ID: 1141160156

View in Genome Browser
Species Human (GRCh38)
Location 16:81624052-81624074
Sequence TATTTACAACCACCTATTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141160148_1141160156 30 Left 1141160148 16:81623999-81624021 CCAGGACATAACCCCTCTGCTTC 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1141160156 16:81624052-81624074 TATTTACAACCACCTATTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 170
1141160149_1141160156 19 Left 1141160149 16:81624010-81624032 CCCCTCTGCTTCTGCTGATACAG 0: 1
1: 0
2: 1
3: 25
4: 288
Right 1141160156 16:81624052-81624074 TATTTACAACCACCTATTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 170
1141160151_1141160156 17 Left 1141160151 16:81624012-81624034 CCTCTGCTTCTGCTGATACAGCC 0: 1
1: 0
2: 1
3: 27
4: 328
Right 1141160156 16:81624052-81624074 TATTTACAACCACCTATTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 170
1141160152_1141160156 -4 Left 1141160152 16:81624033-81624055 CCACTCTCTCTCCCCTCTTTATT 0: 1
1: 0
2: 28
3: 300
4: 2301
Right 1141160156 16:81624052-81624074 TATTTACAACCACCTATTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 170
1141160150_1141160156 18 Left 1141160150 16:81624011-81624033 CCCTCTGCTTCTGCTGATACAGC 0: 1
1: 0
2: 2
3: 35
4: 295
Right 1141160156 16:81624052-81624074 TATTTACAACCACCTATTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141160156 Original CRISPR TATTTACAACCACCTATTTG AGG Intronic
908654674 1:66375611-66375633 TATTTAAAAACACTTGTTTGGGG + Intergenic
909082747 1:71133658-71133680 TAGTTCTAACCACCTATTGGTGG - Intergenic
909730715 1:78885660-78885682 TAATTCCAACCCCCCATTTGAGG - Intergenic
910583504 1:88854104-88854126 TCTTTACAAGAACATATTTGTGG - Intronic
912464539 1:109862499-109862521 TGTTTTCAGCCACCGATTTGTGG - Intergenic
912762205 1:112378909-112378931 TTATAACTACCACCTATTTGAGG + Intergenic
912807501 1:112769191-112769213 AATTTACAACTACTTATTTGTGG + Intergenic
916388018 1:164298948-164298970 TATTGACAACCACCCATGTGAGG + Intergenic
918262026 1:182804968-182804990 TATTTTTAACCACTTCTTTGAGG - Intronic
919096388 1:193042176-193042198 TATTTACAAACACCTTTTTCAGG + Intronic
921633543 1:217464287-217464309 TATATCCAACCACCTGTTTGAGG - Intronic
924887246 1:248231759-248231781 TCTTCACAACTACCTAATTGTGG + Intergenic
1064332053 10:14403110-14403132 TGTTTAAACCCACCAATTTGGGG + Intronic
1065481716 10:26201378-26201400 GATTTAAAATCACCTATTTTAGG + Intronic
1068274444 10:54775157-54775179 TATTTATTACCACATTTTTGAGG - Intronic
1069317766 10:67128767-67128789 TTTTTATAAATACCTATTTGAGG + Intronic
1073586374 10:104714552-104714574 TTTTTACAACTATCTTTTTGTGG + Intronic
1075249465 10:120852742-120852764 TAAATATAACAACCTATTTGGGG + Intronic
1076378258 10:130007104-130007126 TATTTATAATCACCTATTTTGGG - Intergenic
1077691361 11:4345622-4345644 TATTTTCAGCCACCTACTTTAGG + Intergenic
1078818487 11:14851121-14851143 TACTTAAAACCACGTATTTAGGG - Intronic
