ID: 1141161101

View in Genome Browser
Species Human (GRCh38)
Location 16:81629665-81629687
Sequence CCATTTTAGCAGCTGTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 209}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141161096_1141161101 6 Left 1141161096 16:81629636-81629658 CCTCCGAGGCTGCGTCCATCTTC 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1141161101 16:81629665-81629687 CCATTTTAGCAGCTGTGGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 209
1141161097_1141161101 3 Left 1141161097 16:81629639-81629661 CCGAGGCTGCGTCCATCTTCACG 0: 1
1: 0
2: 3
3: 8
4: 83
Right 1141161101 16:81629665-81629687 CCATTTTAGCAGCTGTGGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 209
1141161098_1141161101 -9 Left 1141161098 16:81629651-81629673 CCATCTTCACGCAGCCATTTTAG 0: 1
1: 0
2: 2
3: 2
4: 110
Right 1141161101 16:81629665-81629687 CCATTTTAGCAGCTGTGGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 209
1141161095_1141161101 18 Left 1141161095 16:81629624-81629646 CCTTGCAGTTCTCCTCCGAGGCT 0: 1
1: 0
2: 1
3: 14
4: 153
Right 1141161101 16:81629665-81629687 CCATTTTAGCAGCTGTGGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 209
1141161093_1141161101 28 Left 1141161093 16:81629614-81629636 CCAGTTATGACCTTGCAGTTCTC 0: 1
1: 0
2: 0
3: 13
4: 112
Right 1141161101 16:81629665-81629687 CCATTTTAGCAGCTGTGGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141161101 Original CRISPR CCATTTTAGCAGCTGTGGCC AGG Intronic
901531837 1:9858583-9858605 CCATTTTAGAAGTTGTGTTCAGG - Intronic
903909612 1:26713289-26713311 CCATTTTACCAGCTCTGGTGTGG - Intronic
904373334 1:30064721-30064743 CCTTCTTAGCAGCTGTGGGGAGG + Intergenic
904538984 1:31219965-31219987 CAGGTTTAGCAGCAGTGGCCAGG - Intronic
905552930 1:38858855-38858877 CCATTTCAGTAGTTGTGGCCTGG - Intronic
906383174 1:45345711-45345733 CCTTTTTAAGAGCTGTGGCTTGG - Intronic
910623139 1:89277841-89277863 CCATTTCAGCAGCTTTGCACAGG + Intergenic
912019720 1:105092444-105092466 GCAGTTTAGCAGTTCTGGCCAGG + Intergenic
916604579 1:166328060-166328082 CCAATTTAGCAGCTGTGTTCAGG + Intergenic
916617220 1:166454430-166454452 CCATTTTTGGAGTTGGGGCCTGG - Intergenic
920765996 1:208834413-208834435 CCATTTTAGCATCTTTGAACCGG + Intergenic
922924612 1:229337606-229337628 CCAGTTCAGCAGCTGTGCCAAGG + Intronic
924575822 1:245280124-245280146 CCATTTCAGCAGAAGTAGCCAGG + Intronic
1063548115 10:7001563-7001585 CGATTCAAGCAGCTGAGGCCGGG + Intergenic
1064156594 10:12907913-12907935 ACATTTCAGAAGCTGGGGCCAGG + Intronic
1064990333 10:21251307-21251329 CCCTCTTGGTAGCTGTGGCCAGG + Intergenic
1065178130 10:23098260-23098282 GCAGTATAGCAACTGTGGCCAGG + Intronic
1067053454 10:43038301-43038323 CCAATGAAACAGCTGTGGCCAGG + Intergenic
1068071748 10:52204996-52205018 CCATTTTAGAAGCCCTGCCCTGG - Intronic
