191288 19:47991750-47991772 GTGAAGAAGGAAGAGGAGGAGGG - Intronic
1168400115 19:56080774-56080796 TGGAAGAAAGTTGAGGGGGGAGG - Intergenic
1202676882 1_KI270711v1_random:15240-15262 TTTAAGAATGTTGAAGATGCTGG - Intergenic
925143794 2:1567881-1567903 TTGAGGATTCTTGAGGAGGGAGG + Intergenic
925310439 2:2877902-2877924 TTGTAAAATGTTAAGTAGGAAGG - Intergenic
925616079 2:5745599-5745621 TTGAAGATTGGTCAGGAGGAAGG + Intergenic
925702126 2:6649227-6649249 ATGAAGAATGAGGAGGAAGAAGG - Intergenic
926686679 2:15703641-15703663 TTGTGGAATGTTGAGGAGGAAGG + Intronic
927157776 2:20231470-20231492 TTGAATAATATGGAGGAGGTGGG + Intergenic
928630352 2:33185247-33185269 TTGGTGAATGTTCAGGAGGGAGG + Intronic
928726491 2:34179778-34179800 TTGCAGAATGTTGAAGGGAAAGG - Intergenic
928955699 2:36865014-36865036 TTCCAGAAAATTGAGGAGGAGGG - Intronic
928971658 2:37036020-37036042 TTGAATAATATTTAGGATGAAGG - Intronic
929937441 2:46303866-46303888 GTGAAGAATGGGGAGGAGGAAGG + Intronic
930210415 2:48631153-48631175 TTCCAAAATGTTGAGGAGAAGGG - Intronic
931242571 2:60466433-60466455 TTGCAGAAGGTTTAGGAGGTTGG - Intronic
934650860 2:96090631-96090653 TTGAAAAATGTTGGGAAAGATGG - Intergenic
935277184 2:101485097-101485119 TTGGAGAATGAAGAGGAAGATGG - Intergenic
935475690 2:103519424-103519446 TTCCAGAATATTGAAGAGGAGGG - Intergenic
936539412 2:113337881-113337903 TCCAAGAATGTTTGGGAGGAGGG - Intergenic
936720584 2:115247754-115247776 TTCAAGAAGGTTGATGATGATGG + Intronic
937229312 2:120388316-120388338 TTGAAGGATAATGAGGAGGAAGG + Intergenic
938252887 2:129829250-129829272 TCTAAGAATGTTGAGGAGCGTGG + Intergenic
939121148 2:138118601-138118623 TGGAAGAATTGGGAGGAGGATGG - Intergenic
939190891 2:138915481-138915503 TTAGAGAAAGATGAGGAGGAAGG - Intergenic
939291296 2:140198661-140198683 CTGAATAATTTTGAGTAGGATGG - Intergenic
939385614 2:141493328-141493350 TGGAAGAATCTTGAGGAAAAGGG + Intronic
939424669 2:142019641-142019663 TTGGAGAGTTTTGAGCAGGAGGG - Intronic
939554688 2:143660238-143660260 ATACAGAATGTGGAGGAGGAAGG - Intronic
941013678 2:160330742-160330764 TTGGAGAATGGTGAGCAGAAAGG - Intronic
941342363 2:164323159-164323181 TTTTAGAAGGCTGAGGAGGAAGG - Intergenic
941454924 2:165703737-165703759 ATGAAGGATCTTGAGAAGGAGGG + Intergenic
942210424 2:173664232-173664254 TTGAAGAAGGCGGAGGAGGAGGG - Intergenic
943218704 2:185075782-185075804 ATGTAGAATGAGGAGGAGGAGGG + Intergenic
943548963 2:189315037-189315059 TTCCAAAATGTTGAGGAGGAAGG + Intergenic
943856374 2:192798426-192798448 TTGAAGAATGTTGAGCAAAAGGG - Intergenic
944115411 2:196180680-196180702 ATGAAGAATGCTGAGACGGAAGG + Intergenic
944276393 2:197843298-197843320 ATGAAGAATGTAAAGCAGGAGGG - Intronic
944325430 2:198398554-198398576 CTGATGAATTTTGAGGAGAAAGG + Intronic
944471617 2:200059253-200059275 TTCCAAAATATTGAGGAGGAAGG + Intergenic
944747300 2:202671248-202671270 TTTAAGAATGTTGAAGAAGTAGG + Intronic
945564689 2:211382735-211382757 TTGAAAAATGTAAAGGATGAGGG + Exonic
946458067 2:219845259-219845281 TTGAGGCAGGATGAGGAGGAGGG + Intergenic
946540940 2:220684020-220684042 TTGAGGAATGGTGAGGAGTCGGG + Intergenic