1082044858 11:47716791-47716813 TATTTACTGCCACATACTTGAGG + Exonic
1085749466 11:79148243-79148265 TGTTTACATTCACCTATTTTAGG + Intronic
1087494819 11:98877956-98877978 TATTTACAATCACCAAGATGTGG - Intergenic
1087862184 11:103172820-103172842 TATTTACAATCAGTTTTTTGAGG - Intronic
1088610974 11:111576496-111576518 TAGTTAAAAGAACCTATTTGAGG + Intergenic
1088696558 11:112371042-112371064 TATTTACAACCATTGAGTTGGGG - Intergenic
1090587812 11:128233435-128233457 TATTTCCATGCACATATTTGGGG - Intergenic
1098096842 12:66966025-66966047 TTTTTACAACCTGCTATTTAAGG - Intergenic
1099916135 12:88896028-88896050 TATTTAAAACCATGTATTGGGGG - Intergenic
1101344579 12:103874641-103874663 TATTTTAAGCCACCTGTTTGTGG - Intergenic
1102777355 12:115532230-115532252 TATTTACAACAACCTAATGAGGG - Intergenic
1109520767 13:63507396-63507418 TATTTAAAACCAACTAATTATGG - Intergenic
1110353154 13:74535162-74535184 TATTTACAACCATATTTCTGTGG + Intergenic
1112534206 13:100234527-100234549 ACTTAACAAGCACCTATTTGTGG + Intronic
1112599874 13:100844590-100844612 TATTTCCTACCACCAAATTGAGG - Intergenic
1113199781 13:107854570-107854592 TTTTTAAAAAGACCTATTTGGGG + Intronic
1113814271 13:113160710-113160732 TGCTTACCACCACCTATTTGAGG - Intronic
1115291732 14:31779661-31779683 TAGTTATAACCAACTATTGGAGG + Intronic
1115391518 14:32859878-32859900 CATTTACAACAACATGTTTGAGG + Intergenic
1115424963 14:33247327-33247349 TATTCATAATCAGCTATTTGAGG - Intronic
1115900960 14:38147872-38147894 TCTATACAATCACCCATTTGGGG + Intergenic
1120523744 14:85553741-85553763 TATTTATAGTCACCTATTGGAGG - Intronic
1121380958 14:93466078-93466100 TATTTACTACCAAATATTTATGG + Intronic
1121641513 14:95487534-95487556 TATTTTAAACCACCTTCTTGGGG + Intergenic
1121660295 14:95630266-95630288 AATTTACAACCACTTTTTTGGGG - Intergenic
1121968161 14:98329610-98329632 TGTTTAAAACCCCCTAGTTGTGG - Intergenic
1125209290 15:37194247-37194269 AAATTACAACAACATATTTGGGG - Intergenic
1125404303 15:39336755-39336777 TATTTGCATTCACTTATTTGGGG + Intergenic
1127622418 15:60746768-60746790 TTTTTATGACCACATATTTGAGG - Intronic
1127926703 15:63552023-63552045 TTTAAACAACCACTTATTTGTGG + Intronic
1130291459 15:82605736-82605758 CATGTATAAACACCTATTTGTGG + Intronic
1131859071 15:96632824-96632846 TCTTTACAACCACCCTTGTGAGG + Intergenic
1133315448 16:4880771-4880793 TTTTTACAGACACCTATTTTGGG + Exonic
1138466027 16:57191085-57191107 TATTTCAAACCTTCTATTTGAGG - Intronic
1141131505 16:81440693-81440715 TGTTTATTAGCACCTATTTGAGG - Intergenic
1141131518 16:81440883-81440905 TGTTTATTAGCACCTATTTGAGG + Intergenic
1141160156 16:81624052-81624074 TATTTACAACCACCTATTTGAGG + Intronic
1144940534 17:18936702-18936724 TATTCACAATCACCAAATTGTGG + Intergenic
1148262501 17:46195403-46195425 TTTTTAAAACCATGTATTTGGGG + Intronic
1149283663 17:55136687-55136709 TTTTAACAACCAGCTATTGGGGG - Intronic
1153620138 18:6969557-6969579 TCTTTACAAACACGTATTTTTGG + Intronic