1073434514 10:103508111-103508133 CCACTTTCCCAGCTGTTGCCTGG - Intronic
1075739491 10:124685669-124685691 CCATTTTTGCACCACTGGCCTGG + Intronic
1076689964 10:132218205-132218227 CCATTCTGGCAGCTGGGGCAGGG + Intronic
1076709194 10:132321883-132321905 ACATTTTGGCACCTGTGTCCTGG + Intronic
1077070097 11:665836-665858 CCACTTTGTCAGCTCTGGCCAGG - Intronic
1082870309 11:57938244-57938266 CCTTTTTATCATCTGTTGCCTGG + Intergenic
1083349672 11:62018474-62018496 CCAATTCAGCAGCTGTTGGCTGG + Intergenic
1083403471 11:62440656-62440678 CCATTTGGTCAGGTGTGGCCAGG - Intronic
1083482538 11:62959015-62959037 AGATCTTAGCAGCTGGGGCCAGG - Intronic
1084404423 11:68962881-68962903 CCATTGTAGGATGTGTGGCCTGG + Intergenic
1089325776 11:117655822-117655844 CAGTTTTGGCAGCTGTGGCCAGG - Intronic
1089770971 11:120802682-120802704 CCAAGATAGCAGCTGTGGGCAGG - Exonic
1090752797 11:129762276-129762298 CCATTCTGGAAGCTGTGTCCTGG + Intergenic
1093913152 12:24769819-24769841 CCATTTCAGCAGGTGGGGCTTGG + Intergenic
1098390825 12:69968074-69968096 GGGTTTAAGCAGCTGTGGCCAGG + Intergenic
1099966725 12:89454665-89454687 CCATTTTAGCTAGTATGGCCAGG - Intronic
1100424677 12:94473160-94473182 CAATTTGACCAGATGTGGCCTGG + Intergenic
1101590824 12:106123778-106123800 TCTCTTTGGCAGCTGTGGCCTGG - Intronic
1101730666 12:107424597-107424619 CCATTTTCTCAGCTGTAGACTGG + Intronic
1102659974 12:114517862-114517884 TAATTTTAGCAGATGTTGCCAGG + Intergenic
1106090476 13:26588456-26588478 CCATTCAGTCAGCTGTGGCCAGG + Intronic
1107381405 13:39860504-39860526 CCTGTTTAGCAGGTGTGGACAGG + Intergenic
1109722787 13:66297613-66297635 CCATTTTAGCAGGTGTGAAGTGG - Intergenic
1110521500 13:76484350-76484372 CCATCTTAGCAGCAGAGACCAGG - Intergenic
1112335421 13:98511310-98511332 CCATTTTAGTAGGTGTGGAATGG - Intronic
1113702116 13:112395768-112395790 CCATCAAAACAGCTGTGGCCAGG - Intronic
1114059105 14:19002643-19002665 CCCTGTAAGCAGGTGTGGCCAGG - Intergenic
1114103438 14:19399111-19399133 CCCTGTAAGCAGGTGTGGCCAGG + Intergenic
1114601230 14:23956896-23956918 CCTTTTAAGAAGCTATGGCCGGG - Intronic
1114605428 14:23992028-23992050 CCTTTTAAGAAGCTATGGCCGGG - Intronic
1114610919 14:24039682-24039704 CCTTTTAAGAAGCTATGGCCGGG - Intergenic
1115337235 14:32254032-32254054 CTATTTAAGCAGCTGTGGCTTGG - Intergenic
1115883415 14:37945634-37945656 CCGTATAAGCAGGTGTGGCCAGG - Intronic
1120347426 14:83308491-83308513 CCATTTTACCAGCTGGGGTCAGG + Intergenic
1121218012 14:92263729-92263751 GCAATTTAGCAGCTGTTTCCAGG - Intergenic
1122272485 14:100574406-100574428 CCCTTTTCCCAGCTGTGCCCCGG + Intronic
1122957131 14:105076076-105076098 CCAGGTTGGCAGCTGAGGCCAGG + Intergenic
1202836544 14_GL000009v2_random:81418-81440 CCCTGTAAGCAGGTGTGGCCAGG + Intergenic
1123496538 15:20832754-20832776 CCCTGTAAGCAGATGTGGCCAGG - Intergenic
1123496705 15:20833992-20834014 CCCTCTAAGCAGGTGTGGCCTGG + Intergenic
