ID: 1141158577

View in Genome Browser
Species Human (GRCh38)
Location 16:81613646-81613668
Sequence TAAGACTCTAAAAATGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 315}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141158577_1141158580 -5 Left 1141158577 16:81613646-81613668 CCATGATCATTTTTAGAGTCTTA 0: 1
1: 0
2: 1
3: 33
4: 315
Right 1141158580 16:81613664-81613686 TCTTAGTCAAATACAGTTTGGGG 0: 1
1: 0
2: 2
3: 10
4: 195
1141158577_1141158582 4 Left 1141158577 16:81613646-81613668 CCATGATCATTTTTAGAGTCTTA 0: 1
1: 0
2: 1
3: 33
4: 315
Right 1141158582 16:81613673-81613695 AATACAGTTTGGGGAAGAGAGGG 0: 1
1: 0
2: 5
3: 58
4: 530
1141158577_1141158579 -6 Left 1141158577 16:81613646-81613668 CCATGATCATTTTTAGAGTCTTA 0: 1
1: 0
2: 1
3: 33
4: 315
Right 1141158579 16:81613663-81613685 GTCTTAGTCAAATACAGTTTGGG 0: 1
1: 0
2: 1
3: 13
4: 140
1141158577_1141158581 3 Left 1141158577 16:81613646-81613668 CCATGATCATTTTTAGAGTCTTA 0: 1
1: 0
2: 1
3: 33
4: 315
Right 1141158581 16:81613672-81613694 AAATACAGTTTGGGGAAGAGAGG 0: 1
1: 0
2: 5
3: 36
4: 397
1141158577_1141158578 -7 Left 1141158577 16:81613646-81613668 CCATGATCATTTTTAGAGTCTTA 0: 1
1: 0
2: 1
3: 33
4: 315
Right 1141158578 16:81613662-81613684 AGTCTTAGTCAAATACAGTTTGG 0: 1
1: 0
2: 0
3: 20
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141158577 Original CRISPR TAAGACTCTAAAAATGATCA TGG (reversed) Intronic
901176829 1:7308735-7308757 TATGACTCAAGACATGATCATGG + Intronic
902081500 1:13823951-13823973 TCAGACACTAAAGATGTTCATGG - Exonic
905062821 1:35154095-35154117 TAAAACTATAAAAATTATCCAGG + Intergenic
905932806 1:41801479-41801501 TAAGAGTCTTAAAATTACCAAGG - Intronic
908188710 1:61678006-61678028 TAAAACTTGAAAAATGATTAAGG - Intergenic
908489410 1:64628135-64628157 TATGACTCTAACAATGATGATGG - Intronic
909383458 1:75028934-75028956 TAAGCTTTTAAAACTGATCAAGG + Intergenic
909945291 1:81656707-81656729 TATGATTTTAAAAATAATCAGGG + Intronic
910417476 1:87015975-87015997 TAAAAATATAAAAATTATCAGGG - Intronic
910520927 1:88121673-88121695 TAAAACTCAATAAATGGTCATGG - Intergenic
910861683 1:91748249-91748271 GAAGTCTCTGAAGATGATCAAGG + Intronic
911699297 1:100932779-100932801 CTAGACTATAAAAATGAACAAGG + Intronic
912646775 1:111400443-111400465 CAAGACTTTAAAAATGATGAGGG - Intergenic
913591329 1:120329603-120329625 CTAGACTCTAAAAATTATAAAGG + Intergenic
913652034 1:120925496-120925518 CTAGACTCTAAAAATTATAAAGG - Intergenic
914169072 1:145203574-145203596 CTAGACTCTAAAAATTATAAAGG + Intergenic
914524192 1:148447529-148447551 CTAGACTCTAAAAATTATAAAGG + Intergenic
914599483 1:149188342-149188364 CTAGACTCTAAAAATTATAAAGG - Intergenic
914642213 1:149619607-149619629 CTAGACTCTAAAAATTATAAAGG - Intergenic
915650721 1:157308441-157308463 TAAGAGTTTAAGAATGATGAGGG + Intergenic
916766758 1:167868326-167868348 TTAGAACCTAGAAATGATCAGGG - Intronic
917116102 1:171605247-171605269 TTAGAACCTAGAAATGATCAGGG - Intergenic
918032032 1:180824275-180824297 TAAGGCTCTTAAAATAATCTAGG + Intronic
918865144 1:189886684-189886706 CAAGACTCAAAACATGATCTGGG - Intergenic
919054701 1:192555030-192555052 CAAAACCCTAAAAATGATTAAGG - Intergenic
920830253 1:209458150-209458172 TCAGACTCTAAACTAGATCAAGG + Intergenic