1158284193 18:55861233-55861255 TATTCACAACCACCAAGCTGAGG + Intergenic
1160045282 18:75380819-75380841 TATTTAAAACCTCCTCTTTCCGG + Intergenic
1161536351 19:4821401-4821423 TACATGCAACCACTTATTTGAGG + Intronic
925213811 2:2074924-2074946 TCTTTACAACAACCCCTTTGAGG + Intronic
925428750 2:3773076-3773098 TATTCACAACCACTTAGTTCAGG - Intronic
925883256 2:8370258-8370280 TTTTTACATCCATCTGTTTGGGG - Intergenic
928158673 2:28900562-28900584 TAAATACAAACACCTATTTCAGG - Intronic
929331529 2:40687662-40687684 AATTTACATCTACCTATTTTAGG - Intergenic
931816518 2:65908681-65908703 TCTCTACAATCACCTATATGTGG + Intergenic
931887536 2:66633240-66633262 TATTTAAAACACCATATTTGAGG - Intergenic
933123625 2:78575048-78575070 TATTTACAACCACCAATAAAGGG - Intergenic
933372221 2:81428970-81428992 TATTAACAATGACCAATTTGGGG - Intergenic
934086050 2:88510646-88510668 TATTTACAACAATGTATTTATGG + Intergenic
934636674 2:95995649-95995671 TAGTGACACCCACCTATTGGGGG - Intergenic
934796976 2:97109773-97109795 TAGTGACACCCACCTATTGGGGG + Intergenic
934836438 2:97593652-97593674 TAGTGACACCCACCTATTGGGGG - Intergenic
935233219 2:101117234-101117256 TGTTTTCAGCCACCTAGTTGGGG + Intronic
936545363 2:113387793-113387815 TAGTGACACCCACCTATTGGGGG + Intergenic
936619125 2:114076700-114076722 GATTTAAAACCACCCATTTGTGG + Intergenic
937430410 2:121833101-121833123 TATTTTCAACCTCCTAATTTGGG - Intergenic
937548472 2:123055526-123055548 TATTTACAATCTCCCATTTAAGG + Intergenic
937786249 2:125902457-125902479 TATATAAATCCACCTTTTTGAGG - Intergenic
938815329 2:134897257-134897279 TATATACAAACATATATTTGTGG + Intronic
939111670 2:138015863-138015885 TATTTACAAACACCAATCTATGG - Exonic
940903142 2:159145211-159145233 AGTTTACAAAAACCTATTTGAGG + Intronic
941554818 2:166964487-166964509 CATTTACAGCCTCCTATTTGCGG - Intronic
943041267 2:182808312-182808334 TATTTACAACAGCCTAATTTAGG + Intergenic
943936717 2:193927788-193927810 TATTTGCAATCACATTTTTGTGG + Intergenic
944231651 2:197400199-197400221 TATTTACATTAAACTATTTGGGG + Intronic
944825657 2:203480779-203480801 TATTTTCAACATACTATTTGTGG - Intronic
946959398 2:224967744-224967766 TATTAACAACTACATATATGTGG - Intronic
947705475 2:232271977-232271999 TAATTACAGCCACTTATGTGTGG + Intronic
1173630942 20:44514987-44515009 TATTTACAATCACCAAAATGTGG + Intronic
1177523513 21:22263099-22263121 TCTTGACAACCACCTGTTTTGGG + Intergenic
1178576491 21:33796883-33796905 TAATTACAATTATCTATTTGTGG + Intronic
1181710645 22:24685279-24685301 TACTTACTACCACCGATTTGAGG + Intergenic
1183754471 22:39747283-39747305 AATTTAAAAACAACTATTTGAGG - Intronic
949866378 3:8550764-8550786 TATGAACAAACAGCTATTTGAGG - Intronic
951561913 3:23975996-23976018 TAATTACAACCTCCCATGTGGGG + Intronic
952874689 3:37934649-37934671 TATGGCCAACCCCCTATTTGGGG - Intronic
955602178 3:60657393-60657415 CATTGACAACCTCCCATTTGAGG - Intronic