1123553775 15:21406344-21406366 CCCTGTAAGCAGATGTGGCCAGG - Intergenic
1123553940 15:21407584-21407606 CCCTCTAAGCAGGTGTGGCCTGG + Intergenic
1123590017 15:21843709-21843731 CCCTGTAAGCAGATGTGGCCAGG - Intergenic
1123590184 15:21844949-21844971 CCCTCTAAGCAGGTGTGGCCTGG + Intergenic
1125349941 15:38756005-38756027 CTATTGTAGAAGCTGTGGGCTGG + Intergenic
1127013037 15:54650872-54650894 CCATTGTTGGAGCTGTGGCCTGG - Intergenic
1129906785 15:79193398-79193420 CCATGTGACCAGCTCTGGCCGGG - Intergenic
1130014946 15:80179482-80179504 CAATGTGAGAAGCTGTGGCCTGG + Intronic
1130320236 15:82835497-82835519 CCCTTTCAGCAGCTGCAGCCTGG + Exonic
1202962121 15_KI270727v1_random:133540-133562 CCCTGTAAGCAGATGTGGCCAGG - Intergenic
1202962287 15_KI270727v1_random:134780-134802 CCCTCTAAGCAGGTGTGGCCTGG + Intergenic
1132861857 16:2075787-2075809 CCATTACCGCAGCTCTGGCCAGG + Exonic
1132932628 16:2466785-2466807 ACATTTTGGGAGCTGGGGCCAGG + Intergenic
1133905340 16:10016956-10016978 CCCATTAAGCAGCAGTGGCCTGG - Intronic
1135871708 16:26157174-26157196 CCAATTCAGCAGCTAAGGCCTGG - Intergenic
1138014592 16:53417104-53417126 CCGTCCTACCAGCTGTGGCCTGG + Intergenic
1138257216 16:55576566-55576588 TCATTTTAACTGCAGTGGCCAGG - Intronic
1141161101 16:81629665-81629687 CCATTTTAGCAGCTGTGGCCAGG + Intronic
1141451319 16:84105414-84105436 TCAGTTCAGCATCTGTGGCCTGG - Intronic
1142294244 16:89209898-89209920 CCATTTTGGCTCCTGTGGACAGG + Intergenic
1143502883 17:7349152-7349174 CTCTTACAGCAGCTGTGGCCTGG - Exonic
1146681160 17:34809376-34809398 CCATTGTAGAACCTGTGCCCTGG + Intergenic
1147246205 17:39122662-39122684 CCATTGTAGAAGCTCTGACCAGG + Intronic
1147802971 17:43107661-43107683 CCATTTAATCATCTTTGGCCTGG - Intronic
1147853474 17:43460165-43460187 CTATTTTAGAAGCAGTGGGCAGG - Intergenic
1148054473 17:44786007-44786029 ACATTTCAGGAGCTGTCGCCAGG - Intergenic
1152038815 17:77890287-77890309 TGATTGGAGCAGCTGTGGCCCGG + Intergenic
1152532875 17:80930576-80930598 CCATTTTAGAAGCTGCAGCTGGG - Intronic
1153454150 18:5261861-5261883 CCCTGTAAGCAGGTGTGGCCAGG - Intergenic
1154454452 18:14508437-14508459 CCCTGTAAGCAGGTGTGGCCAGG - Intronic
1154454615 18:14509676-14509698 CCCTCTAAGCAGGTGTGGCCTGG + Intronic
1155429234 18:25738187-25738209 CCATCTCAACAGCTGTGTCCAGG + Intergenic
1156591265 18:38491312-38491334 GCATTTCAGCAGTTGTGCCCTGG - Intergenic
1156896932 18:42256773-42256795 CCATGCTAGCAGGTGTGGTCAGG + Intergenic
1157698803 18:49746341-49746363 GCATTTTAGGAGCTTTGGCCAGG - Intergenic
1159968606 18:74621565-74621587 ACATTTAAGCAGCTGTGGGGAGG - Intronic
1162410326 19:10502034-10502056 CCATTTGAGGCGCTGGGGCCGGG - Intronic
1164382694 19:27748440-27748462 CCATTCTAGGAAGTGTGGCCTGG - Intergenic
1164892584 19:31837423-31837445 TCATTTAAGAATCTGTGGCCAGG - Intergenic