921682812 1:218054083-218054105 TAAGACTCCAAATATGAGCTGGG - Intergenic
923991519 1:239442467-239442489 TAAGAGTTTAAAAATTTTCAGGG + Intronic
924418751 1:243887365-243887387 AAAGACGCTAAAAATCCTCAGGG - Intergenic
1063872520 10:10433854-10433876 TAAGAATGTAATAATGGTCATGG - Intergenic
1064763229 10:18643700-18643722 TAAGGCTATCAAAATGATGAAGG - Intronic
1064809524 10:19179487-19179509 TAAAAATATAAAAATTATCAGGG + Intronic
1065472512 10:26097115-26097137 AAATATTCTAAAAATGATTATGG - Intronic
1065578363 10:27146999-27147021 TAAGCTATTAAAAATGATCAAGG + Intronic
1068051857 10:51960431-51960453 TAAGACTATAAAAATATTTATGG + Intronic
1068495277 10:57778815-57778837 TAAAACTTTAAAATTGGTCATGG + Intergenic
1068515357 10:58019174-58019196 TAAGACACCAAAAATGCACATGG + Intergenic
1069212209 10:65776355-65776377 GAACATTCTAAAATTGATCATGG - Intergenic
1070367812 10:75753142-75753164 TAGGGCTTTAAAAATGAACAGGG - Intronic
1071220661 10:83461302-83461324 TAAAATTCTAAAAATTATCTGGG - Intergenic
1071288858 10:84173763-84173785 TATGACTCTATAAATGTCCAAGG + Exonic
1072779192 10:98233627-98233649 TAAGAGCTTAAAAATGCTCATGG - Intronic
1073210178 10:101794092-101794114 TAACTCTCTAACAATAATCAGGG + Intronic
1073960191 10:108917746-108917768 TAAAAATCTAAAAATTATTATGG + Intergenic
1074657373 10:115608131-115608153 AAAAACTCTAAAAATGCTAAGGG - Intronic
1075207901 10:120462602-120462624 TAGGTCTGTAAAAATGATCCTGG - Intronic
1078695062 11:13622802-13622824 TAAAACTTGAAAAATTATCAGGG - Intergenic
1079123372 11:17700570-17700592 TATGACTCTGTAAATGATAAGGG + Intergenic
1079886566 11:25997505-25997527 AAATATTCTAAAATTGATCATGG - Intergenic
1080980484 11:37398266-37398288 TAAGGATCTACAAATGGTCAAGG + Intergenic
1082722227 11:56692244-56692266 AAAGCCTCTACAAATGATAAGGG + Intergenic
1082758742 11:57105326-57105348 TAATACTCTAAAAATGACGTTGG + Intergenic
1082770168 11:57201740-57201762 TCAGACTCTAAAGATGAGAAAGG - Intergenic
1083340122 11:61953719-61953741 TAAAAATCAAAAAATGATCTGGG + Intronic
1084058967 11:66657089-66657111 AAAGACTAAAAAATTGATCAGGG - Intronic
1085246330 11:75104690-75104712 TATGACTTTAAAAATTATAAGGG + Intronic
1085916100 11:80890137-80890159 TAAAACTGTCAAAATCATCAAGG - Intergenic
1086397281 11:86429761-86429783 TAAGCCTGTAAAAATGGTGAAGG - Intergenic
1086834940 11:91609256-91609278 TAAGACTGTTGAAATGATGAAGG + Intergenic
1087530902 11:99380891-99380913 TAAGAAACTCAAAATAATCAGGG - Intronic
1087745768 11:101944854-101944876 TAAGAATTTAAATATGATTATGG + Intronic
1087747220 11:101962776-101962798 AAAGAATCTAAATATGAACATGG + Exonic
1087977799 11:104571349-104571371 TAATACACAAAAAATGAGCATGG - Intergenic
1088279607 11:108122688-108122710 AAAGAGTCTAAAATTGATCCTGG + Intronic
1088953507 11:114594679-114594701 GAAAACTGTAAAAATGATCCAGG + Exonic
1089829775 11:121316841-121316863 TGAGACTCTGAAAATGAGCTAGG + Intergenic
1090146716 11:124331823-124331845 GAAGGCTCTAAAACTGATTATGG + Intergenic
1091089717 11:132759650-132759672 AAAGACAATAAAAATGATAAAGG - Intronic
1093260101 12:16925332-16925354 TTAGAGTCTAATAAGGATCATGG + Intergenic
1093467332 12:19463519-19463541 TAACACAGTAAAAATCATCATGG + Intronic
1093669696 12:21858804-21858826 GAAGACTCTAAAAATGTTCTGGG + Intronic
1093746469 12:22747601-22747623 TAAAACTTAAAAAATGATCTTGG + Intergenic
