ID: 1141158519

View in Genome Browser
Species Human (GRCh38)
Location 16:81613235-81613257
Sequence CTGATGAAGCAGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 962
Summary {0: 1, 1: 0, 2: 9, 3: 79, 4: 873}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141158519_1141158525 -6 Left 1141158519 16:81613235-81613257 CCTTCCTCCTCCTGCTTCATCAG 0: 1
1: 0
2: 9
3: 79
4: 873
Right 1141158525 16:81613252-81613274 CATCAGTAGGGCAGCTACCATGG 0: 1
1: 0
2: 0
3: 13
4: 106
1141158519_1141158527 11 Left 1141158519 16:81613235-81613257 CCTTCCTCCTCCTGCTTCATCAG 0: 1
1: 0
2: 9
3: 79
4: 873
Right 1141158527 16:81613269-81613291 CCATGGAGAAATAATGCTCACGG 0: 1
1: 0
2: 0
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141158519 Original CRISPR CTGATGAAGCAGGAGGAGGA AGG (reversed) Intronic
900158920 1:1214218-1214240 CAGAGGAGGCGGGAGGAGGAAGG + Intergenic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
900725553 1:4214191-4214213 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
900816745 1:4853205-4853227 AGGATAAAGGAGGAGGAGGAAGG - Intergenic
900916271 1:5640972-5640994 TGGCTGAAGCAGGAGGAAGACGG + Intergenic
900931161 1:5738681-5738703 CTGATGATTCAGGAGGATCAGGG + Intergenic
901034361 1:6327385-6327407 CGGCAGGAGCAGGAGGAGGAGGG - Exonic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
901395921 1:8981449-8981471 CTGAGAAAGCAGGAGGAAGGAGG - Intergenic
901773416 1:11542917-11542939 GAGAAGAGGCAGGAGGAGGATGG - Intergenic
902436225 1:16399522-16399544 CTGGTGAAGAAGGAGGCAGAAGG + Intronic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902976615 1:20093123-20093145 CTGATGAGGTAGGAGGTGTATGG + Intergenic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
903491079 1:23729081-23729103 ATCTTGAAGGAGGAGGAGGAAGG - Intergenic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
903787328 1:25870113-25870135 CTGAGCCAGCAGGATGAGGATGG + Intronic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904998625 1:34650765-34650787 CTGAGGAAGCAGCAGGAAGGAGG + Intergenic
905183363 1:36179594-36179616 AGGATGGAGGAGGAGGAGGATGG - Intronic
905541850 1:38766184-38766206 CTGCTGGAACAGCAGGAGGAAGG + Intergenic
906180877 1:43817733-43817755 AGGAGGAAGAAGGAGGAGGAGGG - Intronic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
906510071 1:46405742-46405764 CAGATGCCGCAGAAGGAGGAGGG - Exonic
907261263 1:53220447-53220469 CTGAAGGAGCAGGAGGCAGAAGG - Intronic
908834766 1:68217832-68217854 CTAATGAAGCAGGGGGCGGTGGG - Intronic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
910082887 1:83362909-83362931 CTGTTGTAGCAGGAAGAGGTGGG - Intergenic
910278733 1:85475311-85475333 ATGATGATGGAGGAGGAGAAGGG + Intronic
910835809 1:91508850-91508872 ATGATGGAGCAGGTGGAAGAAGG - Intronic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914744379 1:150490809-150490831 ATGAGGAAGCTGGAGGAGAAGGG + Intronic
914747452 1:150510643-150510665 CTTGAGAAGCAGGAGGAGGTGGG + Intronic
914946370 1:152070393-152070415 CTACTGAAGGAGGAGGAGGCAGG + Intergenic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915043313 1:152986562-152986584 CTGATGCTGCAGCAGGAAGAAGG + Intergenic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915504174 1:156342254-156342276 CTGATGACTCTGGAGCAGGAGGG + Intronic
916575123 1:166060169-166060191 CACATGGAGAAGGAGGAGGAAGG + Intronic
916890482 1:169107871-169107893 ATGATGATGTTGGAGGAGGAGGG - Intronic
916944851 1:169716220-169716242 CTGGTGAAGTAAGATGAGGATGG - Intronic
917510705 1:175667094-175667116 GTGGTGAAGAAGGATGAGGAAGG - Intronic
918243882 1:182642536-182642558 CTGAAGAAGAAGGAGCAGGTGGG - Intergenic
918247462 1:182672303-182672325 CTAATGAGCCAGGAGGAGGGGGG + Intronic
920092426 1:203464124-203464146 GGGAGGAAGGAGGAGGAGGAGGG + Intergenic
920139436 1:203797146-203797168 TTGATGAAGCAGGAAGAACATGG + Exonic
920302920 1:205000403-205000425 CTTTTGAAGCTGGAGGAGAATGG - Intronic
920916751 1:210263869-210263891 GTGGTAAAGCAGGAGTAGGAAGG + Intergenic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921514285 1:216070578-216070600 CTCATAAAGAAGGAGGTGGATGG + Intronic
921950099 1:220920656-220920678 ATGAGGAAGCAGGGAGAGGAAGG + Intergenic
922072011 1:222204044-222204066 CTGATCAGGCAGGAGGTGAAAGG + Intergenic
922174739 1:223188735-223188757 GAGATAAAGAAGGAGGAGGAAGG + Intergenic
922353177 1:224751936-224751958 CTGATGAACCAGAAGAAAGATGG + Intergenic
922722649 1:227906531-227906553 AGGATGGAGCAGGAGGAGGGAGG - Intergenic
923000397 1:230002283-230002305 CAGGTGCAGCAGGAGGAGCAAGG + Intergenic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923475302 1:234326086-234326108 AGGAAGGAGCAGGAGGAGGATGG + Intergenic
923517732 1:234711607-234711629 GGGAAGAAGGAGGAGGAGGATGG - Intergenic
923548236 1:234940456-234940478 CTGAGAAAGCATGGGGAGGAGGG - Intergenic
923826908 1:237510259-237510281 GGGATGTAGCAGGAGAAGGAAGG + Intronic
924032459 1:239900153-239900175 CTGTTGAGTCAGGATGAGGAAGG + Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924867155 1:247996087-247996109 CAGCTGAAGGAGGAAGAGGAAGG - Intronic
1062936557 10:1394899-1394921 AGGAAGAAGAAGGAGGAGGAGGG - Intronic
1063231290 10:4067872-4067894 CTGATGAATGAGGAGGAGCCGGG - Intergenic
1063448184 10:6133479-6133501 GTGAGGAAACAGGTGGAGGAAGG + Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1064752821 10:18549008-18549030 TTGATGAAGTAGGAGGCGGTTGG - Intronic
1064815506 10:19257297-19257319 CAGATGACCCAGGAGGATGAGGG + Intronic
1064978873 10:21146505-21146527 CTGATAATGCAGGAGTAGGATGG - Exonic
1065140381 10:22714102-22714124 CAGCTGCAGCCGGAGGAGGAGGG + Intronic
1065325407 10:24546180-24546202 CGGAGGAGGCAGGAGAAGGAGGG - Exonic
1065966201 10:30772623-30772645 GGGATGAAGCAGGAAGAGAATGG - Intergenic
1066571445 10:36777269-36777291 CTGATGAATCAGGAAAAGGGAGG + Intergenic
1067055031 10:43045264-43045286 CTTATGGACAAGGAGGAGGATGG - Intergenic
1067338731 10:45384112-45384134 CTGATGCAGGGGGAGGGGGAAGG + Intronic
1067344775 10:45429191-45429213 GAGATGAGGCAGGAGGAAGAGGG + Intronic
1067547709 10:47206633-47206655 CGGATGAAGAAAGAGGTGGAGGG - Intergenic
1067557812 10:47284871-47284893 GGGAGGAAGAAGGAGGAGGAGGG + Intergenic
1067557818 10:47284891-47284913 GGGAGGAAGAAGGAGGAGGAGGG + Intergenic
1067741637 10:48899977-48899999 CTGTTGAAGCAGGAAGCGAAAGG - Intronic
1067960139 10:50838960-50838982 GTGATGATGGAGGAGGAGAAGGG - Intronic
1068022325 10:51600949-51600971 AAGATGAAGAAGGAGGAAGAAGG + Intronic
1068688032 10:59889293-59889315 CTTCTGAGGCAGGAGGAAGATGG + Intronic
1068787215 10:60989696-60989718 GTGCTGAAGCAGAAGCAGGAAGG + Intronic
1068903305 10:62294550-62294572 GAGATGGAGGAGGAGGAGGAAGG - Intergenic
1069098234 10:64286572-64286594 TTGATGAAGCAGGAGAAAGAGGG - Intergenic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1069285414 10:66708584-66708606 CATATGAATGAGGAGGAGGAAGG + Intronic
1069409525 10:68139075-68139097 ATGTTGGAGCAGGAGGAAGAAGG - Intronic
1069621092 10:69837690-69837712 ATGATGAAGCAGGAGGGTCAAGG - Intronic
1069625425 10:69864975-69864997 CTGAGGAAGCAGCAGGTGCATGG + Intronic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069718514 10:70535570-70535592 AGGAGGAAGAAGGAGGAGGAAGG - Intronic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070364530 10:75723491-75723513 GTCATGCAGCAGGAGAAGGAGGG + Intronic
1070569280 10:77628882-77628904 AGGATGGAGCAAGAGGAGGAGGG + Intronic
1070578431 10:77698489-77698511 ATGATGAAGGAGGAGAAGGAGGG + Intergenic
1070706324 10:78641751-78641773 CTTGTGAAGCAGGAGAAAGATGG - Intergenic
1071730559 10:88244265-88244287 CTGAGGAACAAGGAGGAGGAGGG - Intergenic
1071858216 10:89646673-89646695 CTGATGAGGCAGGAGAGGTAGGG - Intergenic
1072222294 10:93336750-93336772 AGGATGAAGGAGGAGAAGGAAGG + Intronic