946704653 2:222446159-222446181 CTGAAGAGTGTTGATGATGAGGG + Intronic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
947046879 2:225997608-225997630 TTGAAGAATCTGGTGGAGAATGG - Intergenic
947266440 2:228287455-228287477 TTCAAAAATTTTGAGGAGGAGGG - Intergenic
947325436 2:228970114-228970136 TTGAAGAAAGCAGAGGAGGTTGG - Intronic
947403639 2:229752725-229752747 TTGAAGAATGGGGAGCAGGGTGG + Intergenic
1168812040 20:710495-710517 TTGAAGAATTGTGGGGCGGAGGG + Intergenic
1169184840 20:3605745-3605767 TTGGAGAGTGATGGGGAGGAAGG + Intronic
1169329079 20:4702559-4702581 TTGAGGAAGGCTGAGGAGGAAGG + Intergenic
1170341691 20:15335881-15335903 ATGAAGAATGGTGAGGAGAAGGG - Intronic
1170647658 20:18211361-18211383 TGGAAGAGTGTTGAGCAGAATGG - Intergenic
1170935961 20:20809827-20809849 TTGGAGAATTTTGAGGAGAGAGG - Intergenic
1171824929 20:29887978-29888000 TTGAAGCATTTTGAGGTGTATGG - Intergenic
1172274585 20:33672764-33672786 TTGAGGAAGGTTGAGGAGATGGG + Intronic
1172599108 20:36171477-36171499 TAGAAGGAAGATGAGGAGGAAGG - Intronic
1172734088 20:37112885-37112907 TTGGAGAAGTTGGAGGAGGAGGG - Intronic
1173645733 20:44632070-44632092 TTGATGGTTGTTGAGGAGGGAGG - Intronic
1173700430 20:45065521-45065543 TTCCAGAAAATTGAGGAGGAGGG - Intronic
1174696699 20:52567030-52567052 TTGAAGAAAGGTGTGGAGGTAGG - Intergenic
1174729986 20:52906718-52906740 TTAAAGAATGTTCTGGAGCAGGG - Intergenic
1174983962 20:55428716-55428738 TATAAGAATCTTGAGGAGGAAGG + Intergenic
1175100800 20:56577419-56577441 TGGAAGAACGTGGAGGAGGAAGG + Intergenic
1175185481 20:57177202-57177224 AAGAAGAGGGTTGAGGAGGAAGG + Intronic
1175402559 20:58708771-58708793 CAGAAGAATGCTGAGGCGGACGG + Intronic
1175660263 20:60806548-60806570 TCGAAGAACGTCAAGGAGGAAGG + Intergenic
1176360427 21:5991541-5991563 TTCCAGAAAATTGAGGAGGAAGG - Intergenic
1176997563 21:15574473-15574495 TTGAAAAATGATGAAGGGGATGG + Intergenic
1178046534 21:28700749-28700771 TTTCAGAAAATTGAGGAGGAGGG + Intergenic
1178773289 21:35525809-35525831 TAGAGGAATGTTGAGAAGGAAGG - Intronic
1179000339 21:37451989-37452011 TTGAAGAATGGTGAGAAGGTCGG + Intronic
1179151789 21:38815454-38815476 TTGAGGATTGTTGAGGGGGCGGG + Intronic
1179381667 21:40904915-40904937 TTGAATAATTTCGAGGGGGAGGG + Intergenic
1179553302 21:42156888-42156910 TGGAAGAAGGTTGGGGAGGCAGG - Intergenic
1179763091 21:43547009-43547031 TTCCAGAAAATTGAGGAGGAAGG + Intronic
1180596847 22:16981722-16981744 TTCCAAAATGTTGAGGAGGATGG + Intronic
1180764833 22:18340293-18340315 TTTGAGGATGTTGAGGATGAGGG - Intergenic
1180814197 22:18779391-18779413 TTTGAGGATGTTGAGGATGAGGG + Intergenic
1181002697 22:19995288-19995310 TGGAAGAATGTGTAGGAGGGTGG + Intronic
1181200382 22:21213726-21213748 TTTGAGGATGTTGAGGATGAGGG + Exonic
1181279325 22:21707640-21707662 TTGAAGACTGATGAGGATGTGGG - Intronic
1181502530 22:23325549-23325571 TTTGGGTATGTTGAGGAGGAGGG + Intergenic
1181701355 22:24623233-24623255 TTTGAGGATGTTGAGGATGAGGG - Exonic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182986067 22:34718106-34718128 TTTGAAAATATTGAGGAGGAGGG + Intergenic
1185348201 22:50319773-50319795 GTGAAGACTGCTGAGCAGGACGG - Intronic