1093874177 12:24329567-24329589 TAAGAAATTAAAAATGATTATGG + Intergenic
1094665445 12:32515819-32515841 TTTGAATATAAAAATGATCAGGG + Intronic
1096726275 12:53565651-53565673 TAAAACTATAAAAATTATCCGGG - Intronic
1096740256 12:53688299-53688321 TAAGAATCTATACATGTTCAGGG - Intergenic
1097162175 12:57054846-57054868 TAAAACTACAAAAATTATCAGGG + Intergenic
1098639259 12:72819869-72819891 TTAGAACCTAGAAATGATCAGGG + Intergenic
1098754114 12:74336217-74336239 TAAGAGTATAAGAATGTTCAGGG - Intergenic
1098915897 12:76256574-76256596 TTATACTCCAACAATGATCATGG - Intergenic
1099724459 12:86408839-86408861 GAAGACATTAAAAATGAACAAGG - Intronic
1100729012 12:97443104-97443126 TAAGCTTATAAAAATGAGCAAGG + Intergenic
1101265063 12:103075835-103075857 TAAGACTCTATACATGACCATGG + Intergenic
1102828706 12:115974417-115974439 TAAGGCTTTAAAAATAATCTAGG + Intronic
1102850716 12:116241997-116242019 TTAAACTATAAATATGATCATGG - Intronic
1105626358 13:22116866-22116888 TCAGACACAAAAAATGATAAGGG - Intergenic
1105642286 13:22278250-22278272 TAAGATTATAGAAATCATCATGG + Intergenic
1105695894 13:22888283-22888305 TTAGAACCTAGAAATGATCAGGG - Intergenic
1105944853 13:25180424-25180446 AGAGACTCTATAAATGCTCACGG - Intergenic
1106383356 13:29261631-29261653 TAAAATTATAGAAATGATCAAGG - Intronic
1106707306 13:32294985-32295007 TAATATTCTAAAATTGATTATGG + Intronic
1108739676 13:53322874-53322896 TAATACTCTAAAAATGGAGAAGG + Intergenic
1109676929 13:65688459-65688481 TAACACTCTAAATATCATCTAGG - Intergenic
1110080646 13:71306065-71306087 AAAGTGTCTAAATATGATCATGG + Intergenic
1111378262 13:87410945-87410967 TAAAACTATAAAAATTATCTGGG + Intergenic
1111608516 13:90573069-90573091 TATGAATCAAAAAATGATCATGG + Intergenic
1111750467 13:92324857-92324879 AATGACTCTAAAACTGATCTTGG - Intronic
1111875187 13:93884541-93884563 TAAATCTCTAAAAATCCTCAAGG - Intronic
1113374762 13:109754621-109754643 TAAAACCTTAAAAATGTTCAGGG + Exonic
1113829578 13:113284905-113284927 TAAGCCTCTTAAAATGGGCAAGG - Intergenic
1114035926 14:18627128-18627150 AAAGAGTCTAAAAATTATCAAGG - Intergenic
1114122713 14:19687894-19687916 AAAGAGTCTAAAAATTATCAAGG + Intergenic
1114864581 14:26573536-26573558 TAAGAATCTGAAAAAGATAAAGG + Intronic
1115708866 14:36028095-36028117 TAAAAATCTAAATCTGATCATGG + Intergenic
1116258433 14:42588120-42588142 CTAAACTCTAAAAATAATCAAGG - Intergenic
1116647196 14:47543724-47543746 TAAAAATCTATAAATCATCAAGG + Intronic
1117329660 14:54700041-54700063 GAAGTCACTAAAAATGATCAAGG - Intronic
1117382134 14:55174849-55174871 TAAAACTGTAAAAATTATCCGGG - Intronic
1118139419 14:63064252-63064274 TGAGAATCAAAAAATGATTAAGG + Intronic
1119013601 14:71024354-71024376 TAAGAGACTAAACATAATCAAGG - Intronic
1119875961 14:78059662-78059684 TAAGACATTAAAAAAGATAAGGG + Intergenic
1120254388 14:82099913-82099935 TCAGACTATATAAATGAACAAGG - Intergenic
1120339183 14:83197161-83197183 TGAGATTCTAAAAATAATGATGG - Intergenic
1120895439 14:89527261-89527283 TAAGACTATAAAACTGTTAAAGG + Intronic
1122580343 14:102767856-102767878 TCAGTCAATAAAAATGATCATGG - Intergenic
1124248486 15:28092291-28092313 AAATGCTCTAAAATTGATCATGG + Intronic
1126524240 15:49632779-49632801 TAAGAATCTAAAAATGAGCAAGG - Intronic
1128032798 15:64496781-64496803 TGAAACTCTGAAAATGATCTAGG - Intronic