1072230494 10:93410288-93410310 GTGACAAACCAGGAGGAGGAAGG - Intronic
1073066904 10:100766495-100766517 CTGTTGGAGCTGGAGGAGGATGG - Intronic
1073420686 10:103421499-103421521 CTGATTCAGGAGGAGGAGGCTGG - Exonic
1073586018 10:104710850-104710872 CATGTGAAGCATGAGGAGGAGGG + Intronic
1073942919 10:108718562-108718584 CAGTTGGAGCAGGTGGAGGAGGG + Intergenic
1074126783 10:110534950-110534972 ATGATGAAGAAGGAGGAGGAGGG + Intergenic
1074215068 10:111376249-111376271 CTGATGAAGAATTTGGAGGAAGG - Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074524870 10:114254480-114254502 CTGATGAGGGTGGAAGAGGAAGG - Intronic
1074640599 10:115376153-115376175 CTTATAAAACAGGAGGAAGAAGG - Intronic
1074773772 10:116751071-116751093 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1074971492 10:118542967-118542989 CTGATGTGGCAGGAGGAGCTTGG + Intergenic
1075035250 10:119060746-119060768 CTGCTGCAGAAGGCGGAGGATGG + Exonic
1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG + Intronic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1076589491 10:131573594-131573616 CTGATGGAGAAGCAGGAGGCAGG + Intergenic
1076897907 10:133323142-133323164 GAGAGGAAGCAGGAGAAGGATGG - Intronic
1077281087 11:1746577-1746599 ATGATGAGTCAGGAGCAGGAGGG + Intronic
1077581282 11:3418826-3418848 CTGCTGCAGCAGGAGGGGGGCGG + Intergenic
1077890609 11:6415530-6415552 ATCATGAAGGAGGAAGAGGAGGG + Intronic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078646225 11:13143248-13143270 GTGATGAAGCAGAATGATGAAGG + Intergenic
1078649669 11:13177037-13177059 CTGTTGAAGAAGCAGGAGCATGG + Intergenic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1079445578 11:20553722-20553744 CTCAAGGAGGAGGAGGAGGAAGG - Intergenic
1080590434 11:33718870-33718892 CTGAGGAAGCAAGAGTTGGAAGG + Intronic
1081016866 11:37892662-37892684 ATTATGAAGCAGGAGGGAGAGGG - Intergenic
1081535658 11:43994381-43994403 CTGATGAAGCAGTCAGAGGCTGG - Intergenic
1081762626 11:45587210-45587232 CAGATGAAGTAGGGGGAGGGTGG - Intergenic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1083052281 11:59788004-59788026 CGTGGGAAGCAGGAGGAGGATGG - Intronic
1083061535 11:59877868-59877890 CTGCTGATGAAGGAGGAGGGAGG - Intergenic
1083399128 11:62411809-62411831 CTGGGGAAGCAGGAGTGGGAAGG - Intronic
1084347667 11:68566300-68566322 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
1084405137 11:68967709-68967731 CTGATGAAGGAGGCAGAGGCTGG - Intergenic
1084952521 11:72674443-72674465 CTGATAATGCAGAAGGGGGAGGG + Exonic
1085266404 11:75240512-75240534 GTGCTGGAGAAGGAGGAGGAAGG + Intergenic
1086458656 11:86984108-86984130 GAGATGAAGCAGGAGGAGAGGGG + Intergenic
1086586293 11:88456293-88456315 ATGATGAAGAGGGAAGAGGAGGG - Intergenic
1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG + Intergenic
1086950043 11:92882601-92882623 CAGATGAAGCAGGACAAAGATGG - Intronic
1087092585 11:94288941-94288963 CTGCAGAAGCAGGAGGATAAGGG + Intergenic
1087672848 11:101127893-101127915 AAGATAAAGGAGGAGGAGGAAGG - Exonic
1088166970 11:106950579-106950601 CTGGTGAAGAAGGTGGGGGAGGG + Intronic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1088794425 11:113255942-113255964 CTGATCAAGCAGGATGACGGCGG + Exonic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089042234 11:115462910-115462932 GGGATGAAGCAGGATGAAGAGGG + Intronic
1089361023 11:117886650-117886672 CCCGTGAAGGAGGAGGAGGAGGG + Intergenic
1089722723 11:120443411-120443433 CCGATGATGCAGGAGAAGGGAGG - Intronic
1090446649 11:126770191-126770213 CTGAAGAAGCAAGGGGAGGTGGG - Intronic
1090737754 11:129625806-129625828 CTGCTGAGGCAGAAGCAGGAGGG - Intergenic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091217083 11:133908793-133908815 CTAGTGAAGCAGGGGGCGGAGGG + Exonic
1091282566 11:134390350-134390372 CTGATGAAGGATGGGGAGGCTGG + Exonic
1091309189 11:134560841-134560863 TTTTTTAAGCAGGAGGAGGAGGG - Intergenic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1091693486 12:2612423-2612445 CTGATGAAATGGGAGGAGGGTGG - Intronic
1091880940 12:3977719-3977741 CTGAGGAAGCAGGAGAAACATGG + Intergenic
1091963280 12:4717679-4717701 AGGCTGAGGCAGGAGGAGGATGG - Intronic
1091964049 12:4723056-4723078 CTTATGAAGGAGGACGTGGAAGG - Intronic
1092188772 12:6502087-6502109 CTGATGCTGCAGAAGGAAGAGGG + Intronic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1092231804 12:6779934-6779956 CTGCTGGAGCAGGAGGGGCATGG + Intergenic
1092372789 12:7931090-7931112 CTGAAGAAGCAGGCTGAGGCCGG - Intronic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093889092 12:24498050-24498072 CTGAGGGTGCAGCAGGAGGAGGG + Intergenic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1094465067 12:30744409-30744431 GTGATGAAGCTGGAGGGGGTAGG - Intronic
1094487555 12:30937107-30937129 GAGATGAAGCAGGAGGAGATAGG + Intronic
1094628262 12:32146926-32146948 AGGAAGAAGAAGGAGGAGGAAGG - Intronic
1096144660 12:49269796-49269818 ATGATGGGGGAGGAGGAGGAGGG - Intronic
1096248014 12:50006384-50006406 GTGATGATGCAGGAGGGGGAAGG - Intronic
1096259154 12:50080245-50080267 AGGATGAAGAAGGAGGAGAAAGG - Intronic
1096546641 12:52344705-52344727 CAAATGAAACAGGAGGAGCAAGG + Intergenic
1096818495 12:54216461-54216483 CTGAAGCTGCAGCAGGAGGAAGG - Intergenic
1097067739 12:56333329-56333351 AGGATGAAGCAGGCGGGGGAGGG + Intronic
1097544246 12:60978940-60978962 CTGCGGAAGCTCGAGGAGGATGG - Intergenic
1098106035 12:67069517-67069539 AGGAAGAAGGAGGAGGAGGAGGG - Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098842470 12:75493091-75493113 CAGATGAAACGGGGGGAGGAAGG + Exonic
1099013841 12:77322856-77322878 GGGATGAAGCAGGAGTAGGTAGG + Intergenic
1099051402 12:77785468-77785490 GTGAAGAAGTAGGAGGAGGGAGG + Intergenic
1099113389 12:78591673-78591695 CTAATGAAGCAGAATGAGTAGGG + Intergenic
1099343881 12:81473491-81473513 CTGATGAAGCTGTAGGAAGATGG - Intronic
1099891889 12:88599271-88599293 GTGATGAGGCAGCAAGAGGATGG - Intergenic
1100295307 12:93255483-93255505 CTGATGAAGCTGGTTTAGGATGG - Intergenic
1101403874 12:104411599-104411621 GAGATGATGCAGGAGGAGGAAGG - Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102167892 12:110820835-110820857 ACGAAGAAGGAGGAGGAGGAGGG - Intergenic
1102394484 12:112574942-112574964 GTGATGAAGATGGAGGAGGGAGG + Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1102582677 12:113900678-113900700 CTCCTGATGAAGGAGGAGGAAGG + Intronic
1102645826 12:114403265-114403287 CGGAGGAGGCAGGAGGAGGCAGG + Intronic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102754590 12:115327089-115327111 CTGATGCAGCAGGTTCAGGATGG + Intergenic
1102792322 12:115657807-115657829 ACGAGGAAGAAGGAGGAGGAGGG - Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1103936725 12:124481087-124481109 CTGAGGAAGCAGGGGGTGAAGGG + Intronic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1104783846 12:131437456-131437478 CTGCTCCATCAGGAGGAGGAGGG - Intergenic
1104820278 12:131673061-131673083 ATGAAGGAGGAGGAGGAGGAGGG + Intergenic
1104820298 12:131673139-131673161 TGGATGAAGCAGGAGGATGAAGG + Intergenic
1105356458 13:19663976-19663998 CTCATGCAGCAGGAGGACAAGGG - Intronic
1105524174 13:21160290-21160312 CTGACAAAGGAGGAGGAAGACGG + Intronic
1105578911 13:21675576-21675598 CTGCTGCCGGAGGAGGAGGAGGG - Intronic
1105738332 13:23295708-23295730 GAGAGGAAGAAGGAGGAGGAAGG - Intronic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1106247541 13:27962317-27962339 CTGATGAAGAAGGGGGTGGGGGG - Exonic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106603206 13:31204704-31204726 CTGATGGAGCAGGAGTTGGAGGG + Intronic
1106607762 13:31247030-31247052 CTGATGAAGGAGGAGGACACTGG - Exonic
1106766823 13:32921871-32921893 GGGAGGAAGCAGGAGGAAGAGGG + Intergenic
1106911005 13:34463718-34463740 CTGATGGAGCAGTAGGTGGTGGG - Intergenic