1165775145 19:38399916-38399938 CCATTTTAGCTAGAGTGGCCAGG + Intergenic
1202636095 1_KI270706v1_random:45947-45969 CCCTGTAAGCAGGTGTGGCCAGG - Intergenic
925865120 2:8220402-8220424 CCATTTAGGGAGCTGTGGCCGGG + Intergenic
927328779 2:21837729-21837751 CCATTTTAGGAGCTGTAGAATGG - Intergenic
928645432 2:33347290-33347312 CTATTTTACCAGCTGTGCCAGGG - Intronic
930520568 2:52461156-52461178 CAATTTTATCACCAGTGGCCTGG - Intergenic
933405449 2:81851929-81851951 CCATTGTTGGAGATGTGGCCTGG - Intergenic
933781217 2:85802734-85802756 CCATTTGAGCTGCTGTGACATGG - Intergenic
934753344 2:96808664-96808686 CCAGTTTGGCAGCTCTGTCCTGG + Exonic
937727813 2:125187769-125187791 ACATTTTAACAGCTGTGGGGAGG - Intergenic
940905892 2:159169381-159169403 CCATTATCGCAGCTGATGCCAGG - Intronic
941056124 2:160790892-160790914 CCACTTTATGAGCTGGGGCCAGG - Intergenic
947201532 2:227618720-227618742 TCATGTAAGAAGCTGTGGCCGGG + Intronic
948291377 2:236827315-236827337 GGATTTTAGAAGCTCTGGCCAGG + Intergenic
948768598 2:240235998-240236020 CCATCACTGCAGCTGTGGCCAGG - Intergenic
1168889734 20:1287174-1287196 CCCTTTTGGCATCAGTGGCCAGG + Intronic
1170719213 20:18860406-18860428 CCAATTTTGCAGGTGGGGCCAGG + Intergenic
1171287287 20:23951617-23951639 CCATTTCAGCATCTGTTTCCAGG + Intergenic
1171324906 20:24282750-24282772 CCATTTTGGCTCCTGTGGGCAGG - Intergenic
1171882236 20:30626887-30626909 CCCTGTAAGCAGGTGTGGCCAGG - Intergenic
1171882397 20:30628125-30628147 CCCTGTAAGCAGGTGTGGCCAGG + Intergenic
1172673092 20:36647861-36647883 GGGTTTTAGCAGCTCTGGCCAGG - Intergenic
1173090756 20:39968824-39968846 TCATTGGAGCAGCTCTGGCCAGG - Intergenic
1174611930 20:51804850-51804872 CCAGTTTAACAGCTGCAGCCAGG + Intergenic
1175698360 20:61119438-61119460 CCATTCTAGCAGCTGTGTGGTGG - Intergenic
1176088393 20:63308294-63308316 CCACATTAGCAGCTCTGGCTGGG + Intronic
1176819553 21:13643632-13643654 CCCTCTAAGCAGGTGTGGCCTGG - Intergenic
1176819718 21:13644865-13644887 CCCTGTAAGCAGGTGTGGCCAGG + Intergenic
1178408385 21:32344717-32344739 CCATTTCAGCAGCTCTGGAAGGG - Exonic
1179384998 21:40933461-40933483 CCATTTCAGCAGCAGTGGGGAGG - Intergenic
1179568370 21:42263193-42263215 CCCTGTTAGCTGCTGTGGCTGGG - Intronic
1179983181 21:44907030-44907052 CCTCATGAGCAGCTGTGGCCGGG + Exonic
1180364623 22:11927289-11927311 CCCTGTAAGCAGGTGTGGCCAGG + Intergenic
1180477589 22:15725259-15725281 CCCTGTAAGCAGGTGTGGCCAGG - Intergenic
1182190475 22:28455213-28455235 CCATGTTAGCAGCTGAGGTTAGG + Intronic
1183701517 22:39453845-39453867 CCCTTTCAGCAGCTGCTGCCTGG - Intergenic
1184591343 22:45485512-45485534 CCCTTTTCACAGCGGTGGCCTGG + Intergenic
950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG + Intronic
954541772 3:51397777-51397799 CCTTTTTTGCAGCTCTAGCCAGG - Exonic
954790656 3:53130744-53130766 CCCTTTTGGCAGATGAGGCCAGG - Intergenic
955937244 3:64113395-64113417 CCCTCTAAGCAGGTGTGGCCAGG - Intronic