1203226455 22_KI270731v1_random:81198-81220 TTTGAGGATGTTGAGGATGAGGG - Intergenic
1203264295 22_KI270734v1_random:5078-5100 TTTGAGGATGTTGAGGATGAGGG + Intergenic
949111011 3:260305-260327 TTTAAGAATGTAAAGGAAGATGG - Intronic
949151841 3:778467-778489 TTCAAGAAAGTTGGGGAAGACGG + Intergenic
949521139 3:4855121-4855143 TTGGAGAATGTTGTGAAGCAGGG - Intronic
950129708 3:10533797-10533819 GTGTAGACTGTGGAGGAGGAAGG - Intronic
950296614 3:11837861-11837883 TTGGAGAATCTTGAGGGGGAGGG + Intronic
950739927 3:15042221-15042243 TTGAAGAAACTTGGGGTGGAGGG - Intronic
951055362 3:18140961-18140983 TTGTAGAAAGGTGAGGAAGATGG + Intronic
951129335 3:19023280-19023302 TTGAAGGCTGTTGAGGAGGTGGG + Intergenic
951309179 3:21103046-21103068 TTCCAAAATATTGAGGAGGAAGG - Intergenic
951782036 3:26374400-26374422 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
951870972 3:27362141-27362163 TTGAAGAAGGTCCAGAAGGATGG + Intronic
951935452 3:28017833-28017855 TTGAAAAATGTTAAAGAAGACGG + Intergenic
952534742 3:34297696-34297718 TTGGAGAGTGGTGAGGAAGAGGG + Intergenic
952710214 3:36423867-36423889 AAGAAGAAAGATGAGGAGGAAGG - Intronic
953434218 3:42865809-42865831 GTGAAGAAAGTGGAGGAAGAAGG - Exonic
953643431 3:44730383-44730405 TTTGAGAATGTAGACGAGGAAGG + Intronic
953763401 3:45712695-45712717 TTGAAGAATTTTGAGCAGATAGG + Intronic
953809637 3:46100975-46100997 TTTAAGGAAGTTGATGAGGAAGG - Intergenic
954469241 3:50677630-50677652 TTGGAGAAATTTGTGGAGGAGGG + Intronic
954738857 3:52730391-52730413 TTCCAGAGAGTTGAGGAGGAAGG + Intronic
954807292 3:53228043-53228065 CTGAAGAAAGGTGAGGAGAAGGG - Exonic
955062168 3:55502656-55502678 TTGAAGAATGTTGAACAGCATGG + Intergenic
955509140 3:59661989-59662011 TAGAAGAATCTGGAGGAAGAGGG + Intergenic
955535142 3:59915617-59915639 ATGAGGAATGTTGAGAAGCATGG - Intronic
955897366 3:63714870-63714892 TGGAACAAAGTTGGGGAGGATGG - Intergenic
956115928 3:65918673-65918695 TTTAAGAATGTTGTGGAGGCCGG - Intronic
956262514 3:67360393-67360415 TTGAAGAGTTATGAGGATGAAGG - Intergenic
957398746 3:79680824-79680846 TTGAAGAATCTCTAGGAGGTGGG + Intronic
957644201 3:82899588-82899610 TTTAAGTATTTTGAGTAGGAAGG - Intergenic
959519842 3:107313022-107313044 TTGCAAAAACTTGAGGAGGAAGG - Intergenic
959900726 3:111658923-111658945 TTCCAGAAAATTGAGGAGGAGGG - Intronic
959998748 3:112708022-112708044 TTTCAGAAAGTTGAGGAGGAGGG - Intergenic
960732674 3:120743681-120743703 TTGAAGGATGATTAGGAGAAGGG + Intronic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963516900 3:146320306-146320328 TTTCAAAAAGTTGAGGAGGAGGG + Intergenic
963532878 3:146493251-146493273 TTGCAAAAAATTGAGGAGGAGGG + Intronic
965294004 3:166919486-166919508 TTGCAAAAAATTGAGGAGGAAGG + Intergenic
965598066 3:170427120-170427142 TTGATCACTGTTGAGGAGGTTGG - Intronic
965829323 3:172766446-172766468 CTGAAGAATGATTAGAAGGAAGG + Intronic
966499470 3:180622955-180622977 TTCCAAAATATTGAGGAGGAGGG - Intronic
966561563 3:181326225-181326247 TTGATGAATCTTCAGGAGCAAGG - Intergenic
966708886 3:182949937-182949959 TTGAAGGAAGATGAGGATGATGG - Intronic
967289394 3:187904337-187904359 TTGAAGAAGGCTGAAGAGAAAGG - Intergenic