1107014482 13:35697229-35697251 CAGATGAGGAAAGAGGAGGAGGG - Intergenic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107906797 13:45068860-45068882 CTGAGGAGGCAGGAGATGGATGG + Intergenic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108700229 13:52937460-52937482 GAGATGAAGCAGGAGGTTGAGGG + Intergenic
1109443579 13:62405519-62405541 CTCAGGAAGCAACAGGAGGAGGG - Intergenic
1110352854 13:74529943-74529965 TTAATGAAGAAGGAGGAAGATGG - Intergenic
1110849199 13:80224648-80224670 ATGAGGAAGTTGGAGGAGGAGGG + Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111717473 13:91897049-91897071 TTGATGAAAAAGGAGGAGGAGGG - Intronic
1112383305 13:98914445-98914467 CATTTGAAACAGGAGGAGGAAGG + Intronic
1112479148 13:99757961-99757983 CTGATGAAGAAGGACTGGGATGG + Intronic
1112555351 13:100463066-100463088 CTGATGATGGAGAAAGAGGACGG + Intronic
1112913524 13:104519565-104519587 CTGATAAAGCAGTAGTAAGAGGG - Intergenic
1113674122 13:112196369-112196391 CTGAGGAGGCAGGAGCAGGGAGG - Intergenic
1114537160 14:23430275-23430297 CCGAGGGAGCAGGACGAGGAGGG - Intronic
1114852551 14:26398826-26398848 AGGCTGAAGCTGGAGGAGGATGG - Intergenic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117372761 14:55093967-55093989 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1118373372 14:65156645-65156667 CTGCTGGAGCGGGAGGAGGCAGG - Intergenic
1119025564 14:71149542-71149564 TGGATGAAGCAGGAGGAAGTCGG - Intergenic
1119456871 14:74763622-74763644 CTCATGAAGCCCGAGGAGGAGGG - Exonic
1119740776 14:77012448-77012470 GTGGTGAAGCCGAAGGAGGAGGG - Intergenic
1120794508 14:88617711-88617733 CTGATGTAGCAGGCCGAGGTGGG - Exonic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122873080 14:104650449-104650471 CTGACGACGGGGGAGGAGGAGGG - Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123022927 14:105410692-105410714 CTGGTGAGGGAGGTGGAGGATGG + Intronic
1123800312 15:23811950-23811972 AAAATGAAGAAGGAGGAGGATGG + Intergenic
1123808239 15:23897272-23897294 GTGAGGAGGCAGGAGCAGGAAGG + Intergenic
1123811632 15:23932531-23932553 GTGAGAAAGCAGGAGCAGGAAGG + Intergenic
1123827766 15:24101092-24101114 GTGAGGACGCAGGAGCAGGAAGG + Intergenic
1123842220 15:24260501-24260523 GTGAGGACGCAGGAGCAGGAAGG + Intergenic
1123857247 15:24426563-24426585 GTGAGGACGCAGGAGCAGGAAGG + Intergenic
1123861876 15:24477091-24477113 GTGAGGAAGCAGGAGCAGGAAGG + Intergenic
1123871730 15:24581700-24581722 ATGAGGAGGCAGGAGCAGGAAGG + Intergenic
1123895888 15:24829480-24829502 ATGAGGAGGCAGGAGAAGGAAGG + Intronic
1123899558 15:24862913-24862935 ATGAGGAGGCAGGAGCAGGAAGG + Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1124839375 15:33227660-33227682 CTCATGGAGATGGAGGAGGAAGG - Intergenic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125506090 15:40268484-40268506 GTGGTGGAGGAGGAGGAGGAAGG - Intronic
1125723012 15:41854102-41854124 CTGATGAAGGGGGAGGACGGAGG - Exonic
1126091179 15:45053462-45053484 AAGCTGAAGCAGGAGAAGGAGGG + Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126804398 15:52331742-52331764 CTGCTGCAGCATGAGGTGGACGG - Intronic
1126896174 15:53259064-53259086 CTGAAGAGGCAGGAAGAAGAAGG + Intergenic
1127426651 15:58865021-58865043 CCGCTGAAGCAGGAGGCCGAGGG + Intergenic
1127664654 15:61133834-61133856 CTGATGATGCAGTAGGAAGAAGG - Intronic
1127965700 15:63921354-63921376 CTGAGGAAACAGGGAGAGGATGG - Intronic
1128177671 15:65570525-65570547 CTGAAGAAACAGGAGGTTGAAGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128788177 15:70413485-70413507 TAGATGAAGCAGGAGAGGGAGGG - Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129144329 15:73633355-73633377 CTGCGGCGGCAGGAGGAGGACGG - Exonic
1129295826 15:74599526-74599548 CGGAGGAAGCAGGCTGAGGAGGG + Intronic
1129406398 15:75321828-75321850 AGGATGAAGGAGGAGGAAGAAGG - Intergenic
1129665308 15:77576313-77576335 ATGCTGGAGGAGGAGGAGGAGGG + Intergenic
1129824509 15:78625823-78625845 ATGATGCAGCAGGAGGAGGCTGG - Intronic
1129878332 15:78991649-78991671 CTGAGGAAGCGGGGGGAGGCGGG + Intronic
1130182340 15:81643274-81643296 GTGCTGAGGGAGGAGGAGGATGG - Intergenic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131284727 15:91047849-91047871 ATGAGGAAGGAGGAGGAGTAGGG - Intergenic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131901070 15:97088539-97088561 ATGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901094 15:97088626-97088648 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132659552 16:1055292-1055314 CTGAAGAATCAGGCGGAGCACGG - Intergenic
1132747327 16:1442488-1442510 TTGCTGCAGCAGGAGGAGCAGGG - Exonic
1132761138 16:1509162-1509184 CTGAAGCACCAGGAGGAGCAGGG + Intronic
1133118170 16:3589979-3590001 GTGCTGCAGCAGGAGGATGAGGG - Exonic
1133398010 16:5464031-5464053 GTGATGGACCAGCAGGAGGAGGG + Intergenic
1133520126 16:6549124-6549146 GGGAGGAAGGAGGAGGAGGAGGG + Intronic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134212467 16:12289245-12289267 CCCATGCAGCAGGAGGAGAAGGG + Intronic
1135127694 16:19824748-19824770 AAGATGAACCAGGAAGAGGAAGG + Intronic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1136028389 16:27484958-27484980 CTGGTGCAGCTGGAGGAGGCAGG - Intronic
1136367417 16:29815142-29815164 ATGAGGAGGCAGGAAGAGGAAGG - Intronic
1136539100 16:30918720-30918742 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1137290916 16:47051350-47051372 ACGATGAAGGAGGATGAGGAAGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137593580 16:49708826-49708848 GTGCTGAAGCAGGAGGAGGCAGG - Intronic
1137805557 16:51301882-51301904 CTGAAGAAGCAGCAGAAAGAAGG - Intergenic
1138126166 16:54440471-54440493 AGGATGGAGGAGGAGGAGGAAGG - Intergenic
1138773026 16:59687513-59687535 ATGGTGGAGCAGGAGGAAGAGGG + Intergenic
1139320377 16:66109573-66109595 CTGATCTTGCAGGAGGAAGAGGG - Intergenic
1139643920 16:68313535-68313557 CTGAGGCAGGAGGAGAAGGAGGG - Intronic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139968277 16:70757655-70757677 CTGCTGAAGCAGAAGCAGGGAGG + Intronic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140507302 16:75481892-75481914 CTGGTAAAGCAGGAGGGCGATGG + Intronic
1140806005 16:78532949-78532971 CTGATGAAGCAAGAGTAGGAGGG + Intronic
1140996675 16:80266616-80266638 CTGATGCAACAGAAGGAAGAGGG + Intergenic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141252233 16:82369266-82369288 GTGATGGAGGAGGAGGAGCATGG - Intergenic
1141294175 16:82751393-82751415 GTGAGGAGGCAGGAGGAGGTGGG - Intronic
1141714019 16:85716650-85716672 CAGAGGGAGAAGGAGGAGGAAGG + Intronic
1141775724 16:86121618-86121640 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1142134158 16:88443989-88444011 CTGAAGCAGCAGGGGGAGGCAGG + Intergenic
1142274804 16:89112793-89112815 CAGATGAAGCAGGAGCAAGCGGG - Intronic
1203141729 16_KI270728v1_random:1771501-1771523 GGGATGATGGAGGAGGAGGAGGG - Intergenic
1203141786 16_KI270728v1_random:1771705-1771727 ATGATGGAGGAGGAGGAGGAGGG - Intergenic
1203141815 16_KI270728v1_random:1771813-1771835 GAGATGATGGAGGAGGAGGAGGG - Intergenic
1142624527 17:1183365-1183387 GTGATGAGGCAGGAGCAGGCAGG - Intronic
1142849128 17:2695855-2695877 CTGCGGGAGGAGGAGGAGGATGG + Intronic
1143036779 17:4004074-4004096 CTGCGGAACCCGGAGGAGGAAGG - Intergenic
1143091260 17:4450243-4450265 AGGAGGAAGGAGGAGGAGGAGGG - Intronic
1143365049 17:6401964-6401986 TGGCTGGAGCAGGAGGAGGAGGG + Intronic
1143692498 17:8581146-8581168 CAGATGGAGCAGGAAGGGGAGGG + Intronic
1143779661 17:9222577-9222599 CTGGTGAGGAAAGAGGAGGAGGG + Intronic
1143794699 17:9327250-9327272 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1144218925 17:13082627-13082649 CATATAAAGAAGGAGGAGGAGGG + Intergenic
1144579236 17:16448764-16448786 TTGAGGACACAGGAGGAGGAGGG + Intronic