1128533179 15:68469066-68469088 GAAGACTCTAAAGGTGATTAGGG + Intergenic
1128920832 15:71608654-71608676 CAAGACACTTAAAATGCTCATGG - Intronic
1130047545 15:80457479-80457501 TAAGAGCCTAAAAAGGCTCACGG - Intronic
1132165147 15:99579694-99579716 CAATACTATAAAAATGAACAAGG - Intronic
1134768629 16:16784571-16784593 TAACACTATAAAAATCAACATGG + Intergenic
1134809357 16:17154160-17154182 TAAAATTCAAATAATGATCATGG - Intronic
1135734936 16:24923260-24923282 TAAGACTGAAACAATGATCTTGG - Intronic
1137758464 16:50920983-50921005 TAAGATTCTGAATATGATGAGGG - Intergenic
1137817664 16:51414202-51414224 AAAAACTCTAAAAAAGATCCCGG - Intergenic
1137828796 16:51524533-51524555 TAAATCTCTAAAAATGAGGATGG - Intergenic
1137878753 16:52024222-52024244 TAGGACTCTGAAAATCAGCATGG - Intronic
1138258525 16:55594120-55594142 TAAGGCTTTAAACCTGATCATGG - Intergenic
1138317843 16:56085752-56085774 CAAGACTATAAAAAGAATCAAGG + Intergenic
1139759431 16:69172552-69172574 CAAGACTGTAAAAATGAGAATGG - Intronic
1140127173 16:72127504-72127526 TAAGACACTAAAACTGAGGATGG + Intronic
1141158577 16:81613646-81613668 TAAGACTCTAAAAATGATCATGG - Intronic
1141996235 16:87638078-87638100 TAAAACTATAAAAATTAGCAGGG - Intronic
1142406059 16:89890825-89890847 TAATACTATAAAAATAATAAAGG - Intronic
1142633723 17:1243375-1243397 TAAAACTATAAAAATTAGCAGGG + Intergenic
1147227763 17:38993259-38993281 TAAGAGACTAAAAATTATCTAGG - Intergenic
1147358430 17:39915816-39915838 TAATACTCTAAAGCTGCTCAGGG + Intronic
1147376412 17:40024894-40024916 TAAAAATATAAAAATGAGCAGGG - Intronic
1149548831 17:57524697-57524719 TAAAATCCTAAAAATGATGATGG - Intronic
1150664339 17:67117708-67117730 TAAAAGTATAAAAATGATCCGGG - Intronic
1150820714 17:68432002-68432024 TAAGGCTCCAAAAAAGATCAGGG + Intronic
1151100099 17:71546819-71546841 TAAGTCTCAAAAAATGAGGAAGG - Intergenic
1151147431 17:72053952-72053974 TAAGATGTTTAAAATGATCATGG + Intergenic
1151629090 17:75297992-75298014 TAAAACTATAAAAATTATCTGGG + Intergenic
1152329049 17:79660024-79660046 TAAAAATATAAAAATGAACAGGG + Intergenic
1153524392 18:5980590-5980612 TAAAAATATAAAAATTATCAAGG - Intronic
1154299856 18:13183599-13183621 TTACACTCTCAAAATCATCACGG - Intergenic
1155523685 18:26695107-26695129 TAAAAAACTAAAAATGATCATGG + Intergenic
1156327462 18:36086773-36086795 TAAAACTCCAAAAATTAACAGGG + Intergenic
1157046939 18:44112558-44112580 AAAGACTCAAAAAAGGATAATGG - Intergenic
1157363302 18:47039318-47039340 AAAGGTTCTAAAATTGATCAAGG - Intronic
1158764799 18:60437002-60437024 TAAGATTTTAAAAATAATCTTGG + Intergenic
1159098357 18:63931274-63931296 TCATTCTCTAATAATGATCAGGG + Intronic
1159977706 18:74735718-74735740 CAAGCCTCTAAAGTTGATCATGG - Intronic
1161424579 19:4195907-4195929 TAAAAGTCTAAGAATAATCACGG + Intronic
1162986212 19:14271847-14271869 CAAGAAGCCAAAAATGATCAGGG - Intergenic
1163934271 19:20427649-20427671 TTAGAACCTAGAAATGATCAGGG + Intergenic
1164798422 19:31055237-31055259 TAATACTGTAAAAATGGTGAAGG - Intergenic
1165989164 19:39796570-39796592 TGAAAATCTAAAATTGATCATGG + Intergenic
1166113333 19:40636824-40636846 AAAAACTTTAAAAATGATCCAGG + Intergenic
1166573640 19:43816388-43816410 TCAGAATGTAAAGATGATCAAGG + Intronic
926024352 2:9527553-9527575 TTAGACTTTAAAAAAGATTAGGG - Intronic