958540200 3:95461330-95461352 CCATTGTTGCAGGTGGGGCCTGG - Intergenic
961513796 3:127420450-127420472 CAGGTCTAGCAGCTGTGGCCAGG + Intergenic
965392597 3:168123013-168123035 CCTTTTGAGCAGCTGTGCCTGGG - Intergenic
966421559 3:179739310-179739332 CCTTTCTAGCAGCTGCAGCCAGG + Intronic
968838436 4:2982132-2982154 CCAGGTCAGCAGCTGTGGCTGGG + Intronic
972343718 4:38175454-38175476 CCATTTAACCAGCTCTGGACTGG - Intergenic
973365903 4:49209333-49209355 CCCTGTAAGCAGGTGTGGCCAGG - Intergenic
973366066 4:49210572-49210594 CCCTGTAAGCAGGTGTGGCCAGG + Intergenic
973394533 4:49581879-49581901 CCCTGTAAGCAGGTGTGGCCAGG - Intergenic
973394696 4:49583118-49583140 CCCTGTAAGCAGGTGTGGCCAGG + Intergenic
975300431 4:72783885-72783907 CCATTTTAGTAGATGTGTCTTGG - Intergenic
978723298 4:111940701-111940723 GTATTTTAGGAGCTCTGGCCAGG - Intergenic
979668683 4:123340022-123340044 CCATGTTGGGAGCTTTGGCCTGG + Intergenic
979773626 4:124559921-124559943 CCCTTTTCGCAGTGGTGGCCTGG + Intergenic
980135679 4:128856428-128856450 GCACTTAAACAGCTGTGGCCTGG + Intronic
983546353 4:168968597-168968619 CTGGTATAGCAGCTGTGGCCAGG + Intronic
1202763410 4_GL000008v2_random:131814-131836 CCCTGTAAGCAGGTGTGGCCAGG - Intergenic
991577689 5:68122231-68122253 CCATTAAAGCAGGTGTGGTCAGG - Intergenic
991771692 5:70046937-70046959 CCACTTGAGCCGCTGTGCCCAGG - Intergenic
991850983 5:70922344-70922366 CCACTTGAGCCGCTGTGCCCAGG - Intergenic
994439710 5:99787028-99787050 CCATTTTAGTAGCTGTGCAGTGG + Intergenic
995484687 5:112628401-112628423 ACACTTCAGCAGCTTTGGCCAGG - Intergenic
997101791 5:130977722-130977744 CCATTTTAACAGCTGTGTAGTGG + Intergenic
997270358 5:132531650-132531672 CCCTTTTAGCCTCTGTGTCCTGG + Intergenic
999438821 5:151585322-151585344 AAAATTTATCAGCTGTGGCCAGG + Intergenic
1000222619 5:159228358-159228380 CCATTTTAGCAGAAGCGCCCTGG - Intergenic
1000487324 5:161863587-161863609 CCAATTTTGGAGCTGGGGCCTGG - Intronic
1002583903 5:180229191-180229213 CAATTTTAGCATCACTGGCCTGG + Intergenic
1006042991 6:31270797-31270819 CCACTGCAGCAGCTGTGGTCAGG - Intronic
1007745789 6:44042341-44042363 CCTTTGTAGCAGGTGTGGGCTGG - Intergenic
1015672621 6:135707591-135707613 CAATCTTGGCAACTGTGGCCTGG + Intergenic
1017199821 6:151740492-151740514 CCATTTTGTCAGCTGTGGGATGG - Intronic
1018434898 6:163750968-163750990 CCCTTTTTGCAGCCATGGCCTGG - Intergenic
1019160075 6:170063617-170063639 GCACATTAGCAGCTGTGGCGTGG - Intergenic
1019720394 7:2567013-2567035 CTGTTTCAGCAGCTGTGGACGGG + Intronic
1019826270 7:3286961-3286983 CCAGTGTTGCAGGTGTGGCCTGG + Intergenic
1020447574 7:8285401-8285423 CCAGACTAGCAGCTATGGCCAGG - Intergenic
1022176801 7:27878867-27878889 CCATTTCAGTAGTTGTTGCCTGG - Intronic
1022388986 7:29927395-29927417 GCATATAAACAGCTGTGGCCTGG + Intronic
1028069846 7:86437664-86437686 CCATTTTAGCATCTGCTTCCAGG + Intergenic