1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG + Exonic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1144797614 17:17903016-17903038 CAGATGAGGCAGGTGGATGAAGG - Intronic
1144825185 17:18101785-18101807 CTGAGGCAGCAAGGGGAGGAAGG + Intronic
1145092264 17:19995716-19995738 AGGCTGAAGCAGGAGGAGAATGG - Intergenic
1145268062 17:21389987-21390009 GGAATGAGGCAGGAGGAGGAGGG - Intronic
1145278789 17:21453734-21453756 GTCAGGAAGCAGGAGGAGGTAGG - Intergenic
1145399065 17:22516752-22516774 GTTAGGAAGCAGGAGGAGGTAGG + Intergenic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146718607 17:35107015-35107037 CTGAAGCAGCTGGAGGAGGCGGG + Exonic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147498849 17:40942749-40942771 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1148097711 17:45064938-45064960 CTGAAGAAAGAGGAGGAGGGAGG - Intronic
1148192608 17:45690134-45690156 CTGAAGGGGAAGGAGGAGGAAGG + Intergenic
1148666953 17:49382186-49382208 CTGAGGAAGTTGGAGGAGAAAGG - Intronic
1148698775 17:49576139-49576161 CTGAAGGAGCAGGAAGGGGAAGG + Exonic
1149333098 17:55606727-55606749 CTGACGAAGGAAGAGGAGGGAGG - Intergenic
1149445356 17:56708921-56708943 CTGATAAAGAGGGAGGTGGAAGG + Intergenic
1149563777 17:57627738-57627760 AGGACGGAGCAGGAGGAGGAGGG - Intronic
1149567364 17:57649737-57649759 CTAATGGAACAGGAGGGGGATGG + Intronic
1149571477 17:57675321-57675343 GTGATGGAGCAGAAGGAGCATGG + Intronic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1150602016 17:66659367-66659389 CTGGTGGAGGAGGAGGAAGAAGG - Intronic
1150702273 17:67458183-67458205 AGGAGGAAGCAGGAGGAGGCAGG - Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1151174458 17:72275658-72275680 AGGATGAAGCAGGTGGAAGAGGG - Intergenic
1151718659 17:75843940-75843962 CTTCTGAAGCTGGAGGAGTAGGG + Intronic
1151726350 17:75887053-75887075 AGGCTGAGGCAGGAGGAGGAAGG + Intronic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152537886 17:80960952-80960974 CTGATGAAGCTGGAGGCACAAGG - Intronic
1152913131 17:83016781-83016803 GGGAGGAAGGAGGAGGAGGAGGG + Intronic
1153185255 18:2478918-2478940 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1153773817 18:8435669-8435691 CTGGTGAAACAGGAGGAGTTTGG - Intergenic
1154200445 18:12296225-12296247 ATGATGAGTCAGGAGGTGGATGG - Intergenic
1155406547 18:25494638-25494660 CTGATAAAGCAGCAGGTGGTAGG + Intergenic
1155529992 18:26757379-26757401 TTGTTGAACCAGGAAGAGGAAGG + Intergenic
1155724775 18:29067078-29067100 CTGGTAAAGCAGCATGAGGATGG - Intergenic
1156139710 18:34091735-34091757 CTGATGCAGGAGAAAGAGGACGG + Intronic
1156194661 18:34760552-34760574 CTAATGAAGCAGTCTGAGGAGGG + Intronic
1156592662 18:38509227-38509249 CTGACCAAGCAGGAGGATGGGGG + Intergenic
1156959744 18:43011208-43011230 GTGATCAAGGAGGAGCAGGAAGG + Intronic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1158070926 18:53469635-53469657 CTGATGATGCAGGAAAGGGAAGG - Intronic
1158886375 18:61830703-61830725 GGGATGAAGGAGGAGGAAGAAGG + Intronic
1159271240 18:66153814-66153836 AAGACGAAGAAGGAGGAGGAGGG + Intergenic
1159275264 18:66211132-66211154 CTGATTAATCAGAAGAAGGAGGG - Intergenic
1159409700 18:68055233-68055255 CTGGTGATGCTGGAGGGGGAAGG - Intergenic
1159580986 18:70234616-70234638 CCCATGAGACAGGAGGAGGAAGG + Intergenic
1159586655 18:70288980-70289002 CTCCTGGAGGAGGAGGAGGAAGG + Exonic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160622981 18:80183577-80183599 CTGATGAAGCAGGATGAAGTGGG - Intronic
1160818334 19:1046541-1046563 CTGCTGCAGCGGGAGGAGCAGGG + Intronic
1160950672 19:1665779-1665801 CTGATGGAGCAGGAGCTGGGGGG - Intergenic
1161266434 19:3366727-3366749 GTTTTGAAGCAGGAGGAGGCGGG + Intronic
1161509544 19:4662919-4662941 CTGGGGTAGGAGGAGGAGGAAGG - Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG + Intronic
1162188019 19:8922329-8922351 CTCATGAAGCAGGAGCAGAAGGG - Intronic
1162339212 19:10081755-10081777 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1162424168 19:10583982-10584004 CTGGTACAGCGGGAGGAGGAAGG - Exonic
1163263160 19:16203525-16203547 CTGATGGAGAAGGAGGAGGAGGG + Exonic
1163300495 19:16442691-16442713 CTCAGGTAGCTGGAGGAGGATGG - Intronic
1163377423 19:16942021-16942043 TGGCTGGAGCAGGAGGAGGAGGG - Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163518976 19:17780795-17780817 CTGAGGAAGCAGGAGAGGGAGGG + Intronic
1163929304 19:20373870-20373892 CAGATGTAGGAGGTGGAGGAGGG - Intergenic
1164769820 19:30799954-30799976 CTCGTGCAGCAGGAGGAGGAGGG - Intergenic
1165094492 19:33402866-33402888 CTGCTGAGGCAGGAGGATGGTGG + Intronic
1165098901 19:33426740-33426762 CTGAGGAAACAGGAGGAGCTGGG + Intronic
1165106007 19:33470034-33470056 CTGCTGAAGCAGCAGGAAGATGG - Intronic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1166356234 19:42229202-42229224 CTGATGGATAAGGGGGAGGATGG - Intergenic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167191288 19:47991750-47991772 GTGAAGAAGGAAGAGGAGGAGGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
1167588308 19:50387646-50387668 GTGCTGAAGCTGGAGGAGGAAGG - Intronic
1167733641 19:51277932-51277954 CTGAGTAAACAGGCGGAGGAAGG + Intergenic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
924998302 2:384140-384162 CTGATGCAGCAGGAGCCGGGTGG + Intergenic
925128897 2:1480789-1480811 CGGATGCAGCAGGAGGAAGGTGG - Intronic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925222518 2:2153518-2153540 CTGATGCGGGAAGAGGAGGAAGG + Intronic
925285871 2:2715457-2715479 CAGATGCTGAAGGAGGAGGATGG - Intergenic
925370794 2:3343963-3343985 GCGCTGAGGCAGGAGGAGGATGG + Intronic
925541425 2:4971889-4971911 CTCGTGAACCAGGAGAAGGAAGG - Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
925881242 2:8354529-8354551 CTGATGGTGAAGGACGAGGAGGG - Intergenic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
926173709 2:10570278-10570300 ATGGTGAGACAGGAGGAGGAAGG + Intergenic
926383555 2:12314585-12314607 GAGATGCAGCAGCAGGAGGAGGG - Intergenic
927235592 2:20871590-20871612 CTGATGAAGAAGGAGAAAGAAGG + Intergenic
928090937 2:28374746-28374768 CTGGTGCAGCACGAGGCGGAGGG + Intergenic
928099432 2:28427317-28427339 CTGAGGAAGGAGGAGGAGAAGGG - Intergenic
928118176 2:28563110-28563132 CTGATGCAGAAGGGGCAGGAGGG + Intronic
928266138 2:29813423-29813445 TGGATGGAGGAGGAGGAGGAGGG + Intronic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929576964 2:43058006-43058028 CTCAGGAAGCAGGAGGGGGCTGG - Intergenic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
930774756 2:55160908-55160930 CTGATGCTGGATGAGGAGGAAGG - Intergenic
931778028 2:65556677-65556699 TTGCGGAAGCAGGAGGTGGATGG + Intergenic
931991785 2:67797475-67797497 CTGATGCAGCAGGAGGGGGTGGG + Intergenic
932208156 2:69902268-69902290 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
932208162 2:69902288-69902310 AGGAGGAAGAAGGAGGAGGAAGG - Intronic
932449437 2:71800191-71800213 CTGATGTAACAAGAGGAGGCAGG + Intergenic
932570048 2:72933826-72933848 CGGCAGAAGCTGGAGGAGGAAGG + Exonic
934128564 2:88922830-88922852 ATGAAGAAAAAGGAGGAGGACGG + Intergenic
934161657 2:89255241-89255263 CAGCTGAAGCAGGATGAGCAGGG + Intergenic
934205627 2:89927174-89927196 CAGCTGAAGCAGGATGAGCAGGG - Intergenic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935639896 2:105280649-105280671 CGGGTGAAGGAGGAGGAGGTGGG + Exonic
936061956 2:109300680-109300702 GTGGTGAAGGAGGAAGAGGAAGG - Intronic
936418596 2:112343183-112343205 CTGAGGAATGAGGTGGAGGATGG + Intergenic
937844011 2:126557439-126557461 AAGCTGAAGCAGGAGAAGGAGGG - Intergenic
938031555 2:127998909-127998931 CTGATGACGCAGGCAGAGGAAGG + Intronic
938239605 2:129733203-129733225 TTGGTGAGGCTGGAGGAGGAGGG - Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938396176 2:130950102-130950124 CAGCTGAAGGAGGATGAGGAAGG + Intronic