968393114 4:209260-209282 GTGAATATTGTTGTGGAGGAAGG - Intergenic
968402416 4:309517-309539 GTGAATATTGTTGTGGAGGAAGG + Intergenic
968669417 4:1840913-1840935 TTGATGACTGTTGTGGTGGAGGG + Intronic
970321223 4:14877440-14877462 TTGAAGAATGGTTAGGAGTTAGG - Intergenic
970341247 4:15109165-15109187 TTGAACAATGCTGAGGAGAGGGG + Intergenic
971707113 4:30058981-30059003 TTGAAGAAAGTTGAGGATTATGG - Intergenic
972722775 4:41717205-41717227 TAGTAGAATGTTGAAGTGGAAGG - Intergenic
972738875 4:41872279-41872301 TGAAAACATGTTGAGGAGGAGGG + Intergenic
974178276 4:58352979-58353001 TTGAAAAATGTTGTGGGGGAAGG + Intergenic
974252373 4:59403260-59403282 TTGAAGCATGTGTAGGAAGAGGG - Intergenic
974816970 4:67017677-67017699 TTGAATAATGATGATGATGATGG - Intergenic
974889670 4:67865951-67865973 TTCCAAAATATTGAGGAGGAGGG + Intronic
975088202 4:70368440-70368462 TTGAAGAATATTAAGAAGCAAGG + Intergenic
975936624 4:79589171-79589193 TTGCATAGTGTTGAGGAGGCTGG - Intergenic
976159338 4:82182131-82182153 TTAAAGAAGTTAGAGGAGGAGGG + Intergenic
976955864 4:90898618-90898640 TTGTAGTATGTTGAGAAGTAAGG + Intronic
977338343 4:95726285-95726307 TTGAAGTATGTGAAGGAGGGAGG + Intergenic
977365622 4:96064401-96064423 TTGAAGAATTTTTAGGAGCCAGG + Intergenic
977583104 4:98746453-98746475 TGGCAGGAGGTTGAGGAGGAAGG - Intergenic
977922564 4:102661544-102661566 TTGAAGAACATTGAAGAAGAAGG + Intronic
978320370 4:107487021-107487043 TTTAAAAATTTTGAGGAAGAAGG + Intergenic
978976474 4:114881109-114881131 TTGAAGGATTTTGAGTAGGGAGG + Intronic
979359724 4:119747137-119747159 TTGAAGACTGAAGAGTAGGAGGG - Intergenic
980205359 4:129712527-129712549 TGGAGATATGTTGAGGAGGAGGG + Intergenic
980264811 4:130501452-130501474 TTAAAGAATGTTAAGGAGACAGG + Intergenic
980516665 4:133871429-133871451 TTGCAGAATGCTGAGGAAGTAGG + Intergenic
980555790 4:134402421-134402443 TTGTAAAAAATTGAGGAGGAGGG - Intergenic
980863342 4:138525116-138525138 TTCCAAAAAGTTGAGGAGGAGGG + Intergenic
980954021 4:139410115-139410137 TTAAGGAATGCTGAGGAGGCAGG + Intronic
980997394 4:139793058-139793080 TTTAAGAATGCTGATGAGGATGG + Intronic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981398054 4:144277801-144277823 TGGAAGAATGTGGAGGTGGAGGG - Intergenic
982644352 4:158004860-158004882 TCGAAGAATCCTGAGGAGGATGG - Intergenic
982905047 4:161057395-161057417 TTGAAGTAGGATGAGAAGGATGG - Intergenic
982939634 4:161533680-161533702 TTCAAAAAAATTGAGGAGGAGGG + Intronic
983045466 4:162981828-162981850 TTGTTGAATCTTGAAGAGGAGGG - Intergenic
983555575 4:169056335-169056357 CTGAATTATGTTGAGCAGGATGG + Intergenic
983870522 4:172820163-172820185 TTGACTAATGTGGAGGAAGAGGG + Intronic
983872687 4:172840508-172840530 TGGATGAATGGTGAGCAGGATGG - Intronic
984112975 4:175643200-175643222 TTGAAGAATGGTTTGTAGGAAGG - Intronic
984128382 4:175840820-175840842 TTGAAGAATGAACAGGAGAACGG + Intronic
984472233 4:180190928-180190950 TTGAAGAAGTTTGAGGTGTAAGG + Intergenic
984895465 4:184535705-184535727 TTGAATAATGATGATGATGATGG + Intergenic
986048629 5:4065754-4065776 CTGAAGAGTGGTGAGGAGCAAGG + Intergenic