1028226169 7:88255133-88255155 CCATCTTATCAGCTCTGGACAGG + Intergenic
1029638765 7:101804793-101804815 CCATTCTGGCAGCTATGGCTGGG - Intergenic
1030801022 7:113852089-113852111 CCACTTTAGCTGATGTGGCAGGG + Intergenic
1035096889 7:156363091-156363113 GCACTTTGGCAGCTGTGCCCTGG - Intergenic
1035240381 7:157525427-157525449 CCATTCTAGCAGATGTGGGGTGG - Intergenic
1038289644 8:26237360-26237382 CCAGTTTTGCAGGTGGGGCCTGG + Intergenic
1039259514 8:35755635-35755657 CAGTTCTAGAAGCTGTGGCCAGG - Intronic
1039264392 8:35808905-35808927 CCATGCTAGCAGGTGTGGACAGG - Intergenic
1040087945 8:43365247-43365269 CCCTGTAAGCAGGTGTGGCCAGG - Intergenic
1040088173 8:43366806-43366828 CCCTGTAAGCAGGTGTGGCCAGG + Intergenic
1040404296 8:47085311-47085333 CCCTGTAAGCAGGTGTGGCCAGG - Intergenic
1042201337 8:66281823-66281845 TCATTGTAACAGCTGTGCCCTGG + Intergenic
1043211909 8:77530406-77530428 GCATTTCAGCAGCTCTGGCATGG - Intergenic
1044059927 8:87623749-87623771 CCACTTTATCAGCTAAGGCCTGG + Intergenic
1046292568 8:112181873-112181895 CCATTTTGGAAGCAGTGACCTGG + Intergenic
1048383634 8:133890861-133890883 CCAGTGTTGCAGCTGGGGCCTGG + Intergenic
1055199747 9:73646153-73646175 CCATTTCAACAGCTGGTGCCAGG - Intergenic
1055628278 9:78196425-78196447 CTTTTTCAGAAGCTGTGGCCTGG + Intergenic
1056499147 9:87190660-87190682 CCATCAGATCAGCTGTGGCCTGG + Intergenic
1057110303 9:92463546-92463568 CCATGTCAGGAGATGTGGCCTGG + Intronic
1058286176 9:103181808-103181830 CCATTTTAGCTTCTGTGGGTGGG + Intergenic
1060444748 9:123677722-123677744 CCATTCTAAGAGCCGTGGCCAGG - Intronic
1060964819 9:127706630-127706652 CCTGTTCTGCAGCTGTGGCCTGG - Intronic
1061550463 9:131331544-131331566 CCATTTGACAAGCTGTGGGCAGG + Intergenic
1061781487 9:132999056-132999078 CCTTCTTAGCAGCTGGGGCAGGG + Intergenic
1203527643 Un_GL000213v1:104705-104727 CCCTGTAAGCAGGTGTGGCCAGG - Intergenic
1203527806 Un_GL000213v1:105938-105960 CCCTCTAAGCAGGTGTGGCCTGG + Intergenic
1203544168 Un_KI270743v1:116687-116709 CCCTGTAAGCAGGTGTGGCCAGG - Intergenic
1188815418 X:34706362-34706384 CCATCCTGGCAGCTGTGGCATGG - Intergenic
1193558014 X:82980717-82980739 GTATTTAAGGAGCTGTGGCCTGG + Intergenic
1193679699 X:84502720-84502742 CCATTTGAGCAGGTGCTGCCTGG + Intergenic
1195087567 X:101426724-101426746 CCATTTTACCATCTGTGACAAGG - Intronic
1195346370 X:103954338-103954360 CCCTGTAAGCAGGTGTGGCCAGG - Intronic
1195361085 X:104084506-104084528 CCCTGTAAGCAGGTGTGGCCAGG + Intergenic
1196539294 X:116885854-116885876 CTAGTTTAGGAGCTTTGGCCTGG - Intergenic
1198040184 X:132843036-132843058 CCATTTTGGCATCTGTTGGCAGG + Intronic
1198556877 X:137804053-137804075 CAATTTTAGAAGTTGTGACCAGG + Intergenic
1199940908 X:152626833-152626855 CCATTTTCTCAGCAGTGGGCTGG + Intergenic
1200060247 X:153480821-153480843 CCCTCATGGCAGCTGTGGCCTGG - Intronic