939169269 2:138675003-138675025 CCCATGAAACAGGAGAAGGAAGG - Intronic
940013139 2:149075967-149075989 CTGATGAGGCAGGAGGCTGACGG + Intronic
940066413 2:149634737-149634759 AGGATTAAGCGGGAGGAGGAGGG - Intergenic
940106917 2:150111477-150111499 ATGATGGAGTGGGAGGAGGAAGG - Intergenic
940826591 2:158419438-158419460 CTCATGAAGAAGTAGTAGGAAGG + Intronic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942210424 2:173664232-173664254 TTGAAGAAGGCGGAGGAGGAGGG - Intergenic
942253029 2:174063876-174063898 CTGATGAAGCAAGAGGGAGAGGG - Intergenic
942430904 2:175910417-175910439 TAGATGGACCAGGAGGAGGAGGG - Intergenic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942966503 2:181900142-181900164 CTCAGGAAGTAGGAGGAGTAAGG - Intronic
942985402 2:182134740-182134762 ATGATGAAGGAGGAGGAGAAAGG + Intergenic
943445295 2:187977870-187977892 CTGGTGTTGCAGGAGGAGGAAGG + Intergenic
944191637 2:197010044-197010066 AGGATGGAGGAGGAGGAGGAAGG + Intronic
945478768 2:210319616-210319638 CTTATGAAGAAGGAGGAGTTAGG + Intergenic
945703617 2:213201648-213201670 CCTATAAAGAAGGAGGAGGAGGG - Intergenic
945772208 2:214058198-214058220 ATGATTAAGCTGGAGGAGGAAGG - Intronic
946396295 2:219445319-219445341 GTGATGGCTCAGGAGGAGGAGGG - Intronic
946496696 2:220202633-220202655 CAGATGAACCATGAGGAGCATGG - Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
947347534 2:229208775-229208797 CGGAGGAGGCAGGAGGAGAAAGG + Intronic
947542808 2:230990444-230990466 CTCTGGAAGCAGGATGAGGACGG + Intergenic
947709008 2:232299539-232299561 CCTCTGAATCAGGAGGAGGAGGG - Intronic
947722314 2:232377732-232377754 AAGATGAAGCAGGAGGTAGAAGG + Intergenic
947726211 2:232402536-232402558 AAGATGAAGCAGGAGGTAGAGGG + Intergenic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
947845205 2:233238146-233238168 TTTATGAGGCAGGAGAAGGAAGG + Intronic
947852957 2:233303396-233303418 ACGATGAAGCAGCAGGAGAATGG + Intergenic
948883582 2:240872283-240872305 GTGAACATGCAGGAGGAGGAGGG + Intronic
948883607 2:240872440-240872462 GTGAACATGCAGGAGGAGGAGGG + Intronic
1168769652 20:407474-407496 CTGATGGAGCTGGAGCGGGATGG + Intergenic
1169211672 20:3769155-3769177 CGGAGGAGGCAGGAGGGGGAAGG - Intergenic
1170910292 20:20559711-20559733 ATGAGGAAATAGGAGGAGGAGGG + Intronic
1170994685 20:21341253-21341275 CTGAGGCAAGAGGAGGAGGATGG + Intronic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171327266 20:24305569-24305591 GGGTTGAAGGAGGAGGAGGAAGG + Intergenic
1171504506 20:25623035-25623057 CTGATGAAGCATGAAGAGGACGG + Intronic
1172781424 20:37438934-37438956 CAGATGAAGCAGGACGGGAAAGG - Intergenic
1173093553 20:40001246-40001268 CTGATGAAGTAGGTGTAGGGTGG - Intergenic
1173137587 20:40453048-40453070 CTGAAGGATCAAGAGGAGGAGGG - Intergenic
1173375446 20:42478391-42478413 CTGATGTAGAAAGAGGAGCAGGG - Intronic
1173410126 20:42802733-42802755 CTGATCATGCAGGAGAAGGGAGG - Intronic
1173620163 20:44430338-44430360 CTGAAGAAGGAGGATGAGGTTGG - Exonic
1174099398 20:48115642-48115664 TTTGTGAAGCCGGAGGAGGAGGG - Intergenic
1174372615 20:50102850-50102872 CTGGTGTAGCTGGAGGAGGATGG - Intronic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1175452092 20:59077925-59077947 GGGAAGAAGGAGGAGGAGGATGG + Intergenic
1175942949 20:62546293-62546315 CGGGTGCAGGAGGAGGAGGATGG + Intergenic
1176020248 20:62959008-62959030 CTGCAGGAGCTGGAGGAGGAGGG + Intronic
1176034140 20:63028206-63028228 CTGATGAAGCTGCAGAAAGAAGG - Intergenic
1176233775 20:64044905-64044927 CTGACTCAGCAGGAGGAGGGTGG + Intronic
1177274847 21:18896703-18896725 CTTATGAAGGAAGAGAAGGAAGG + Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1178202526 21:30423647-30423669 ATGATGGAGGAGAAGGAGGAGGG + Intronic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1178820036 21:35966668-35966690 CTGGGGAAGCAGGAGTATGAGGG + Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179238978 21:39572271-39572293 CTGATGAAGCGGGTGGAGTGGGG - Intronic
1179512702 21:41884471-41884493 CTGATGCTCCAGGAGGAGGCTGG - Intergenic
1179784328 21:43720871-43720893 CCAATGAAGTAGGAGGTGGATGG - Intronic
1180792506 22:18583697-18583719 CTGATTAGGGTGGAGGAGGAGGG - Intergenic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1181046104 22:20215046-20215068 CTGATGAGGCAGGTGGATGGTGG + Intergenic
1181142247 22:20814638-20814660 CTCAGGAAGCTGGAGCAGGAGGG + Intronic
1181229231 22:21411618-21411640 CTGATTAGGGTGGAGGAGGAGGG + Intergenic
1181249420 22:21523245-21523267 CTGATTAGGGTGGAGGAGGAGGG - Intergenic
1181554121 22:23657838-23657860 GAAATGGAGCAGGAGGAGGAGGG - Intergenic
1181860334 22:25813133-25813155 AGGAAGAAGGAGGAGGAGGAGGG - Intronic
1182041024 22:27239234-27239256 CAGCTGCAGCTGGAGGAGGAAGG + Intergenic
1182419349 22:30241392-30241414 CGGATGAAGCAGGAAGGAGAAGG + Exonic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1183179718 22:36251990-36252012 CTTATGAGGCAGGAAGAGAATGG - Intergenic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183866738 22:40710288-40710310 CTTAAGAAGCAGTAGTAGGACGG - Intergenic
1184291899 22:43501825-43501847 AAGATGAGGGAGGAGGAGGAGGG - Intronic
1184651313 22:45920603-45920625 CTGTTGAAGCAGGAGGAGCCTGG + Exonic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185167888 22:49272893-49272915 CCCATGCAGCAGAAGGAGGAGGG + Intergenic
949142539 3:652316-652338 AGGATGAGGCAGTAGGAGGAAGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949465387 3:4338161-4338183 AAGGTGAAGCAGGCGGAGGATGG + Intronic
949533615 3:4979206-4979228 GTGATGAAGCCGGGGGAGGGCGG + Exonic
949766741 3:7535256-7535278 CTGACGCAACTGGAGGAGGATGG + Intronic
951376539 3:21924900-21924922 CTACTGTAGCAGGAGAAGGAGGG - Intronic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951964993 3:28372048-28372070 AGGAGGAAGAAGGAGGAGGAGGG - Intronic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
952968701 3:38637196-38637218 CTGATGAACCTGGGGCAGGATGG - Intronic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953510863 3:43537540-43537562 TGGATGGAGCAGGAGGTGGAAGG - Intronic
953563583 3:44013055-44013077 TTGGTGACGGAGGAGGAGGAAGG + Intergenic
953621673 3:44538121-44538143 ATGAAGAAGCATGAGGAGGGAGG + Intergenic
953693105 3:45136378-45136400 CTAAGGAAGAAGGAGGAGGATGG + Intronic
953928877 3:46996271-46996293 CCGATACAGCAGGAGGAGAAAGG - Exonic
953980181 3:47409707-47409729 CTGATGAAGAAGTCGCAGGAGGG + Exonic
954418651 3:50406932-50406954 CTGATGATGCTGGAGGGTGATGG - Intronic
954594743 3:51814708-51814730 CTGCTTTAGGAGGAGGAGGAGGG - Intergenic
954876456 3:53805930-53805952 AAGATGAGGGAGGAGGAGGAGGG - Intronic
955008615 3:54992948-54992970 TGGCTGAAGCAGGAGGAAGAGGG + Intronic
955701969 3:61690618-61690640 GTGATGACGGAGAAGGAGGATGG - Intronic
955733770 3:62015303-62015325 CTGCTGAAACAGCAGGAGAAAGG + Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
957766597 3:84633312-84633334 TTGATGAATCAGGAGAAAGAGGG - Intergenic
958824813 3:99017527-99017549 ATCATCAAGCAGGATGAGGAGGG - Intergenic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959510191 3:107202110-107202132 ATGATGAAACAGGAGCAGGGAGG + Intergenic
959906952 3:111720973-111720995 ATGATGAAGTAAGAGGAAGATGG + Intronic
959963810 3:112332213-112332235 AAGACGAAGGAGGAGGAGGAGGG + Intergenic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
960726029 3:120671084-120671106 CTGAAGAAACTGGAGGACGAAGG - Intronic
960953189 3:123012759-123012781 AGGATGAAGGAGGAAGAGGAGGG - Intronic
961077702 3:123997260-123997282 CAGAGGTAGCAGGAAGAGGAGGG - Intergenic
961306865 3:125964022-125964044 CAGAGGTAGCAGGAAGAGGAGGG + Intergenic
961428561 3:126864348-126864370 GTGGTGATGAAGGAGGAGGAGGG - Intronic
961509431 3:127391951-127391973 CTGATGCAGGAGGAGCTGGAGGG + Intergenic
961761227 3:129169580-129169602 CCAATAAAGCTGGAGGAGGAAGG - Intronic