986495173 5:8334123-8334145 CTGCAGAATGTTGGGGAAGAGGG - Intergenic
986728436 5:10617576-10617598 TAGAAGAATGGGGTGGAGGAAGG - Intronic
986734347 5:10657038-10657060 TTTAAGAAGTTTGAGGAGGTAGG + Intergenic
987068931 5:14317650-14317672 GTGAAGAATGATGAGAATGATGG - Intronic
987435780 5:17892554-17892576 TTCAAGAATGTACAAGAGGATGG + Intergenic
987778744 5:22404027-22404049 TTGAACAAAATTGAGGATGAAGG + Intronic
987862040 5:23501257-23501279 TTCAAAAATATTGAAGAGGAGGG - Intergenic
988104303 5:26723790-26723812 TTTGAGATTGTTGAGGAAGAAGG - Intergenic
988816967 5:34843757-34843779 TTGAAAAATATTGAGGAGAGAGG - Intronic
988966910 5:36428421-36428443 TTCCAAAAAGTTGAGGAGGAAGG - Intergenic
989299466 5:39872356-39872378 TTGCAAAAAATTGAGGAGGAAGG - Intergenic
989447379 5:41546233-41546255 TTAAAGCATCTTGAAGAGGAGGG - Intergenic
989729690 5:44633886-44633908 TTTAAGAGGGTTGAGGAGTATGG - Intergenic
990162576 5:52958291-52958313 TTAAAGTATTTTGAGGAGTAAGG - Exonic
990898033 5:60720160-60720182 TTCAAAAAAATTGAGGAGGAAGG + Intergenic
991242000 5:64470917-64470939 TTTAAGAATGTTGAGGGGTCTGG - Intergenic
991353694 5:65746558-65746580 TTGAAAAGTCTTGAGGATGAAGG + Intronic
993392294 5:87334716-87334738 TTGAAGAGTGTTGTTGATGAGGG + Intronic
993692090 5:91014410-91014432 TTCAAAAAAATTGAGGAGGAAGG - Intronic
993995260 5:94715042-94715064 TTAAAGGAAGATGAGGAGGAAGG + Intronic
994654330 5:102571217-102571239 TTCAAAAATATTGAAGAGGAGGG + Intergenic
995278260 5:110303359-110303381 TTCAAAAATATAGAGGAGGAGGG - Intronic
995496436 5:112749430-112749452 TTGAAGGATTTGGAGGAGGAGGG + Intronic
996426914 5:123322865-123322887 TTCCAAAATATTGAGGAGGAGGG - Intergenic
997203926 5:132030365-132030387 CTGAAGAATTTTGAGAAGCAGGG + Intergenic
997206771 5:132054778-132054800 AGGAAGAAGGATGAGGAGGAGGG + Intergenic
998968749 5:147568770-147568792 AAGCAGGATGTTGAGGAGGAGGG + Intergenic
999267272 5:150275076-150275098 GTGCAGAAGGATGAGGAGGAAGG + Intronic
999420754 5:151440437-151440459 TCACAGAATGTTCAGGAGGATGG + Intronic
1000283873 5:159809245-159809267 ATGAAGAATGCAGAGTAGGAGGG + Intergenic
1000382072 5:160638233-160638255 ATGAAGAAAGTTCATGAGGAGGG - Intronic
1000456131 5:161451690-161451712 ATGAAGAATGATGGTGAGGAGGG + Intronic
1000886493 5:166753569-166753591 TAGAAGAATGTTAATGAGGCCGG - Intergenic
1001037852 5:168310727-168310749 TTGTGGAATGCTGAGGTGGAAGG + Intronic
1001541606 5:172543359-172543381 ATGAGGGATGCTGAGGAGGAAGG + Intergenic
1001725142 5:173890262-173890284 TTGATTATTGTAGAGGAGGAAGG - Exonic
1001741093 5:174053359-174053381 TTGGAGCATGCTGAGAAGGATGG + Intronic
1004681726 6:17902266-17902288 TTGGAGAATGAAGGGGAGGATGG - Intronic
1006412481 6:33882463-33882485 TTGCAGAACTTTGGGGAGGAGGG + Intergenic
1006560590 6:34908278-34908300 TAGAAGATTGGTGTGGAGGAGGG + Intronic
1006967024 6:37997928-37997950 TGGAAGATTGTTCAGGAAGAAGG + Intronic
1008189701 6:48439464-48439486 TTGAGGACTGTTGAGAAGGATGG + Intergenic
1008370144 6:50722611-50722633 GTGAACAATGTTGATGACGATGG + Intronic
1008530105 6:52449050-52449072 TTCCAAAAAGTTGAGGAGGAGGG - Intronic
1008541992 6:52553557-52553579 TGGTAGAATGGGGAGGAGGAAGG - Intronic