927378585 2:22450088-22450110 CAGGACTCTAGAAATGGTCAGGG - Intergenic
928703333 2:33921470-33921492 GAAAACTCTAAAAATGCTCTAGG + Intergenic
928847293 2:35692287-35692309 TAATACATTAAAAATGAGCAAGG + Intergenic
929634390 2:43502422-43502444 TAAAAATATAAAAATTATCAGGG + Intronic
931123539 2:59248087-59248109 TAAGGATCTAAAGATGATTAGGG - Intergenic
931196972 2:60061548-60061570 TTATACTATAAAAATAATCAAGG + Intergenic
931865400 2:66404872-66404894 TAAGAGTTTACAAATGAGCAAGG + Intergenic
934072733 2:88399697-88399719 AAAGATTCTAAAATTGATTATGG + Intergenic
934120773 2:88837120-88837142 TAAGAGTCTAAAAACTATAAAGG - Intergenic
935463408 2:103365778-103365800 TAAGAATATAAAAATTAGCAGGG - Intergenic
935796730 2:106649151-106649173 TACGAATCAATAAATGATCAGGG - Intergenic
937619325 2:123967415-123967437 TGACACTCTAAAAATGTTAAAGG - Intergenic
937708621 2:124951146-124951168 TAAAACTCTAAAAATGACATGGG + Intergenic
938184783 2:129220842-129220864 AAATATTCTAAAATTGATCATGG + Intergenic
938274467 2:130005827-130005849 AAAGAGTCTAAAAATTATCAAGG + Intergenic
938440906 2:131331453-131331475 AAAGATTCTAAAAATTATCAAGG - Intronic
938841936 2:135172758-135172780 TAAACCTCTAAAAATTAACATGG - Intronic
939327160 2:140707781-140707803 TAAGACTTGAAAAATGATTTGGG - Intronic
939401108 2:141695007-141695029 TAATACTTTAAAAATGATGCTGG + Intronic
939574555 2:143880683-143880705 ACAGACTATAAAAATGAACATGG + Intergenic
941206236 2:162576726-162576748 AAAGACTCTAATGATGACCAAGG + Intronic
941569872 2:167156762-167156784 TAATTTTTTAAAAATGATCAAGG + Intronic
942386223 2:175446280-175446302 TAAGACTTCAAAAATAATAATGG - Intergenic
943838415 2:192545383-192545405 AAAGATTCTAAATATGATTAAGG + Intergenic
944354291 2:198767235-198767257 TAAAAATGTAAAATTGATCATGG - Intergenic
944640183 2:201716843-201716865 AAAGACTCTAAGAATAAACATGG + Intronic
944888629 2:204092488-204092510 TAAAACTATAAAAATTATCTGGG - Intergenic
946035101 2:216735682-216735704 TAAAACTCTAAAAATTATTGAGG - Intergenic
946592659 2:221268267-221268289 TAAGACCCTGAAAATGATCCTGG + Intergenic
946877773 2:224147086-224147108 TTAGACTTTAAAAATTATAATGG + Intergenic
947338482 2:229111692-229111714 TGAGACCCTAAAAATGGTAATGG + Intronic
1170341168 20:15328664-15328686 TAAGATTAAGAAAATGATCAGGG - Intronic
1172993309 20:39051513-39051535 TTACACCCTAAGAATGATCAAGG + Intergenic
1177092194 21:16783074-16783096 AGAGACTATAAAAATGATAAAGG + Intergenic
1177305778 21:19313659-19313681 TAATACTCTAAGAAGGAACATGG + Intergenic
1178155464 21:29848452-29848474 TTAGACTCTAATAAGCATCAAGG - Intronic
1178193555 21:30315664-30315686 AAAGACTCTAATAATTATTAAGG + Intergenic
1179669360 21:42935237-42935259 TTAGAACCTAGAAATGATCAAGG - Intergenic
1179907441 21:44430759-44430781 TAAGATTCGAAAAATCATTATGG - Intronic
1180460051 22:15554182-15554204 AAAGAGTCTAAAAATTATCAAGG - Intergenic
1180944266 22:19681054-19681076 TAAAACTCTAAAAATTAGCTGGG + Intergenic
1182147634 22:28006458-28006480 TAATACTGGAAAAATGATTATGG - Intronic
1182340778 22:29619203-29619225 TAAAAATCTAAAAATTAGCAGGG - Intronic
1182346265 22:29667792-29667814 TAAGACACAAAAAGTGATTAAGG - Intronic
1182757360 22:32690750-32690772 GAAGAAGCTAAAGATGATCAAGG + Intronic
1183060238 22:35332077-35332099 AAAGACACAAAAAATGAACAAGG - Intronic