961911467 3:130321245-130321267 TTGATGAAGCAGGAGAGGGGAGG + Intergenic
962051558 3:131821095-131821117 CTGAAGGAGGAGGAGGAGGTTGG + Intronic
962444099 3:135449589-135449611 AGGATGGAGGAGGAGGAGGAGGG - Intergenic
962592722 3:136907134-136907156 CTGCTGCAGCAGCAGGAGCAAGG - Intronic
962886062 3:139628953-139628975 CTAATGGAGCAGGAGGAGAAAGG + Intronic
962888302 3:139648443-139648465 CTCCTGAAGCAGGAGGCTGAAGG + Intronic
963299598 3:143583973-143583995 GTAATGAAGAAGAAGGAGGAGGG + Intronic
963327355 3:143877153-143877175 CTCAAGATGGAGGAGGAGGAGGG - Intergenic
963676855 3:148322883-148322905 ATGATGAAGAAGGAGAAAGAAGG + Intergenic
963796476 3:149635603-149635625 CGGAAGAGGGAGGAGGAGGAAGG + Intronic
963850718 3:150207910-150207932 CTTAAGAAGCGGGGGGAGGAAGG + Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
965690053 3:171346148-171346170 CAGATGAAACAGCAGGAAGAAGG + Intronic
966140483 3:176751642-176751664 CTGATGGAGAAAGAGAAGGAGGG + Intergenic
966141121 3:176757393-176757415 CTGGTGAAGCCGGAGTAGAATGG + Intergenic
966981357 3:185139138-185139160 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
967079667 3:186037825-186037847 CTGATGAAAGAGAAGGAGGTGGG - Intergenic
967099734 3:186206592-186206614 CTGATTAAGCAGGTGGGGGGTGG - Intronic
967165175 3:186773602-186773624 AAGATGGAGAAGGAGGAGGAAGG + Intergenic
967349031 3:188491267-188491289 GTGATAAAGGAGGAGGAGGCTGG + Intronic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968056812 3:195697990-195698012 CCAATGAAGTGGGAGGAGGAAGG - Intergenic
968091013 3:195898196-195898218 CTGGTGGAGAAGGTGGAGGACGG - Intronic
968161611 3:196431962-196431984 ATGATGAAGGAGGAGGAGGAGGG + Intronic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
969099610 4:4759008-4759030 GTGAAGAAGCTGGAGGAGGTTGG + Intergenic
969512203 4:7624899-7624921 GTGATCATGGAGGAGGAGGACGG + Intronic
970276016 4:14402155-14402177 CTGCTGAAGCAGAAGGAAAAGGG + Intergenic
970547726 4:17146847-17146869 CTAATGACCCAGGAAGAGGAAGG + Intergenic
970737250 4:19187576-19187598 ATGATGAAGATGGATGAGGATGG + Intergenic
971380787 4:26095654-26095676 AGGAAGAAGAAGGAGGAGGAAGG + Intergenic
971881169 4:32375261-32375283 AAGATGAAGAAGGGGGAGGAGGG - Intergenic
972144852 4:36010605-36010627 CTGATGAGGGAGCAGCAGGATGG - Intronic
972360615 4:38322715-38322737 CTGATGAAGGAGGGAGAGGGAGG - Intergenic
972458731 4:39279514-39279536 CTGAGGCAGGAGGAGGAGGCTGG - Intronic
972541575 4:40043701-40043723 CGGCAGGAGCAGGAGGAGGAGGG - Intergenic
972629653 4:40832449-40832471 GTGAGGAAGCAGGAGTAGGTTGG - Intronic
973197170 4:47458713-47458735 CTGAAGAAGCATGAGAATGAAGG + Intronic
973233337 4:47867638-47867660 AAGATGGAGGAGGAGGAGGAGGG + Intronic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
973628467 4:52795712-52795734 AAGCTGAAGCAGGAGAAGGAAGG + Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
976343179 4:83967307-83967329 CTGATGAAGCAGCAGGAGAAGGG - Intergenic
976703385 4:87995510-87995532 ATCAAGAAACAGGAGGAGGAGGG + Intergenic
976717699 4:88140297-88140319 CTGATAAAGCAGGAAAAGGATGG + Intronic
977183128 4:93902597-93902619 TGGCTGAAGCAGGAGGAAGAGGG - Intergenic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978690862 4:111507607-111507629 CTGATGACCCAGAAGTAGGAGGG + Intergenic
978827997 4:113047775-113047797 CTGCTGAAACAGGAGGAGGGTGG + Intronic
979069775 4:116187235-116187257 CTGATGAAGCAGAAAGAGATAGG - Intergenic
980171849 4:129298734-129298756 CTGTTGGAGCATGAGGAAGATGG + Intergenic
980279477 4:130700891-130700913 TTGATGAAGCAGGAAGAAAACGG + Intergenic
980681717 4:136171248-136171270 CTTTTGAAGTAGGAGGAGAAAGG - Intergenic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981341585 4:143627950-143627972 CAGATTAAGCAGGAGGAATAGGG - Intronic
981938524 4:150257987-150258009 CTTATGAAGCAGCAGCAGGAAGG + Intergenic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
983139340 4:164129212-164129234 ATGATTAAGAAGGAGGAAGAAGG + Intronic
983599202 4:169505316-169505338 CTGAGGAAGGAGGAGTAAGAGGG - Intronic
983637325 4:169911075-169911097 CTGATGGAGGAAAAGGAGGATGG - Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
984386622 4:179067907-179067929 TTGATGAAGCAGGACCTGGAAGG + Intergenic
984769605 4:183425945-183425967 CTGAGGACACAGGAGGGGGAGGG - Intergenic
985026414 4:185743709-185743731 CATCTGAATCAGGAGGAGGAGGG - Intronic
985031391 4:185794257-185794279 GAGATGGAGAAGGAGGAGGAGGG + Intronic
985619245 5:945191-945213 CAGAGGAGGCAGGAGGAGCATGG - Intergenic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
986131686 5:4937873-4937895 CTGAAGGAGCAGGTGGAGCATGG - Intergenic
986445992 5:7821813-7821835 CTGATGGAGCAGAAGGGGAAGGG + Intronic
986634597 5:9808904-9808926 CCCATGGAGCAGGAGGAGCAGGG + Intergenic
986806535 5:11313228-11313250 CTGCTCAGGGAGGAGGAGGAGGG - Intronic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
987255329 5:16144524-16144546 CTGATGAAGAGGGAGGGTGATGG - Intronic
987720826 5:21630114-21630136 CTGATACAGCAGGAAGAGAAAGG + Intergenic
988100472 5:26669864-26669886 CTGCTGCCGCATGAGGAGGAAGG + Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988698665 5:33650082-33650104 CTGATGAAAAGGGAGAAGGAAGG - Intronic
989025596 5:37063818-37063840 CTGATGAAGAAGAAGAAGAAGGG + Exonic
989075342 5:37559424-37559446 GAGATGAAGGAGGAGGAGAATGG - Intronic
989466004 5:41756697-41756719 CTGCTGAAGAAGGGGGAGAAAGG + Intronic
990196236 5:53319611-53319633 TTCCTGAAGGAGGAGGAGGATGG - Intergenic
990470613 5:56111857-56111879 CTGATGAAGCATGTGGAATAGGG - Intronic
990494942 5:56338023-56338045 GAGAAGGAGCAGGAGGAGGAGGG - Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990616713 5:57516203-57516225 AGGAGGAAGCAGGAGGCGGAAGG + Intergenic
990774935 5:59295761-59295783 CTGAGGTAGGAGGAGGAGAATGG - Intronic
990866101 5:60381673-60381695 CCGAGGAAGCAAGTGGAGGATGG + Intronic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991117198 5:62968435-62968457 CTGATGATGCAGGTGGAGGGAGG - Intergenic
991196279 5:63936335-63936357 TAAATGAAGAAGGAGGAGGAGGG + Intergenic
991594699 5:68290553-68290575 CTGATGAAGCAGGAGTGGTCTGG + Intronic
992233572 5:74685726-74685748 CTTAAGAAGCAGTAGGAGGGTGG - Intronic
993452878 5:88094376-88094398 ATCATGAGACAGGAGGAGGATGG - Intergenic
993554961 5:89325253-89325275 CTGATAAAGGAGGAAGTGGAAGG - Intergenic
993727788 5:91388366-91388388 CTACTGGAGCAGGAGTAGGAAGG - Intergenic
993761626 5:91802823-91802845 CTGATGAAGAGTGAGGAGGGAGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
995069668 5:107904925-107904947 GGGGTGAAGCAGGAGGAGGAGGG + Intronic
995897301 5:117029832-117029854 CAGCTGAAGGAAGAGGAGGAAGG - Intergenic
996342889 5:122457629-122457651 CTAAGGAAGCATGAGGAGGCAGG - Intronic
996440600 5:123486011-123486033 CAGATGTAAGAGGAGGAGGAGGG - Intergenic
997735019 5:136206800-136206822 CTGAGGCTGCAGGAAGAGGATGG - Intergenic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
997823890 5:137089425-137089447 CTGGTGTGGGAGGAGGAGGAGGG - Intronic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998402965 5:141857557-141857579 CTGTTGAAGCCTGAGTAGGATGG - Intronic
998874289 5:146583797-146583819 CTGAGGAAGCTGGAGTAGAAGGG - Intronic
999269496 5:150288608-150288630 CTGCTGAGGCAGCAGGAGCACGG - Intronic
999353209 5:150897610-150897632 CTGATGAGGCTGAAGGAGGAGGG - Intronic
999495126 5:152089318-152089340 CTGATGAAGAATTAGGAGGCTGG - Intergenic
1000003632 5:157163473-157163495 CTGCTGAAGGAGGAGCAGCAAGG - Exonic
1000245077 5:159442381-159442403 CTGAGAGCGCAGGAGGAGGAAGG - Intergenic
1000614888 5:163415769-163415791 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1001132907 5:169079549-169079571 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002338671 5:178499447-178499469 CTGATGGAGATGTAGGAGGAGGG - Intronic