955792375 3:62601979-62602001 TATTTAAAGCCTCTTATTTGCGG + Intronic
956720313 3:72111596-72111618 TATTTACAGCCAGCTAATCGTGG - Intergenic
958719850 3:97830429-97830451 TATGTAAGACCACCTATTTTTGG + Intronic
960035383 3:113097243-113097265 TATTTTCAACTTCTTATTTGAGG + Intergenic
963674292 3:148289034-148289056 TAGTTACACTCACCTATTGGAGG - Intergenic
972887958 4:43516330-43516352 CATTTGCAACCACCAATGTGAGG + Intergenic
973125526 4:46579441-46579463 TATTTAGAACAAGCCATTTGGGG + Intergenic
974334740 4:60527435-60527457 TATTTACAAACTCTTATTGGAGG - Intergenic
974338957 4:60588965-60588987 TCTTTAAAACCATCAATTTGTGG + Intergenic
975353217 4:73369058-73369080 TGTTTACAAACACGTTTTTGAGG - Intergenic
975795575 4:78003225-78003247 TGTTTACAACAACATATATGGGG + Intergenic
976440638 4:85069497-85069519 TATTTACAACCACGTAGTTATGG - Intergenic
976648908 4:87414409-87414431 TATTTTCAACTACTAATTTGTGG + Intergenic
977102726 4:92837813-92837835 AATTAACAACAACCTAATTGTGG + Intronic
978686176 4:111446374-111446396 TGTTTACAACTTCCTATTTCAGG + Intergenic
978971812 4:114816805-114816827 TACTTACATCTACATATTTGGGG + Intergenic
979166722 4:117542321-117542343 TTTTTACAAGCATGTATTTGTGG - Intergenic
979372275 4:119903239-119903261 TATTTAAAAATACATATTTGAGG - Intergenic
981390388 4:144183100-144183122 TATAGACATCCACCCATTTGTGG - Intergenic
983297428 4:165883657-165883679 TAATCACAACTACTTATTTGTGG + Intronic
984117234 4:175696456-175696478 TTTTTAAAAACACCCATTTGAGG + Intronic
984409500 4:179378166-179378188 TTTTTACAAACATCTATTTAAGG - Intergenic
984689538 4:182709657-182709679 TATTTAGAACCAGGTTTTTGTGG + Intronic
988357165 5:30192880-30192902 TATTTACAAACAGGTGTTTGAGG - Intergenic
990087903 5:52001529-52001551 TATTCAGATCCACCTATTTGTGG + Intergenic
991645105 5:68793680-68793702 TACTTAAAACTAACTATTTGGGG - Intergenic
995345876 5:111116736-111116758 TATATAAAACCACCAAATTGAGG - Intronic
1000115486 5:158149626-158149648 TATTTGCAAACACCTCTTTTGGG - Intergenic
1002671468 5:180871069-180871091 CATTTACAACCACCTCTCTTTGG + Intergenic
1003870827 6:10401507-10401529 TGTTTAAAACCATATATTTGAGG - Intronic
1004510216 6:16278740-16278762 CATGTATAACCATCTATTTGGGG + Intronic
1009822304 6:68818646-68818668 TAATTAAAACCACATTTTTGTGG - Intronic
1010416116 6:75613578-75613600 TTTATACATCCCCCTATTTGTGG - Intronic
1011123023 6:83975588-83975610 TATTTGCATCCAACCATTTGTGG - Intergenic
1012556373 6:100517546-100517568 TATGTATAACCACCTAGTTTGGG + Intronic
1015128795 6:129786322-129786344 TATTTAAAGGAACCTATTTGGGG - Intergenic
1015532642 6:134236321-134236343 TTTTTAAAACCACTTATTTAGGG - Intronic
1016090249 6:139969243-139969265 TATTTAGAATGACCTATTTAGGG - Intergenic
1017568544 6:155715334-155715356 AATCTGCAACCACTTATTTGGGG + Intergenic
1021770320 7:23994018-23994040 TATTGACTACCTACTATTTGCGG - Intergenic
1022057449 7:26753562-26753584 TATTTATAACTACCTAATTTTGG + Intronic
1022403490 7:30064192-30064214 TATTTACAACCACCTTGTTAGGG - Intronic