949278021 3:2310295-2310317 GGGGACTTTAAAAATGATCAAGG - Intronic
949460132 3:4283093-4283115 TAAGAGTCTAAAGATCCTCAAGG - Intronic
949775994 3:7633092-7633114 TAAAACTCTAAAAATGGCCTGGG + Intronic
950080840 3:10220980-10221002 TAAGACACTAAAAAACATGACGG - Intronic
951635788 3:24774392-24774414 TAAGAATCTACAAAGGATAAAGG + Intergenic
954038342 3:47865635-47865657 ACAGAGTCTAAAAATGATAAGGG + Intronic
954192817 3:48976369-48976391 TAAGAATATAAAAATTATCCAGG - Intronic
954843411 3:53533252-53533274 TAAGACTATCAAAATGAAAATGG - Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
956125026 3:66003125-66003147 TAAGACTGTGAAGATGAACAGGG + Intronic
957507236 3:81138033-81138055 TAATAATCTAAAAATAATCAAGG + Intergenic
959982754 3:112535614-112535636 TAAAACTGAAAAAATGAGCAAGG + Intronic
960036927 3:113111244-113111266 TAGGAGTCTAAAAATGTACAGGG + Intergenic
960340219 3:116465967-116465989 TAAGACTTTAAAGATCTTCAAGG + Intronic
960558152 3:119052317-119052339 TAAGACTACAAAAATTATCCAGG + Intronic
961472166 3:127122344-127122366 TAAGACTCCAAATTTGATGATGG + Intergenic
963300721 3:143594229-143594251 TAAGACTCTAAAATTAAGCTGGG - Intronic
963414593 3:144978527-144978549 TTACACTCTTAAAATGATCAAGG - Intergenic
965392712 3:168124637-168124659 TAAGATTTTAAAAAGCATCAAGG - Intergenic
966038283 3:175447420-175447442 TAGGAGATTAAAAATGATCATGG - Intronic
966446781 3:180009499-180009521 AAAGTCAGTAAAAATGATCAAGG + Intronic
966890319 3:184402833-184402855 TAAAACTATAAAAATTATCCAGG - Intronic
967052577 3:185798349-185798371 TAAGTCTCTAAAAATGTTGAAGG - Intronic
970392488 4:15628391-15628413 TAAGAAGCTAAAAATGAGCATGG + Intronic
970397738 4:15686335-15686357 TCAGACCATAAAAATGATCCAGG + Exonic
971130916 4:23809482-23809504 TAAGTCTCTAAAAAAGAATAAGG - Intronic
971626158 4:28922631-28922653 TAAGAGTCTGAAAATCTTCAAGG + Intergenic
974710072 4:65580170-65580192 TAAAACTTTAAAAATGTTTAAGG + Intronic
975791521 4:77957968-77957990 TACGTGCCTAAAAATGATCATGG + Intergenic
976850580 4:89540733-89540755 AATGACTCTAACAATGATGAGGG + Intergenic
976861325 4:89670325-89670347 TAAGACTCTAAAAAGAAGGAGGG - Intergenic
977078972 4:92498549-92498571 CAAAACTTTAAAAATAATCAAGG - Intronic
977720819 4:100238445-100238467 TGCCTCTCTAAAAATGATCAGGG + Intergenic
977833448 4:101619478-101619500 GAAGACTCAAAACATCATCATGG - Intronic
978519357 4:109599965-109599987 TCAGACTCTAAATATCAACATGG - Intronic
978542084 4:109828055-109828077 TCAGACTCTAAAAATGAAGATGG + Exonic
978613302 4:110567984-110568006 TAATACTCCCAAAATTATCAAGG - Intergenic
978983213 4:114977717-114977739 TATGCCTTTAAAAATGATGAGGG - Intronic
979204921 4:118027242-118027264 TTAGACTCTATTATTGATCAGGG - Intergenic
979495076 4:121374175-121374197 AAAGACTCTAAAAACGTTAAGGG + Intronic
980693342 4:136324464-136324486 TAAAACTCTAGATATAATCATGG + Intergenic
980745982 4:137016510-137016532 AAAGATTCTAAAATTCATCAGGG - Intergenic
980936713 4:139232792-139232814 TAAGACAGTTAAAATGATAATGG + Intergenic
981699422 4:147592688-147592710 CAAGACTCCAAAAATAAGCATGG + Intergenic
981978614 4:150763809-150763831 GAAGATTCAAAAAATTATCATGG + Intronic
982557280 4:156883389-156883411 TAAGAGTCTAAAAATCACCTGGG - Intronic
983278804 4:165654107-165654129 GAAGCCTTTGAAAATGATCACGG + Intergenic