1002447036 5:179296102-179296124 ATGGTGAAGCAGGAGGATGGGGG + Intronic
1002466591 5:179411838-179411860 CTGGCGGAGCAGGAGGAGGCTGG - Intergenic
1002983642 6:2166867-2166889 CTGATGAGGAAGGAGTGGGATGG - Intronic
1003817626 6:9859942-9859964 ATGAAGAAGGAGGAGGAGAAGGG + Intronic
1004007801 6:11652833-11652855 CACATCATGCAGGAGGAGGATGG + Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1005938368 6:30542301-30542323 GTGATGAAGCTAGGGGAGGAAGG - Exonic
1006287181 6:33105542-33105564 GTCATTAAGCAGGGGGAGGATGG + Intergenic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006510634 6:34519318-34519340 TTGAGGAGGAAGGAGGAGGATGG - Intronic
1006590317 6:35150443-35150465 CTGATGAAGTACAAAGAGGAGGG - Intergenic
1006794448 6:36722677-36722699 CTGGTGCAGCAGGTGCAGGAAGG - Exonic
1007068660 6:39018625-39018647 CAGATGACTCAGGAGGAAGATGG - Intronic
1007077183 6:39075280-39075302 CTGCTAGAGCAGGAGGAGGGAGG + Intronic
1007287109 6:40755567-40755589 CAGGTGAAGGGGGAGGAGGAGGG - Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007714513 6:43848023-43848045 AGAATGAAGAAGGAGGAGGAAGG + Intergenic
1007813979 6:44507075-44507097 ATGATGATGGAGGAAGAGGAGGG + Intergenic
1007870683 6:45034145-45034167 CTGTTGGAGGAGGAGGAGGTAGG - Intronic
1008014235 6:46500539-46500561 TTGAAGAAGTAGGAGGAGGCTGG - Intergenic
1008117605 6:47570284-47570306 TTAATGAAGAAGGAGGAGGGAGG + Intronic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1010806587 6:80244191-80244213 CTGGTGAAGCAGGAGATGGAAGG + Intronic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012896311 6:104953657-104953679 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1013021347 6:106223339-106223361 CCAATAAAGCTGGAGGAGGAAGG + Intronic
1013101062 6:106987142-106987164 TTGAGGGAGGAGGAGGAGGAGGG + Intergenic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013355101 6:109339567-109339589 CTGGTGCTGCAGGAGAAGGATGG + Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014078643 6:117265098-117265120 CTGATGATGTATGGGGAGGACGG - Intergenic
1014258116 6:119184572-119184594 CTGAGGAGGCAGGAGTAGGAAGG + Intronic
1014336703 6:120146830-120146852 CTGCAGGAGCAGGAGCAGGAGGG - Intergenic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG + Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016802814 6:148183670-148183692 CAGACACAGCAGGAGGAGGACGG + Intergenic
1016805494 6:148208063-148208085 ATGAGGAAGCAGGAAGAGGTGGG - Intergenic
1018038085 6:159898684-159898706 AGGATGAAGGAGGAGGAAGAGGG - Intergenic
1018219726 6:161565987-161566009 CTGATGATGCAGAAGGGGGAAGG - Intronic
1018258276 6:161943972-161943994 CTGAGGAAGCAGCCTGAGGAAGG + Intronic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018694331 6:166379731-166379753 CTGATGAAGTAAAAAGAGGAAGG + Intronic
1019049293 6:169170755-169170777 CTGAAGATGCATGAGGATGAGGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019339997 7:504460-504482 CTGCTGAGGCAGGAGGGGGCTGG - Intronic
1019372663 7:671087-671109 CTGAGGAAGAAGGAGGTGGACGG - Intronic
1019464175 7:1177506-1177528 CTCAGGAAGCAGAAGCAGGAGGG - Intergenic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1020279353 7:6642563-6642585 GTGGTGGAGGAGGAGGAGGAGGG + Exonic
1021020804 7:15596206-15596228 CTGATGCAGCTGAAGGAGCAAGG - Intergenic
1021488785 7:21196218-21196240 CTGGTGAAGCAGCAGGAAGATGG - Intergenic
1021587365 7:22223581-22223603 TTGATGATGCAGGAGGGAGAAGG + Intronic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021805204 7:24348661-24348683 CTGATGAGGCATGATGTGGAAGG + Intergenic
1021824552 7:24535913-24535935 GAGATGAAGGAGGAAGAGGAAGG - Intergenic
1021928281 7:25554116-25554138 CTAATGAGTCAAGAGGAGGATGG - Intergenic
1021932830 7:25598659-25598681 CTGCTGAAGAAAGAGGATGAAGG + Intergenic
1022498732 7:30869295-30869317 CTGATAGAGGAGGAGAAGGATGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022793892 7:33716667-33716689 ATGATGATGAAGGAGAAGGAGGG - Intergenic
1022877793 7:34552882-34552904 GTGATGCAGCAGGGGGAGGGAGG - Intergenic
1022902516 7:34825029-34825051 CTCAGGAGGCAGGAGGTGGAGGG - Intronic
1023126374 7:36958463-36958485 CTGATGAAAAATGAGGAGGGAGG - Intronic
1023224605 7:37956105-37956127 GTGAAGAAGAAGGAGCAGGAAGG + Intronic
1023626675 7:42121720-42121742 CTGATGGAGGGGGAGGAGGTGGG - Intronic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023758780 7:43444679-43444701 GAGAAGGAGCAGGAGGAGGAGGG + Exonic
1023879318 7:44309391-44309413 CTGAGCCAGCAGGAGCAGGAGGG + Intronic
1024118322 7:46213353-46213375 CTCAGGAAGCAGAAGGAGCAGGG + Intergenic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024229528 7:47353749-47353771 CTGAGGAGGGTGGAGGAGGAGGG - Intronic
1024525387 7:50344154-50344176 CAGATGAAGAAAGAGGAGGTAGG - Intronic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1025014514 7:55428073-55428095 CAGCTGAAGCGGCAGGAGGAAGG + Intronic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1025887763 7:65614474-65614496 GAGATGGAGGAGGAGGAGGAAGG - Intergenic
1026326181 7:69312773-69312795 ATAATGAAACAAGAGGAGGATGG - Intergenic
1026917452 7:74129504-74129526 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1027299723 7:76819111-76819133 CTGTTGTAGCAGGAAGAGGTGGG - Intergenic
1027448615 7:78303407-78303429 CAGATGATTCAGGAGGAGGAGGG - Intronic
1027814704 7:82953695-82953717 GTGGTGGAGGAGGAGGAGGAGGG + Exonic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1030583071 7:111384152-111384174 ATGAAGAAGAAGGAGGAGAAAGG + Intronic
1030658088 7:112190446-112190468 GTAAAGAAGCAGGAGGTGGATGG + Intronic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031780785 7:125961461-125961483 CTGATGGAACAGCAGGAGGAGGG - Intergenic
1031923661 7:127619358-127619380 CTGAGGATGCTGGAGGAGGGTGG - Intergenic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1031994561 7:128221050-128221072 CTCACAAAGAAGGAGGAGGAGGG - Intergenic
1032473074 7:132192394-132192416 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1032474235 7:132201552-132201574 ATTATGAAGCAGCAGGAAGAGGG - Intronic
1032504551 7:132425513-132425535 CTGATGAGGGAGGGTGAGGAAGG - Intronic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033124787 7:138698127-138698149 GGAATGAAGCAAGAGGAGGAAGG + Intronic
1033195228 7:139321782-139321804 CTGGGGAAGCAGGGGAAGGAAGG - Intergenic
1033277543 7:139984043-139984065 GTGATGAAGTAGGATGAAGATGG + Intronic
1033790364 7:144785799-144785821 CTGATGAAGCAGGAGCCATAAGG + Intronic
1033807488 7:144971378-144971400 GTGGTGATGGAGGAGGAGGATGG + Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034406054 7:150903127-150903149 GTGAAGGAGAAGGAGGAGGAGGG - Intergenic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035674338 8:1444599-1444621 ATGATGGAGAAGGAGGTGGAGGG - Intergenic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1036110128 8:5889761-5889783 GTGATGATGCAGGGAGAGGATGG - Intergenic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1036645605 8:10610000-10610022 TTGAAGAAACAGGAGGAGAAGGG - Exonic
1036726372 8:11224451-11224473 TGGCTGAAGCAGGAGGAAGAGGG + Intergenic
1037294180 8:17383308-17383330 CAGAGGGAGCAAGAGGAGGAAGG + Intronic
1037579837 8:20238629-20238651 CTCAGGAAGCAGGGGGAGGCAGG + Intergenic
1037927547 8:22855938-22855960 AGGCTGAGGCAGGAGGAGGATGG + Intronic
1037935679 8:22913581-22913603 CTGAGGGAAGAGGAGGAGGAAGG - Intronic
1038067116 8:23974750-23974772 AGGATGGGGCAGGAGGAGGAAGG + Intergenic
1038238385 8:25784452-25784474 GTGGTGATGGAGGAGGAGGAAGG - Intergenic
1038284965 8:26198493-26198515 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1038463167 8:27733858-27733880 CAGATGCAGCAGCGGGAGGAAGG + Exonic
1038644314 8:29350205-29350227 CTGATGAACCGGGACGAGAATGG - Exonic
1038837851 8:31148250-31148272 GTCATTAAGAAGGAGGAGGAAGG - Intronic