1008702387 6:54116700-54116722 TTCAAAAATATTAAGGAGGAAGG + Intronic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1009405828 6:63311433-63311455 TTAAACAATGTTGAAGATGAAGG - Intronic
1009567306 6:65325205-65325227 ATGAAGAAGGGAGAGGAGGAGGG - Intronic
1010605573 6:77886195-77886217 TCCAAAAAAGTTGAGGAGGAGGG - Intronic
1010950257 6:82028274-82028296 TTTTAGAAGGTTGAGTAGGATGG - Intergenic
1011570887 6:88733253-88733275 TGGAAGAAGGCTGAGGTGGAAGG + Intronic
1012096345 6:94967554-94967576 TTTGAAAATGTTCAGGAGGAGGG + Intergenic
1012159086 6:95860430-95860452 TAGAAGAATGTGGAGGAAAAAGG + Intergenic
1012394300 6:98778292-98778314 TGGAAGAGTCCTGAGGAGGATGG + Intergenic
1012957698 6:105588935-105588957 TTGATGAATGTTGAGGATATAGG + Intergenic
1013968929 6:115991805-115991827 TTCAAAAAAATTGAGGAGGAGGG - Intronic
1014397476 6:120943764-120943786 TTGGAGAATGTGGGGGAGGATGG - Intergenic
1014412650 6:121146058-121146080 TTGAAGACTGATGTGAAGGATGG + Intronic
1014817859 6:125954691-125954713 ATGAAGAATGGTTAGGAGCAAGG - Intergenic
1014981699 6:127952871-127952893 TTTAGGTATGTCGAGGAGGAAGG + Intergenic
1014999773 6:128200827-128200849 AAGAAGAAGGATGAGGAGGAGGG + Intronic
1015111289 6:129594718-129594740 GTGAAGAATGTGGAAGAAGAAGG - Intronic
1016098028 6:140061973-140061995 TAGAAGAATGCTGAGGGAGATGG + Intergenic
1017541208 6:155404904-155404926 TTGAAGGAGGTTAATGAGGAGGG - Intronic
1017558865 6:155605224-155605246 ATGAAGAATGTTGAGTCAGAAGG + Intergenic
1017601598 6:156089142-156089164 TTCCAAAATATTGAGGAGGAGGG + Intergenic
1018668909 6:166163678-166163700 TTGAAGAGTGTAGAAGAGGACGG - Intronic
1020383315 7:7569239-7569261 TTTAAGAATGAGGAGGAAGAGGG - Intronic
1020538544 7:9431159-9431181 TTGAAGAAGGATGATGATGAAGG - Intergenic
1022029269 7:26477541-26477563 TTGGAGACTGCAGAGGAGGAAGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023205467 7:37745040-37745062 TTAAATGAAGTTGAGGAGGAAGG - Intronic
1024268741 7:47626280-47626302 TTGAAGAATGGTGAGGGGTCAGG - Intergenic
1024441110 7:49418992-49419014 TTGAAGCATGTAGAGAAGCATGG + Intergenic
1024808414 7:53177172-53177194 TTCATGAATCTTGAGGATGAAGG - Intergenic
1024910372 7:54441405-54441427 TTGAAGAAAGGTGATGAGCATGG + Intergenic
1025226850 7:57172965-57172987 TTGATGAATGATGAGTATGATGG - Intergenic
1025229911 7:57196246-57196268 TTGATGAATGGTGAGTATGATGG - Intergenic
1026049156 7:66930399-66930421 TTGAAGGATCCTGAGAAGGAAGG + Intronic
1026960456 7:74404379-74404401 TTGAAGAAGGTTCAGAAGGTGGG - Exonic
1028838537 7:95400681-95400703 TTGAGAAATGTTTAGGTGGAGGG + Intergenic
1029135540 7:98368048-98368070 GTGAGGATTGGTGAGGAGGAGGG - Intronic
1030394789 7:108972310-108972332 TTCAAGAAGGTTGAGAAGGTTGG - Intergenic
1030398946 7:109024388-109024410 TTGTAGTATGTTTAGGATGATGG + Intergenic
1031039465 7:116823862-116823884 TTTCAGAAAATTGAGGAGGAGGG - Intronic
1031213686 7:118862649-118862671 TTAAAGAATATTGGTGAGGAGGG + Intergenic
1031429730 7:121652426-121652448 TTGCAAAAAATTGAGGAGGAGGG - Intergenic
1031590645 7:123588069-123588091 TTGCAAAAAGTTGAAGAGGAGGG - Intronic
1031772554 7:125862986-125863008 TTCCAAAATGTTTAGGAGGAGGG - Intergenic