984158619 4:176224393-176224415 TAAAACTACAAAAATGATCCGGG - Intronic
985207785 4:187559037-187559059 AAAGATTCTAAAATTGATCATGG - Intergenic
987235720 5:15939378-15939400 TAATACTCTGAGAATGAGCAGGG + Exonic
989197342 5:38728553-38728575 TAAGAATCTAATAAAGATCTAGG + Intergenic
989303745 5:39927117-39927139 TTAGACTCTAAAACTGAGCTAGG - Intergenic
989822123 5:45806018-45806040 TAAAACTATAAAACTGATGAAGG - Intergenic
989984293 5:50679243-50679265 CTAGACTCTAAAAATTATAAAGG - Intronic
990716449 5:58642687-58642709 TATGACTTTAAAAATGTTCTTGG - Intronic
990996634 5:61738481-61738503 TAAGACTCCAAACATTAGCATGG + Intronic
992989402 5:82268821-82268843 TTAGAACCTAGAAATGATCAGGG + Intronic
994350490 5:98739778-98739800 TCAGACACAAAAAATAATCAAGG + Intergenic
994551161 5:101236966-101236988 AATAACTCTAAAATTGATCAAGG - Intergenic
994942935 5:106348191-106348213 AAATATTCTAAAATTGATCATGG + Intergenic
995385601 5:111585562-111585584 TAAGAATGTAAGAATGGTCATGG + Intergenic
996531574 5:124532909-124532931 TAATCCTCTAAAAAAAATCAGGG + Intergenic
996775438 5:127127672-127127694 TCAGGCTTTAGAAATGATCAGGG - Intergenic
997650613 5:135515193-135515215 TAAAACTATAAAAATAATCATGG - Intergenic
998551955 5:143086342-143086364 TAAGACTCTAAAAATAAAGATGG - Intronic
1000630508 5:163585706-163585728 TAAGACTCTTAAAAAGTTGAAGG + Intergenic
1000905006 5:166954941-166954963 TAAGATGCTAAAAATGATATGGG - Intergenic
1005191627 6:23230032-23230054 TAAGACTTAAAACTTGATCAAGG + Intergenic
1005355113 6:24975048-24975070 AAATATTCTAAAATTGATCATGG + Intronic
1006345844 6:33481793-33481815 TAAAACTATAAAAATGAGCCAGG - Intergenic
1006570840 6:35002731-35002753 TTAGAACCTAGAAATGATCAGGG - Intronic
1006709550 6:36055260-36055282 TTAGAATTTAAAAATGATCAAGG + Intronic
1007922972 6:45627316-45627338 TATGACTCCAATGATGATCACGG + Intronic
1010062431 6:71638834-71638856 TAAGATTTTAAAAATGAAAATGG + Intergenic
1010442654 6:75915427-75915449 TAAACCACTTAAAATGATCAAGG + Exonic
1010704868 6:79095652-79095674 TAAAAATCTAAAAATTAGCAGGG + Intergenic
1011401848 6:86971201-86971223 TTAGATTATAAAAATAATCATGG - Intronic
1011948025 6:92931578-92931600 CAAGACATTAAAAATGGTCATGG + Intergenic
1012212814 6:96544066-96544088 GAAGACCATAAAAATGATCATGG - Intronic
1013440852 6:110166448-110166470 CAAGGCTCAAAAAATGACCAGGG + Intronic
1014061190 6:117073643-117073665 TAAGTCTTTAAAAATTCTCAAGG + Intergenic
1014976900 6:127898197-127898219 TTACACTGTGAAAATGATCAAGG + Intronic
1016642295 6:146362805-146362827 TAAGAAGCTAAAATTGAGCAAGG - Intronic
1017006938 6:150034786-150034808 TAAGATTTTAAAAATAATCAAGG - Intergenic
1017286426 6:152681758-152681780 AAAGACAATAAAAATGAGCAGGG + Intergenic
1018717537 6:166545168-166545190 TCAAACTCTGAAAATGACCAGGG - Intronic
1019946581 7:4334437-4334459 TATGACTCTAAAAGGGATAAAGG - Intergenic
1019971781 7:4547379-4547401 TATGACTATAAAAATGCTAATGG - Intergenic
1020463083 7:8445034-8445056 AAAGCCTCTAAAAATGAAGAGGG - Intronic
1020570811 7:9858817-9858839 TAAGACTGTAATACTGATGAGGG - Intergenic
1022239659 7:28497994-28498016 TAAGATACTAAAACTCATCATGG - Intronic
1022584776 7:31597822-31597844 TAAGACTATTATAAAGATCATGG + Intronic
1022883837 7:34621336-34621358 AAAGGCTCTAAAAATTATAAAGG - Intergenic
1022897232 7:34763128-34763150 TAAAACTATAAACATGAGCAAGG + Intronic