1023427450 7:40053375-40053397 TATTTACAATGGCCTATATGAGG - Intronic
1023453243 7:40310774-40310796 TATTTAAAACCACCCATTCTTGG + Intronic
1023459535 7:40380020-40380042 TGTTAACAACCATCTCTTTGTGG - Intronic
1023559298 7:41456362-41456384 AATTTACAACCACTTTTTGGTGG - Intergenic
1026426478 7:70299515-70299537 CATTTTCAAGCACCTATTTTTGG - Intronic
1027285890 7:76645555-76645577 CATTTAAAGCCACCTATTTAAGG + Intergenic
1027771256 7:82409314-82409336 TATTTACATCCACATATATTTGG - Intronic
1027870295 7:83698406-83698428 CTTTAACAACCACATATTTGTGG + Intergenic
1028257667 7:88620355-88620377 TAATTACAACCACCTTTGAGAGG - Intergenic
1028287731 7:89024162-89024184 TATGAATAACCACTTATTTGTGG + Intronic
1028332855 7:89618156-89618178 TATTTAAAACCACTTTTTTTTGG - Intergenic
1028725756 7:94085828-94085850 CATTTCCAACCTCCTATTTTAGG + Intergenic
1028863069 7:95676748-95676770 TATTAAGAACCAACTATTTTTGG - Intergenic
1031033451 7:116760659-116760681 TAATTACAAAAACCAATTTGGGG + Intronic
1045173488 8:99696291-99696313 TATTCACCACCACCTCTGTGGGG - Intronic
1045835542 8:106516635-106516657 TTTTTATTACCACCTTTTTGTGG + Intronic
1046692529 8:117302069-117302091 TATTTTCAAACAGCTTTTTGTGG + Intergenic
1047385338 8:124404254-124404276 TAATTACAATGAACTATTTGGGG + Intergenic
1047930628 8:129725206-129725228 TATTCACCATCACTTATTTGAGG - Intergenic
1048679260 8:136821477-136821499 TATTTACACCCCCCAAATTGGGG - Intergenic
1050909340 9:11047444-11047466 TTTTTAAAACCACTTAATTGTGG + Intergenic
1051973335 9:22918442-22918464 TATTTACTACCAGCTGTTTCTGG + Intergenic
1054957575 9:70930106-70930128 TTTTTACATCCATCTGTTTGGGG + Intronic
1056259976 9:84839100-84839122 TATTTATTACCACCCATTTGTGG + Intronic
1056282111 9:85051710-85051732 TATTTACAAGGACGTGTTTGGGG + Intergenic
1058579521 9:106439909-106439931 TATTACTAACCACCTAGTTGAGG + Intergenic
1059523754 9:114969196-114969218 TATTTTCAACCAGTTCTTTGTGG - Intergenic
1059722902 9:116978869-116978891 TATTTGCAACTACATATTTTGGG + Intronic
1061689326 9:132312806-132312828 TATTTACAATCACCAAAATGTGG + Intronic
1186310543 X:8313080-8313102 TATCTATTACCACCAATTTGTGG - Intergenic
1186345749 X:8690981-8691003 TAGTAACAACCACCTATCTGTGG - Intronic
1191979246 X:66907872-66907894 TAGGTACAATAACCTATTTGGGG - Intergenic
1192109302 X:68348070-68348092 CACTTACCACCACCTATGTGTGG + Intronic
1194250655 X:91570679-91570701 TATTTACAATGACCAATATGTGG + Intergenic
1194445108 X:93977082-93977104 GATTAACAACTACCTCTTTGGGG + Intergenic
1194565355 X:95480361-95480383 TATTAAGAACAACCTACTTGAGG + Intergenic
1195134273 X:101888295-101888317 TATTCACAACAACCTCTTTTAGG + Intronic
1200105365 X:153709110-153709132 TTTTTAAAACCAGCTATCTGAGG + Intronic
1200569599 Y:4811928-4811950 TATTTACAATGACCAATATGTGG + Intergenic
1201578515 Y:15486749-15486771 TATTTACATGCATCTGTTTGGGG - Intergenic
1202117745 Y:21488335-21488357 CACTTACAACTACCTATTTATGG + Intergenic