1034848912 7:154475392-154475414 ATGAAGATTGTGGAGAAGGAAGG - Intronic
1035212587 7:157339205-157339227 TTGAAGACTGATGAGGGTGACGG - Intronic
1036455336 8:8901942-8901964 ATGAAGCATGTCCAGGAGGAGGG + Intergenic
1036754871 8:11465432-11465454 TTGAAGACTGATGGGGAGGATGG + Intronic
1037231292 8:16662008-16662030 TTGAAGAATGTTGAAGGGCAAGG - Intergenic
1037651271 8:20840844-20840866 CTGAGGAATGTTGAGCATGAAGG + Intergenic
1037839914 8:22237367-22237389 ATGCAGAATTTTGTGGAGGAAGG + Intergenic
1039089536 8:33813536-33813558 TTGAAGATTTTTGCAGAGGATGG + Intergenic
1040141050 8:43913866-43913888 TTGAAGAATTTTGAGGCGTATGG + Intergenic
1040804014 8:51374177-51374199 TTCAATGATGTTGAGAAGGAAGG - Intronic
1041212957 8:55571249-55571271 GAGAAGAATGTTGAGGTGGCTGG - Intergenic
1041372407 8:57176022-57176044 TTCAAAAAAGTTGAGGAGGAGGG + Intergenic
1042104238 8:65307704-65307726 TGGAAGATTGTTGAGAATGAAGG + Intergenic
1042350898 8:67776505-67776527 TTGAAGAATGTTGGGGAGGTGGG + Intergenic
1042781234 8:72493501-72493523 TTGAAAAATGGTGAGAAGGATGG - Intergenic
1044375967 8:91471068-91471090 TGGTAGTCTGTTGAGGAGGAGGG - Intergenic
1044681113 8:94778533-94778555 TTGAAGAAAGTGGAAGCGGAGGG - Intronic
1045011361 8:97961570-97961592 GTTAAGCATGGTGAGGAGGAGGG + Intronic
1045165865 8:99604261-99604283 TTGTAGAATGTTGACAAGAAGGG - Intronic
1045988978 8:108283944-108283966 TTGATGAATATGAAGGAGGACGG - Intronic
1046600454 8:116311007-116311029 TTACAGAATGTTGAAGAAGAAGG - Intergenic
1046649685 8:116823854-116823876 CTGAAAAATGTGGAGGGGGATGG - Intronic
1047291178 8:123531730-123531752 TTGAAGTACGTTGGGGAAGAAGG + Intronic
1047428134 8:124765534-124765556 TTGAAGAATGTTTCTGAGGAAGG - Intergenic
1047699904 8:127438501-127438523 TTCCAGAAAATTGAGGAGGAGGG + Intergenic
1048283839 8:133125765-133125787 TTGGAGCCTGTTGAAGAGGAGGG + Intronic
1048477225 8:134754666-134754688 TTGAAGAAGGGTGAGGTGGGTGG - Intergenic
1048917217 8:139196792-139196814 TTGGAGTCTGTTAAGGAGGATGG - Intergenic
1049231329 8:141485148-141485170 TTCAAGAAAATAGAGGAGGAAGG - Intergenic
1049281741 8:141753024-141753046 TTGAAGAAATGTGAGGGGGACGG + Intergenic
1049939948 9:535889-535911 TGGAAGAATTTTGAGGAACATGG - Intronic
1050119378 9:2292688-2292710 ATAAAGCATGTTTAGGAGGAAGG + Intergenic
1050150838 9:2618072-2618094 TTGAAGAAAGTAGAGGAGGCTGG - Intergenic
1050338640 9:4613887-4613909 TCTAAGAATGTTTAGGAGGAAGG + Intronic
1051041144 9:12812718-12812740 TTGAAGATTGTTGAGGAGATAGG - Intronic
1051261958 9:15273456-15273478 GGGAGGAATGTGGAGGAGGAGGG - Intronic
1051893455 9:21965851-21965873 TTGAGGAAGGGTAAGGAGGAAGG + Intronic
1052551029 9:29949387-29949409 TTCCAAAACGTTGAGGAGGAGGG - Intergenic
1052780077 9:32772984-32773006 TTCCAAAAAGTTGAGGAGGAGGG - Intergenic
1053225350 9:36350395-36350417 TTGAATATTGTGGAGGAGGAAGG - Intronic
1053533362 9:38903567-38903589 TGGGAGAGTGTGGAGGAGGAGGG - Intergenic
1053580592 9:39400027-39400049 TTCAAAAAAGTTGAGGAGGAGGG + Intergenic
1053845087 9:42228074-42228096 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1054102179 9:60958832-60958854 TTCAAAAAAGTTGAGGAGGAGGG + Intergenic