1039347047 8:36716668-36716690 GTGATTCAGGAGGAGGAGGAAGG - Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1040079780 8:43274941-43274963 AGGATGAGGGAGGAGGAGGAGGG - Intergenic
1040443900 8:47473804-47473826 GTGAGGAACCAGGAGGAGGATGG + Intronic
1040568996 8:48591701-48591723 CTGATGAAGCAGGTGGACCTGGG - Intergenic
1040589251 8:48774236-48774258 CAGCTGAAGCAGGAGGAAGCAGG - Intergenic
1041291175 8:56310146-56310168 AGGAGGAAGGAGGAGGAGGAGGG + Intronic
1041291185 8:56310178-56310200 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041291224 8:56310303-56310325 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041719821 8:60965616-60965638 ATGATGAAACAGGAGGATGCAGG + Intergenic
1041739741 8:61145563-61145585 CTGATGCAGCAGGAGGGGGAAGG - Intronic
1041992167 8:64006305-64006327 ATGATGTGGCAGGAGGAGAAAGG - Intergenic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1044413369 8:91909746-91909768 CTGCTGGAAGAGGAGGAGGAAGG + Intergenic
1044431368 8:92111622-92111644 CTGCTGAAGAAGGATGAGAAGGG - Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1045302110 8:100920702-100920724 AAGCTGAAGCAGGAGAAGGAGGG - Exonic
1045951461 8:107856029-107856051 CAGATGAAGAAGCTGGAGGATGG + Intergenic
1046096689 8:109570953-109570975 CTAAAGAAGCAGGAGAGGGAGGG + Intergenic
1046710250 8:117503293-117503315 AGGAAGAAGAAGGAGGAGGAGGG + Intergenic
1047112938 8:121811116-121811138 AAGATGAAGGAAGAGGAGGAGGG + Intergenic
1047361766 8:124175648-124175670 CTGATGGGGAAGGAAGAGGAGGG - Intergenic
1047432552 8:124805412-124805434 CAGAGGAAGCAGGAGAGGGAAGG + Intergenic
1048158352 8:131985834-131985856 GTAATGCAGCAGGTGGAGGATGG + Intronic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048889632 8:138936053-138936075 CTGAGGAAGGATGTGGAGGAGGG + Intergenic
1049021914 8:139962900-139962922 CTCAGGAAGCCGGAGGAGCAAGG + Intronic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049353803 8:142177925-142177947 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1049508559 8:143016464-143016486 CTCAGAAAGCAGGAGGAGGAGGG + Intergenic
1049654779 8:143792707-143792729 CGGAAGATGCAGGAGGAGGAAGG - Exonic
1049932522 9:470558-470580 GAAAGGAAGCAGGAGGAGGAGGG + Intronic
1050275398 9:3992453-3992475 CTGTTTATGCATGAGGAGGAAGG - Intronic
1050282165 9:4061863-4061885 CTGATAAACCAGGAGGAGCACGG - Intronic
1050616126 9:7403423-7403445 ATGATGAAGATGAAGGAGGATGG - Intergenic
1050845056 9:10205693-10205715 CTGATGAAGCAGGCCGGGCATGG - Intronic
1051178578 9:14386223-14386245 CTTATGAGTCAGGAGTAGGAGGG - Intronic
1051764993 9:20513738-20513760 CTGAGGAACCGGGAGGAGGCAGG + Intronic
1051912134 9:22165154-22165176 TTGTTAAAGCAGGAGGAGGGAGG + Intergenic
1052685756 9:31753523-31753545 CTCAAGAAGAAGGAGGGGGAGGG - Intergenic
1053046344 9:34922193-34922215 AAGCTGAAGCAGGAGAAGGAGGG - Intergenic
1053144505 9:35703379-35703401 CTGAGAAGGCTGGAGGAGGATGG + Intronic
1053186563 9:36021509-36021531 CTGATGGGGAATGAGGAGGAGGG + Intergenic
1055080274 9:72261824-72261846 AGGAGGAAGAAGGAGGAGGAGGG - Intergenic
1055648069 9:78379435-78379457 CTGCTGAAGCAGGGGGTGGTAGG + Intergenic
1055688688 9:78806900-78806922 AAGATGAAGCAGGAGTAAGAAGG + Intergenic
1056126279 9:83538573-83538595 CAGCTGAAGGAGGAGGCGGAGGG + Intergenic
1056835390 9:89951096-89951118 CTGAGGATGCAGGACCAGGAAGG + Intergenic
1056934679 9:90907134-90907156 CTGATGAACCCGGAGGTGTAAGG + Intergenic
1056950372 9:91036578-91036600 GTGATGGGGCAGGAGGAGGAGGG - Intergenic
1057181560 9:93033410-93033432 GAGAAGGAGCAGGAGGAGGAGGG - Intronic
1057182416 9:93037268-93037290 CTACTGAAGCAGGCAGAGGACGG - Intergenic
1057389092 9:94628012-94628034 CTGATCATGCAGGGGCAGGAAGG + Intronic
1057925106 9:99139476-99139498 CTGTTGAAGCTGGACGATGAGGG - Intronic
1058567718 9:106304337-106304359 CAGATGCAGCATAAGGAGGAAGG + Intergenic
1058579687 9:106441415-106441437 GAGAGGAAGTAGGAGGAGGAAGG + Intergenic
1058788518 9:108416809-108416831 GTGATGAAGAAGGAGAAGGAAGG - Intergenic
1059072467 9:111152972-111152994 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059072471 9:111152985-111153007 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1060176071 9:121498621-121498643 CTGAGGAAGCAGGAGATGTAGGG - Intergenic
1060202708 9:121661054-121661076 GTGAAGAAGCGGGAGGATGAGGG + Intronic
1060235119 9:121857273-121857295 CTGGTGAAGCAGGAGTCAGAGGG - Intronic
1060623595 9:125090469-125090491 ATGATGAAGAAGGAGAAGGAAGG + Intronic
1060989402 9:127839457-127839479 AAGAAGCAGCAGGAGGAGGAAGG + Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061212984 9:129204096-129204118 CAGATGTGGCAGGAGCAGGAAGG + Intergenic
1061505053 9:131027081-131027103 CTAATGAACCAGAAGGAAGACGG + Intronic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1062142604 9:134967880-134967902 CTGATTAATCAGGGGGAGGAAGG + Intergenic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1062451926 9:136619375-136619397 CTGAAGGAGGAGGAGGAAGAGGG + Intergenic
1062580406 9:137226909-137226931 AGGATGAGGCAGGAGGAGGCTGG + Intergenic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062664030 9:137657206-137657228 TTGAGGAAGCAGCAGGAGCAAGG + Intronic
1203774287 EBV:64052-64074 GGGAGGAAACAGGAGGAGGAGGG + Intergenic
1185550627 X:980670-980692 ATGATGGAGGAGGAAGAGGAGGG + Intergenic
1185550667 X:980798-980820 GGGATGATGGAGGAGGAGGAGGG + Intergenic
1185550700 X:980899-980921 GGGATGGAGGAGGAGGAGGAGGG + Intergenic
1185550729 X:980996-981018 GGGATGATGGAGGAGGAGGAGGG + Intergenic
1185550779 X:981151-981173 GGGATGATGGAGGAGGAGGAGGG + Intergenic
1185550797 X:981203-981225 GGGATGATGGAGGAGGAGGAGGG + Intergenic
1185550828 X:981304-981326 AGGATGGAGGAGGAGGAGGAGGG + Intergenic
1185550860 X:981405-981427 GGGATGGAGGAGGAGGAGGAGGG + Intergenic
1185611740 X:1397350-1397372 CTGATGAGGCTGCAGGATGAGGG + Intergenic
1185661926 X:1735195-1735217 AGGAGGAAGGAGGAGGAGGAGGG - Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1187025747 X:15433932-15433954 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1187661913 X:21556930-21556952 TTGATGATGCAGGAGAAAGAAGG + Intronic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1189512365 X:41675766-41675788 AAGCTGAAGCAGGAGAAGGAGGG - Intronic
1189656344 X:43248786-43248808 CGGCTGGAGCAGGAGGAAGAGGG - Intergenic
1189751722 X:44229379-44229401 CTTATGAATCAGGAGGTTGAAGG - Intronic
1190503648 X:51103758-51103780 CTGATGATGCAAGGGGAGCAGGG + Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1191696279 X:63994071-63994093 TTGAGGAAGCAGGAGGAAAAGGG + Intergenic
1191885639 X:65885042-65885064 CTGAGGATGCAGCAGGAAGATGG + Intergenic
1192996900 X:76521321-76521343 GAGATGAAGCGGGAGGAAGATGG - Intergenic
1195574200 X:106431534-106431556 CTGAAGGGGCTGGAGGAGGAAGG - Intergenic
1195766227 X:108298816-108298838 TTTATGAAGGAGGAGGAAGAGGG + Intronic
1196746701 X:119077633-119077655 TTTCTAAAGCAGGAGGAGGAAGG + Intergenic
1197711872 X:129677574-129677596 CTAAGGAAACAGGAGGAAGAAGG + Intergenic
1198161882 X:134016176-134016198 CTGATGAAAAAGGGGGAGAAAGG + Intergenic
1198694747 X:139324231-139324253 CTGCTGCAGCAGGTGGGGGAGGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199411478 X:147528621-147528643 CTGATGGGGGGGGAGGAGGAGGG - Intergenic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1200060760 X:153482727-153482749 CTGTTGACGCTGGAGGTGGAAGG + Intronic
1200766817 Y:7087255-7087277 CAAATGAAGCACTAGGAGGATGG - Exonic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1201300261 Y:12498784-12498806 ATGACGAAGAAGTAGGAGGAAGG - Intergenic
1202257017 Y:22932074-22932096 CTGAGGAGGCAGGAAGAGAATGG - Intergenic
1202410008 Y:24565822-24565844 CTGAGGAGGCAGGAAGAGAATGG - Intergenic
1202460774 Y:25104250-25104272 CTGAGGAGGCAGGAAGAGAATGG + Intergenic