1026357093 7:69567560-69567582 AAACATTCTAAAAGTGATCATGG + Intergenic
1031044605 7:116873966-116873988 TAAGACTGAAAAACTTATCAGGG - Intronic
1032417420 7:131747068-131747090 CAAGTCTCTAAGAAAGATCATGG - Intergenic
1032748560 7:134812905-134812927 GAAGACCCTAAAAATTATCCTGG - Intronic
1032979338 7:137264067-137264089 TTAGAACCTAGAAATGATCAGGG + Intronic
1033470345 7:141641465-141641487 TAAGTCTCTAAAACTGATTTTGG - Intronic
1034462081 7:151203575-151203597 TAAGCCCCTAAAAATGGTAACGG - Intronic
1035146519 7:156822949-156822971 TAAAAATATAAAAATGATCTGGG + Intronic
1036615910 8:10387439-10387461 TGAGACTCTAAGAAGGGTCAGGG + Intronic
1037219844 8:16505070-16505092 TAAGACTTTAAAATGGATAATGG - Intronic
1039014635 8:33132707-33132729 TAAGAGTCTAAAAATGGGCTGGG - Intergenic
1040482600 8:47840320-47840342 TTATATTCTTAAAATGATCATGG + Intronic
1040741660 8:50583240-50583262 TAAGAATACAAAAATTATCAGGG + Intronic
1040874467 8:52136612-52136634 TAAGACTCTAAAATCCCTCATGG - Exonic
1041181163 8:55249741-55249763 TAAGACTCTAAATTTGAGTATGG - Intronic
1045237966 8:100372812-100372834 AAAGACTATAAAAATCAACAAGG - Intronic
1046731696 8:117733013-117733035 AAATACTCTAAAATTCATCATGG - Intergenic
1046844595 8:118901929-118901951 TAAGTCTGTAAAAATGAACAGGG - Intergenic
1047184633 8:122621625-122621647 GAAGACTCCAAACATGATGACGG + Intergenic
1048750590 8:137669518-137669540 TTAGACTCCAAAAAAGAGCATGG + Intergenic
1049700091 8:144006892-144006914 TCAGACTCCAGAAATGACCATGG - Intronic
1050157755 9:2685688-2685710 TAAGAATATAAAAATTAGCAGGG - Intergenic
1050281726 9:4057256-4057278 TAAGAATTTTAAAATGATAATGG - Intronic
1051046790 9:12885299-12885321 TAACACTCAATAAATGTTCATGG + Intergenic
1053551853 9:39089113-39089135 AAATACTCTAAAATTGATCATGG - Intronic
1053634192 9:39978400-39978422 TAAAAATCTTAAAATGATAAAGG - Intergenic
1053815984 9:41909251-41909273 AAATACTCTAAAATTGATCATGG - Intronic
1054209695 9:62272297-62272319 TAAAAATCTTAAAATGATAAAGG + Intergenic
1054614613 9:67278190-67278212 AAATACTCTAAAATTGATCATGG + Intergenic
1055099677 9:72450476-72450498 TAAGACTTTGAAAATGGTCCAGG - Intergenic
1055939437 9:81635559-81635581 TGAGACAGTAAAAATGATTAAGG + Intronic
1056089529 9:83191280-83191302 AAAGACTCCAGAAAAGATCATGG + Intergenic
1058047380 9:100370988-100371010 TAAGACTCTGAAAATTAGCTGGG + Intergenic
1059897433 9:118882654-118882676 TAAAACACTGAAAATGATGATGG + Intergenic
1186711734 X:12204845-12204867 CAAGTGTCTATAAATGATCAGGG - Intronic
1188607014 X:32044087-32044109 TAAGAATCTAAACATTATCAAGG + Intronic
1189711904 X:43821798-43821820 TAAGATTTTAAAAATGATGAAGG + Intronic
1191637812 X:63396667-63396689 TAAGACTATAAACTTAATCAAGG - Intergenic
1192404060 X:70866180-70866202 TTAGACAGTAAAAATGATAAAGG + Intronic
1193616149 X:83689976-83689998 TAATACTCTCATAATAATCAAGG + Intergenic
1196119740 X:112036959-112036981 AAAGACTCTACTAATGATCAAGG + Intronic
1196197663 X:112852956-112852978 TGAGACTGTGAAAATGAGCAAGG - Intergenic
1196691162 X:118560328-118560350 TAAAGTTCTCAAAATGATCAGGG + Intronic
1198771834 X:140138677-140138699 CAGGACTCTAAACTTGATCACGG - Intergenic
1199486596 X:148355179-148355201 TAAGACTCTATAAATGAGGAAGG + Intergenic
1201375846 Y:13317997-13318019 TAAAAATATAAAAATTATCAGGG + Intronic