ID: 1141163913

View in Genome Browser
Species Human (GRCh38)
Location 16:81647816-81647838
Sequence CAGGGTGGCCACAGGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141163913_1141163927 10 Left 1141163913 16:81647816-81647838 CCCTCATCCCTGTGGCCACCCTG No data
Right 1141163927 16:81647849-81647871 CAGAGCCTCTTCTGGGAACAGGG No data
1141163913_1141163924 2 Left 1141163913 16:81647816-81647838 CCCTCATCCCTGTGGCCACCCTG No data
Right 1141163924 16:81647841-81647863 CTGGGGCTCAGAGCCTCTTCTGG 0: 1
1: 0
2: 5
3: 37
4: 271
1141163913_1141163925 3 Left 1141163913 16:81647816-81647838 CCCTCATCCCTGTGGCCACCCTG No data
Right 1141163925 16:81647842-81647864 TGGGGCTCAGAGCCTCTTCTGGG 0: 1
1: 1
2: 2
3: 28
4: 239
1141163913_1141163926 9 Left 1141163913 16:81647816-81647838 CCCTCATCCCTGTGGCCACCCTG No data
Right 1141163926 16:81647848-81647870 TCAGAGCCTCTTCTGGGAACAGG No data
1141163913_1141163928 11 Left 1141163913 16:81647816-81647838 CCCTCATCCCTGTGGCCACCCTG No data
Right 1141163928 16:81647850-81647872 AGAGCCTCTTCTGGGAACAGGGG 0: 1
1: 0
2: 0
3: 26
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141163913 Original CRISPR CAGGGTGGCCACAGGGATGA GGG (reversed) Intronic
No off target data available for this crispr