1054205588 9:62127996-62128018 TGGGAGAGTGTGGAGGAGGAGGG - Intergenic
1054584180 9:66948031-66948053 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1054632773 9:67460374-67460396 TGGGAGAGTGTGGAGGAGGAGGG + Intergenic
1055741890 9:79398092-79398114 TGGATGAATGGAGAGGAGGAAGG + Intergenic
1056907079 9:90662074-90662096 TTCCACAATATTGAGGAGGAGGG - Intergenic
1057258651 9:93570791-93570813 TTAAAGAAAATTGAAGAGGAGGG + Intergenic
1057489347 9:95509231-95509253 TTGGAGAAAGAAGAGGAGGAGGG + Intronic
1057664349 9:97032925-97032947 CTGATGGATGGTGAGGAGGAAGG - Exonic
1057844750 9:98514857-98514879 TTGAAGAATGGTGGAGGGGATGG + Intronic
1058302623 9:103395151-103395173 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1059241460 9:112809959-112809981 TTGAAGATTGGAGAGTAGGATGG + Intronic
1059334126 9:113557997-113558019 ATAGAGAATGGTGAGGAGGAAGG + Intronic
1059601091 9:115779860-115779882 ATGAAGATTTTTGAGGAGGGAGG + Intergenic
1059640332 9:116210453-116210475 TAAAAGAATGGTGAGGAGGTAGG - Intronic
1059873493 9:118604438-118604460 TTGGAAATTGTTGAGGAGGAGGG + Intergenic
1059970248 9:119659939-119659961 TTGAAGAATGATGAGAATGTTGG + Intergenic
1060164721 9:121401627-121401649 TTCAAAAAATTTGAGGAGGAAGG + Intergenic
1062375282 9:136259239-136259261 TGGCAGAATGTTGGGGGGGAGGG + Intergenic
1186818814 X:13265311-13265333 CACAAGAATGTGGAGGAGGAGGG - Intergenic
1186887784 X:13931896-13931918 TTGAGGAGTGTTGAGAAGGGTGG - Intronic
1187239580 X:17500456-17500478 CTGAAGGTTGTGGAGGAGGAGGG + Intronic
1187704048 X:21991867-21991889 TAGAAGAAAGTTGAAGAGGCCGG + Intronic
1189030351 X:37443031-37443053 TTGAAGAATGTAGAGGGGTTGGG + Intronic
1190109910 X:47582961-47582983 TTGAGGAATTTGGAGGAGGTTGG - Intronic
1190567962 X:51750462-51750484 TTGAAGAATGTGGTTGGGGATGG - Intergenic
1191628307 X:63292574-63292596 TTCCAAAATCTTGAGGAGGAGGG + Intergenic
1192207346 X:69105237-69105259 ATGAGGAATGTTGATGAGGGCGG + Intergenic
1192311347 X:70017316-70017338 TTCCAAAAAGTTGAGGAGGAGGG + Intronic
1192348224 X:70330650-70330672 TTGAAGAGTTTTAAGTAGGAGGG + Intronic
1193823901 X:86198871-86198893 TTCCAAAAAGTTGAGGAGGAGGG + Intronic
1194251565 X:91581912-91581934 TTCCAAAAAGTTGAGGAGGAAGG - Intergenic
1195455516 X:105064820-105064842 TTGAAGGATGTGAAGGTGGAAGG + Intronic
1195541126 X:106064271-106064293 TTCCAGAAATTTGAGGAGGAGGG - Intergenic
1195567540 X:106360071-106360093 TTCAAAAAATTTGAGGAGGAGGG - Intergenic
1196240413 X:113337488-113337510 TTACAAAATATTGAGGAGGAGGG - Intergenic
1197106081 X:122717824-122717846 TTGAAAAATGCAGAGGTGGATGG + Intergenic
1198267285 X:135021742-135021764 TGGAAGTCTGGTGAGGAGGAGGG + Exonic
1198825887 X:140697417-140697439 TTTAGAAAAGTTGAGGAGGAAGG - Intergenic
1199197609 X:145049421-145049443 ATGCAAAATGTAGAGGAGGAGGG + Intergenic
1199452957 X:147993906-147993928 TGGGAGAATCTGGAGGAGGAGGG - Intronic
1199488615 X:148374325-148374347 TCCAAGAAAATTGAGGAGGATGG + Intergenic
1201461748 Y:14233042-14233064 AAGAAGAATGAGGAGGAGGAGGG - Intergenic
1201683021 Y:16669970-16669992 TTTAAGGATTTTGAGGTGGATGG + Intergenic